ID: 959350016

View in Genome Browser
Species Human (GRCh38)
Location 3:105250205-105250227
Sequence GGGATGATAAAAGTCTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959350011_959350016 25 Left 959350011 3:105250157-105250179 CCCAACTTGTTGAGAGTACTGAA No data
Right 959350016 3:105250205-105250227 GGGATGATAAAAGTCTTCACTGG No data
959350012_959350016 24 Left 959350012 3:105250158-105250180 CCAACTTGTTGAGAGTACTGAAG No data
Right 959350016 3:105250205-105250227 GGGATGATAAAAGTCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959350016 Original CRISPR GGGATGATAAAAGTCTTCAC TGG Intergenic
No off target data available for this crispr