ID: 959321546

View in Genome Browser
Species Human (GRCh38)
Location 3:104882108-104882130
Sequence TCCACCAAGTAAAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959321540_959321546 18 Left 959321540 3:104882067-104882089 CCTTTCTTACAACAACAATTTAG No data
Right 959321546 3:104882108-104882130 TCCACCAAGTAAAAGCTGGTGGG No data
959321539_959321546 30 Left 959321539 3:104882055-104882077 CCATAGAGACAACCTTTCTTACA No data
Right 959321546 3:104882108-104882130 TCCACCAAGTAAAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959321546 Original CRISPR TCCACCAAGTAAAAGCTGGT GGG Intergenic
No off target data available for this crispr