ID: 959282182

View in Genome Browser
Species Human (GRCh38)
Location 3:104358261-104358283
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959282180_959282182 18 Left 959282180 3:104358220-104358242 CCTTGAATTGAGTTGTAAGAACT No data
Right 959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG No data
959282181_959282182 -8 Left 959282181 3:104358246-104358268 CCTTTAATGAGCAATGTTGCATT No data
Right 959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr