ID: 959293992

View in Genome Browser
Species Human (GRCh38)
Location 3:104512437-104512459
Sequence AACTGAATCTTGCTTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959293992_959293993 18 Left 959293992 3:104512437-104512459 CCAGTTATAAGCAAGATTCAGTT No data
Right 959293993 3:104512478-104512500 AAAGCCATTTAATTTCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959293992 Original CRISPR AACTGAATCTTGCTTATAAC TGG (reversed) Intergenic
No off target data available for this crispr