ID: 959350015

View in Genome Browser
Species Human (GRCh38)
Location 3:105250185-105250207
Sequence GCTTTTCATGGTGTAGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959350011_959350015 5 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350015 3:105250185-105250207 GCTTTTCATGGTGTAGTTTAGGG No data
959350012_959350015 4 Left 959350012 3:105250158-105250180 CCAACTTGTTGAGAGTACTGAAG No data
Right 959350015 3:105250185-105250207 GCTTTTCATGGTGTAGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959350015 Original CRISPR GCTTTTCATGGTGTAGTTTA GGG Intergenic
No off target data available for this crispr