ID: 959317929

View in Genome Browser
Species Human (GRCh38)
Location 3:104832942-104832964
Sequence TCAGCTCAGCCGAGCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959317929_959317932 18 Left 959317929 3:104832942-104832964 CCAGAGAAGCTCGGCTGAGCTGA No data
Right 959317932 3:104832983-104833005 TTTATTGAGGCTTCATATTTAGG No data
959317929_959317930 5 Left 959317929 3:104832942-104832964 CCAGAGAAGCTCGGCTGAGCTGA No data
Right 959317930 3:104832970-104832992 GCTGTCCAGAGAGTTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959317929 Original CRISPR TCAGCTCAGCCGAGCTTCTC TGG (reversed) Intergenic
No off target data available for this crispr