ID: 959279149

View in Genome Browser
Species Human (GRCh38)
Location 3:104316242-104316264
Sequence TGCTGCTGGTGGGTGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959279149_959279160 14 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279160 3:104316279-104316301 CAGCTCTGGGCAGTGAGGGAGGG No data
959279149_959279156 1 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279156 3:104316266-104316288 TTGCTGTGGAGTGCAGCTCTGGG No data
959279149_959279159 13 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279159 3:104316278-104316300 GCAGCTCTGGGCAGTGAGGGAGG No data
959279149_959279158 10 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279158 3:104316275-104316297 AGTGCAGCTCTGGGCAGTGAGGG No data
959279149_959279155 0 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279149_959279157 9 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279157 3:104316274-104316296 GAGTGCAGCTCTGGGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959279149 Original CRISPR TGCTGCTGGTGGGTGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr