ID: 959332151

View in Genome Browser
Species Human (GRCh38)
Location 3:105020107-105020129
Sequence CCTGAGTATCACAAGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959332151_959332156 21 Left 959332151 3:105020107-105020129 CCCTTAATCTTGTGATACTCAGG No data
Right 959332156 3:105020151-105020173 ATTACATAAATTCAGCACTAAGG No data
959332151_959332155 -3 Left 959332151 3:105020107-105020129 CCCTTAATCTTGTGATACTCAGG No data
Right 959332155 3:105020127-105020149 AGGGTATGAATTCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959332151 Original CRISPR CCTGAGTATCACAAGATTAA GGG (reversed) Intergenic
No off target data available for this crispr