ID: 959350011

View in Genome Browser
Species Human (GRCh38)
Location 3:105250157-105250179
Sequence TTCAGTACTCTCAACAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959350011_959350013 -7 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350013 3:105250173-105250195 TACTGAAGAGTTGCTTTTCATGG No data
959350011_959350017 26 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350017 3:105250206-105250228 GGATGATAAAAGTCTTCACTGGG No data
959350011_959350014 4 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350014 3:105250184-105250206 TGCTTTTCATGGTGTAGTTTAGG No data
959350011_959350016 25 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350016 3:105250205-105250227 GGGATGATAAAAGTCTTCACTGG No data
959350011_959350015 5 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350015 3:105250185-105250207 GCTTTTCATGGTGTAGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959350011 Original CRISPR TTCAGTACTCTCAACAAGTT GGG (reversed) Intergenic
No off target data available for this crispr