ID: 959319329

View in Genome Browser
Species Human (GRCh38)
Location 3:104850832-104850854
Sequence GCAGCTTTCAGAACTGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959319322_959319329 24 Left 959319322 3:104850785-104850807 CCAACCTTCAGACTCAGTTAATC No data
Right 959319329 3:104850832-104850854 GCAGCTTTCAGAACTGGAATTGG No data
959319321_959319329 25 Left 959319321 3:104850784-104850806 CCCAACCTTCAGACTCAGTTAAT No data
Right 959319329 3:104850832-104850854 GCAGCTTTCAGAACTGGAATTGG No data
959319323_959319329 20 Left 959319323 3:104850789-104850811 CCTTCAGACTCAGTTAATCATTA No data
Right 959319329 3:104850832-104850854 GCAGCTTTCAGAACTGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959319329 Original CRISPR GCAGCTTTCAGAACTGGAAT TGG Intergenic
No off target data available for this crispr