ID: 959332155

View in Genome Browser
Species Human (GRCh38)
Location 3:105020127-105020149
Sequence AGGGTATGAATTCAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959332150_959332155 21 Left 959332150 3:105020083-105020105 CCTACTTTCTGAACATTGTTCAG No data
Right 959332155 3:105020127-105020149 AGGGTATGAATTCAGCAGCAAGG No data
959332153_959332155 -4 Left 959332153 3:105020108-105020130 CCTTAATCTTGTGATACTCAGGG No data
Right 959332155 3:105020127-105020149 AGGGTATGAATTCAGCAGCAAGG No data
959332151_959332155 -3 Left 959332151 3:105020107-105020129 CCCTTAATCTTGTGATACTCAGG No data
Right 959332155 3:105020127-105020149 AGGGTATGAATTCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959332155 Original CRISPR AGGGTATGAATTCAGCAGCA AGG Intergenic
No off target data available for this crispr