ID: 959324112

View in Genome Browser
Species Human (GRCh38)
Location 3:104914188-104914210
Sequence CTGAATAAGCAGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959324109_959324112 -3 Left 959324109 3:104914168-104914190 CCCAGGTGATTTTGGAGAGGCTG No data
Right 959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG No data
959324105_959324112 5 Left 959324105 3:104914160-104914182 CCGTGGTCCCCAGGTGATTTTGG No data
Right 959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG No data
959324110_959324112 -4 Left 959324110 3:104914169-104914191 CCAGGTGATTTTGGAGAGGCTGA No data
Right 959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG No data
959324108_959324112 -2 Left 959324108 3:104914167-104914189 CCCCAGGTGATTTTGGAGAGGCT No data
Right 959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959324112 Original CRISPR CTGAATAAGCAGAGGCAAGA AGG Intergenic
No off target data available for this crispr