ID: 959356371

View in Genome Browser
Species Human (GRCh38)
Location 3:105334601-105334623
Sequence AGCCCTGTGAAAGCTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959356371_959356374 10 Left 959356371 3:105334601-105334623 CCAAACACAGCTTTCACAGGGCT No data
Right 959356374 3:105334634-105334656 GAGAACACCTTAACTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959356371 Original CRISPR AGCCCTGTGAAAGCTGTGTT TGG (reversed) Intergenic
No off target data available for this crispr