ID: 959335260

View in Genome Browser
Species Human (GRCh38)
Location 3:105056858-105056880
Sequence GCAGGAGGAAGCGAGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959335260_959335265 -10 Left 959335260 3:105056858-105056880 CCGCCCCGCTCGCTTCCTCCTGC No data
Right 959335265 3:105056871-105056893 TTCCTCCTGCATCAGCCAGGTGG No data
959335260_959335266 -9 Left 959335260 3:105056858-105056880 CCGCCCCGCTCGCTTCCTCCTGC No data
Right 959335266 3:105056872-105056894 TCCTCCTGCATCAGCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959335260 Original CRISPR GCAGGAGGAAGCGAGCGGGG CGG (reversed) Intergenic