ID: 959279320

View in Genome Browser
Species Human (GRCh38)
Location 3:104317442-104317464
Sequence GGCACTTCTGGACCTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959279313_959279320 16 Left 959279313 3:104317403-104317425 CCAGATAGACTTCTAAGGTGTTT No data
Right 959279320 3:104317442-104317464 GGCACTTCTGGACCTACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959279320 Original CRISPR GGCACTTCTGGACCTACCCA GGG Intergenic
No off target data available for this crispr