ID: 959279155

View in Genome Browser
Species Human (GRCh38)
Location 3:104316265-104316287
Sequence GTTGCTGTGGAGTGCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959279151_959279155 -10 Left 959279151 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279149_959279155 0 Left 959279149 3:104316242-104316264 CCCTCTCTCACCCACCAGCAGCA No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279148_959279155 4 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279150_959279155 -1 Left 959279150 3:104316243-104316265 CCTCTCTCACCCACCAGCAGCAG No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959279155 Original CRISPR GTTGCTGTGGAGTGCAGCTC TGG Intergenic
No off target data available for this crispr