ID: 959279151

View in Genome Browser
Species Human (GRCh38)
Location 3:104316252-104316274
Sequence CCACAGCAACTGCTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959279151_959279155 -10 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279151_959279160 4 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279160 3:104316279-104316301 CAGCTCTGGGCAGTGAGGGAGGG No data
959279151_959279159 3 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279159 3:104316278-104316300 GCAGCTCTGGGCAGTGAGGGAGG No data
959279151_959279156 -9 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279156 3:104316266-104316288 TTGCTGTGGAGTGCAGCTCTGGG No data
959279151_959279158 0 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279158 3:104316275-104316297 AGTGCAGCTCTGGGCAGTGAGGG No data
959279151_959279157 -1 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279157 3:104316274-104316296 GAGTGCAGCTCTGGGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959279151 Original CRISPR CCACAGCAACTGCTGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr