ID: 959301728

View in Genome Browser
Species Human (GRCh38)
Location 3:104610996-104611018
Sequence CCTAAGCCCACGTTTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959301723_959301728 30 Left 959301723 3:104610943-104610965 CCCAATACCTGGTACATTGCAAG No data
Right 959301728 3:104610996-104611018 CCTAAGCCCACGTTTTTTTGTGG No data
959301726_959301728 23 Left 959301726 3:104610950-104610972 CCTGGTACATTGCAAGGACAAAA No data
Right 959301728 3:104610996-104611018 CCTAAGCCCACGTTTTTTTGTGG No data
959301724_959301728 29 Left 959301724 3:104610944-104610966 CCAATACCTGGTACATTGCAAGG No data
Right 959301728 3:104610996-104611018 CCTAAGCCCACGTTTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959301728 Original CRISPR CCTAAGCCCACGTTTTTTTG TGG Intergenic
No off target data available for this crispr