ID: 959358974

View in Genome Browser
Species Human (GRCh38)
Location 3:105366813-105366835
Sequence CTGCGTCCGGGGAAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959358966_959358974 -9 Left 959358966 3:105366799-105366821 CCACCTGCTTTGCGCTGCGTCCG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 331
959358964_959358974 18 Left 959358964 3:105366772-105366794 CCTCTAGGCTGCGGATCCGCGCT 0: 1
1: 0
2: 0
3: 2
4: 19
Right 959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 331
959358962_959358974 27 Left 959358962 3:105366763-105366785 CCTGCAGCGCCTCTAGGCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 123
Right 959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 331
959358965_959358974 2 Left 959358965 3:105366788-105366810 CCGCGCTTCAACCACCTGCTTTG 0: 1
1: 0
2: 0
3: 11
4: 210
Right 959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959358974 Original CRISPR CTGCGTCCGGGGAAGTGGGG AGG Intergenic
900830578 1:4962494-4962516 CAGCGTCCAGGGCTGTGGGGAGG - Intergenic
900992430 1:6104177-6104199 CAGGGTCCGGGGGAGTGGGTGGG + Exonic
901182742 1:7352709-7352731 CTGGTTGCTGGGAAGTGGGGTGG + Intronic
902148205 1:14420911-14420933 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
902985640 1:20152562-20152584 CTGGGTCCAGGGCAGAGGGGCGG - Intergenic
905206194 1:36344090-36344112 CTGCCTCCCGGGGGGTGGGGGGG - Intronic
908292680 1:62684126-62684148 CTGAACCCGGGGCAGTGGGGTGG + Intronic
908301064 1:62761491-62761513 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
909051720 1:70775039-70775061 CTGCTTCCCTGGGAGTGGGGAGG + Intergenic
909678519 1:78265005-78265027 TGGAGTCGGGGGAAGTGGGGAGG - Intergenic
910334298 1:86110537-86110559 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
910625607 1:89303203-89303225 CTGCTTGCGGGGAGGTGTGGGGG - Intergenic
912824656 1:112894676-112894698 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
914753242 1:150549610-150549632 CTGGGTCCGGGGTCGTGGCGGGG - Intronic
915345069 1:155193142-155193164 CTGGCTCCGGGGGAGGGGGGAGG + Intergenic
916991662 1:170251120-170251142 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
918154534 1:181832393-181832415 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
918308362 1:183267598-183267620 CTGTGCCCTGGGGAGTGGGGGGG + Intronic
919991239 1:202709781-202709803 CGCCGTCGTGGGAAGTGGGGCGG - Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921675145 1:217968383-217968405 GTGAGTCCTGGGAGGTGGGGAGG - Intergenic
922546814 1:226464175-226464197 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
923161345 1:231317438-231317460 CTGCTTCCGGGGAGGTGTGGAGG + Intergenic
923181981 1:231528621-231528643 CTGCGTCCGGAGGGGAGGGGAGG - Intergenic
1062836749 10:640715-640737 CTGCGCGCGGGGAAGAGGGTGGG + Intronic
1063152315 10:3347892-3347914 CTGCGTCTGGGTTAGTGGGGAGG - Intergenic
1066540550 10:36442102-36442124 ATGGGTCCAGGGAAGGGGGGGGG - Intergenic
1066613639 10:37275707-37275729 CTGCTTGCAGGGAAGTGTGGAGG - Intronic
1067546638 10:47196750-47196772 CTGGGTCCAGGGATGTGGGGTGG - Intergenic
1068211294 10:53924160-53924182 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
1068821008 10:61377253-61377275 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1069090855 10:64197154-64197176 CTGCTTGCAGGGAGGTGGGGAGG - Intergenic
1073467099 10:103700613-103700635 CAGGGTTAGGGGAAGTGGGGAGG + Intronic
1074516929 10:114179197-114179219 CTGCTTCCGGGGAAGGCGGAGGG + Intergenic
1074829856 10:117240935-117240957 CTGGGTCCGGGGAAGAGGCGCGG + Intergenic
1075728113 10:124620919-124620941 CAGCTTGCGGGGAGGTGGGGAGG + Exonic
1076638761 10:131900492-131900514 CCGCGTCGGGGGCAGTGGGCGGG + Intergenic
1077914761 11:6603944-6603966 CAGAGTTGGGGGAAGTGGGGAGG - Exonic
1078070127 11:8102933-8102955 CTGAATCGGGGGAAGTGGGGAGG - Exonic
1081047731 11:38296660-38296682 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1081136192 11:39442445-39442467 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1082181791 11:49128904-49128926 CTGGGGTGGGGGAAGTGGGGAGG - Intergenic
1082628477 11:55513544-55513566 CTGCTTCTGGGGGAGGGGGGTGG - Intergenic
1084387702 11:68854615-68854637 CAGGGTCGGGGGAGGTGGGGAGG + Intergenic
1084590661 11:70088129-70088151 CTGCGTGGGGGGCAGTAGGGGGG + Intronic
1084935351 11:72583922-72583944 CTGCTTCCAGGGAAGAGAGGAGG + Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085687652 11:78638825-78638847 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1087400966 11:97667060-97667082 CTGCTTGTGGGGAGGTGGGGAGG + Intergenic
1087977302 11:104565317-104565339 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1088135936 11:106555175-106555197 CTGCTGCCGGGGAATGGGGGAGG + Intergenic
1089666819 11:120025876-120025898 CGGCTTGCGGGGAAGTGTGGAGG + Intergenic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1091803752 12:3341816-3341838 CTGCCTCCGGGGAAGGGGACAGG + Intergenic
1096621439 12:52868048-52868070 CTGCCTCCCGGGAAGGGGGTTGG - Intergenic
1096982773 12:55737905-55737927 GTGCCTCTGGGGGAGTGGGGAGG - Intergenic
1097918192 12:65042024-65042046 CTGCATCTGGGGGAGTGGAGAGG + Intergenic
1098377955 12:69837456-69837478 CTGTCTCCGGGGGAGTGGAGAGG + Intronic
1099354104 12:81611703-81611725 ATGCCTCTGGGGGAGTGGGGAGG + Intronic
1100283081 12:93137205-93137227 CTGGGGTGGGGGAAGTGGGGAGG + Intergenic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102820175 12:115901878-115901900 CTGAGTCCTGGGGAGTCGGGAGG + Intergenic
1104912800 12:132247766-132247788 CAGCGTCCGGGGATGGGGTGAGG - Intronic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1105593847 13:21817925-21817947 CTGCTTGCGGGAAAGTGTGGAGG + Intergenic
1105863918 13:24442102-24442124 AAGCGTGAGGGGAAGTGGGGAGG + Intronic
1108382552 13:49868197-49868219 GTGAGTTGGGGGAAGTGGGGAGG - Intergenic
1109829989 13:67773300-67773322 CTGCTTGCAGGGAAGTGAGGAGG - Intergenic
1109884343 13:68523920-68523942 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1111587311 13:90298724-90298746 CTGAGTTTGGGGAAGTGAGGAGG + Intergenic
1112077800 13:95931819-95931841 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1112487576 13:99834040-99834062 CTGCCTCCTTGGAAGTGGGAGGG + Intronic
1113329607 13:109315693-109315715 CTGAGTGCGGGGCAGTGGGGAGG - Intergenic
1113330221 13:109319443-109319465 CTGCTTGCAGGGAAGTGTGGAGG - Intergenic
1115284210 14:31700523-31700545 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
1115421392 14:33199122-33199144 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1118597791 14:67449463-67449485 CAGGGTGTGGGGAAGTGGGGTGG + Intronic
1119011538 14:70995795-70995817 CTGCAGCCTGGGAAGGGGGGCGG - Exonic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123825611 15:24078814-24078836 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124418171 15:29491255-29491277 CTGCTTACGGGGAGGTGTGGAGG - Intronic
1125479202 15:40069149-40069171 CTGCGGGTGGGGCAGTGGGGTGG - Intergenic
1125764416 15:42123635-42123657 CTGGGTCCTGGGATGAGGGGTGG - Intergenic
1125775359 15:42207999-42208021 CTGAGGCCGGGGAAGTGGACAGG - Intronic
1127165715 15:56243591-56243613 CAGCGGCCGGGGCTGTGGGGGGG + Intergenic
1127515478 15:59689259-59689281 CTGCGGCCGGGGGATTGGGCCGG - Exonic
1129189314 15:73928016-73928038 CTGGGTCGGGGGAAGTCGGGAGG - Intronic
1129599369 15:76989335-76989357 CTGGGACAGGGTAAGTGGGGTGG + Intergenic
1129655934 15:77525810-77525832 CTGAGTCGGGGGAGGTGGGCAGG + Intergenic
1131014239 15:89044045-89044067 GTGGGTTGGGGGAAGTGGGGAGG - Intergenic
1132147388 15:99436859-99436881 CTGGATGCGGGGGAGTGGGGTGG + Intergenic
1133287953 16:4699251-4699273 CTGAGCCTGGGGAAGTGGTGGGG - Intronic
1135340079 16:21637744-21637766 CTGCTCGCGGGGAAGTGTGGAGG - Intronic
1136553173 16:30992628-30992650 CTACGTGCGGGGACGGGGGGGGG + Exonic
1136570343 16:31093158-31093180 CTGCGGGTGGGGATGTGGGGAGG - Intronic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1137614654 16:49839157-49839179 CTGGGTCCTGGGATGAGGGGAGG - Intronic
1140221620 16:73048156-73048178 CACCGCCCGGGGAAGGGGGGCGG + Exonic
1141839799 16:86567273-86567295 CTGCGGCCGGGGGAGCGAGGGGG - Exonic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1143697516 17:8631015-8631037 GTGCGGCCGGGGCAGTGGCGCGG + Intergenic
1143749837 17:9020705-9020727 CTGCCTCAGGGGATCTGGGGAGG + Intergenic
1145236217 17:21210099-21210121 CTGGGTCCACGGAGGTGGGGAGG - Intronic
1145961965 17:28892100-28892122 CTCTGACCTGGGAAGTGGGGTGG + Intronic
1145976341 17:28986340-28986362 CTGGGCCCTGGGAAGTGAGGCGG - Intronic
1146123047 17:30211598-30211620 CTGCCTCCCAGGAACTGGGGTGG - Intronic
1147805305 17:43126818-43126840 CTGCTTGCGGGGAAGTGTGGAGG + Intergenic
1147845463 17:43401353-43401375 CTAAGACTGGGGAAGTGGGGAGG - Intergenic
1147971300 17:44220072-44220094 CCGCCGCCGGGGAAGGGGGGGGG + Intronic
1148145256 17:45360678-45360700 CTAGGTGTGGGGAAGTGGGGTGG + Intergenic
1150294878 17:64002275-64002297 CTGCTTCCTGGGATGAGGGGTGG - Exonic
1151890991 17:76950135-76950157 CTGCCTCCCGGGAAGGGTGGAGG - Exonic
1151897767 17:76991825-76991847 CTGCGTCAGTGGAGGTGGGCAGG + Intergenic
1152068996 17:78125969-78125991 CTGGGTCCTGGGAAGGGGTGAGG - Intronic
1156271842 18:35542387-35542409 CTGAGTCTGTGGCAGTGGGGTGG + Intergenic
1156657787 18:39309071-39309093 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1157736626 18:50055239-50055261 GTGAGTCCGGGGCAGGGGGGCGG - Intronic
1159322178 18:66866678-66866700 CAGCTTCCGGGGAGGTGTGGAGG + Intergenic
1159962655 18:74567562-74567584 CGGCCTCAGGGGAGGTGGGGTGG + Intronic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160830414 19:1102096-1102118 CTGAGTCGGGGGCAGTGGCGGGG + Intergenic
1161150091 19:2702845-2702867 CTGCGCCCAGGAGAGTGGGGCGG + Intergenic
1161469228 19:4448021-4448043 CTGAGACCCGGGGAGTGGGGTGG + Intronic
1161476903 19:4491270-4491292 CTGCGCCGGGGGGGGTGGGGGGG - Intronic
1161861631 19:6802189-6802211 GTGGGGTCGGGGAAGTGGGGAGG + Intronic
1161958474 19:7509242-7509264 CTGGGGCCGGGGAAGGGTGGGGG + Intronic
1162386987 19:10365633-10365655 CTACATCCGGGACAGTGGGGTGG - Exonic
1162944021 19:14031662-14031684 CTGCTTGAGGGGGAGTGGGGAGG - Intergenic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163799117 19:19354459-19354481 CTGGGGCTGGGGAAGAGGGGTGG - Intronic
1165036346 19:33036617-33036639 CAGCTTCTGGGGAAGTGTGGAGG + Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1166316885 19:41994263-41994285 CCGCGTCCGCGGGAGGGGGGCGG + Intronic
1166318700 19:42003323-42003345 CTGAGTCCGAGGAGGTGAGGAGG - Exonic
1166461734 19:42993663-42993685 CAGCGTCCGGAGAAGGGAGGTGG + Intronic
1166501682 19:43345961-43345983 CAGCGTCCGGAGAAGAGAGGTGG + Intergenic
1167108665 19:47446272-47446294 CTGCATCCTGGGCAGGGGGGTGG + Intronic
1167791313 19:51684482-51684504 CTGGGCTGGGGGAAGTGGGGAGG - Intergenic
1168063924 19:53908959-53908981 CTGAGGCCTGGGAAGTGGAGAGG - Intergenic
1168168574 19:54571979-54572001 CTGAGTTTGGGGGAGTGGGGAGG - Intergenic
925394947 2:3526789-3526811 CTCCGTCCTGGGCAGTGGGAAGG + Intergenic
926101396 2:10120613-10120635 CCGCCTCCGGGGAGGTCGGGCGG - Intergenic
926162949 2:10501255-10501277 CTGCATCCGGGCCAGTGGGGAGG + Intergenic
926437706 2:12854452-12854474 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
927596549 2:24402838-24402860 CTGCTTGCGGGGAGGTGCGGAGG + Intergenic
931249395 2:60516544-60516566 CGTCATCCGGGGAAGTGGAGAGG + Intronic
933415781 2:81985153-81985175 CTGCTTGCAGGGAAGTGTGGAGG + Intergenic
934479569 2:94622566-94622588 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
934518662 2:95005707-95005729 CTGGGTCCCTGGAGGTGGGGTGG + Intergenic
934548724 2:95241115-95241137 CTGCTTTGGGGGCAGTGGGGTGG - Intronic
935878400 2:107536471-107536493 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
937472564 2:122186680-122186702 CTGAGTCAGGGGGATTGGGGTGG - Intergenic
937751468 2:125479539-125479561 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
937789468 2:125943307-125943329 CTGCTTGAGGGGAAGTGTGGAGG - Intergenic
938262903 2:129907773-129907795 CTCTGTCCGGGGAGGCGGGGTGG - Intergenic
938422229 2:131154767-131154789 GTGCGTCCGGGGGTGTGGGCTGG - Intronic
938728736 2:134129920-134129942 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
941476635 2:165957450-165957472 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
941928104 2:170915731-170915753 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
942763476 2:179427456-179427478 CTGCATCCAGGGAAGTGGGCTGG + Intergenic
943134394 2:183892512-183892534 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
947539400 2:230964632-230964654 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
947999682 2:234557531-234557553 CAGCCTGCAGGGAAGTGGGGGGG + Intergenic
949021702 2:241744503-241744525 CGGGGTCGGGGGCAGTGGGGAGG - Intronic
949062962 2:241971836-241971858 CTGCCTCCTGGGAAGTTGGGAGG + Intergenic
949075523 2:242055271-242055293 CAGCGGCCGGAGAAGTGTGGGGG + Intergenic
1168762019 20:355848-355870 CTGAGTCCAGGGAGGTTGGGAGG - Intronic
1168831206 20:846123-846145 CTGGGGTCGGGGCAGTGGGGAGG + Exonic
1168838864 20:895882-895904 CTGGGTCCGGGGAGGGGGTGGGG + Intronic
1169263755 20:4155400-4155422 CGGCGTACGTGGGAGTGGGGGGG + Intronic
1170930843 20:20768417-20768439 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1170948068 20:20909856-20909878 CTGCGTACTGGGAGGAGGGGTGG - Intergenic
1171244457 20:23600212-23600234 CAGTGTCTTGGGAAGTGGGGTGG - Intergenic
1173279776 20:41618109-41618131 CTGCGGCCTGGGGAGAGGGGCGG - Intronic
1173700315 20:45064096-45064118 CTGCGCCCGGCCAAGGGGGGGGG + Intronic
1173987830 20:47276286-47276308 CTCCGTGCGGGGGAGCGGGGAGG - Intronic
1174038398 20:47682433-47682455 CTGCGTCTGGGGCAGGGGAGCGG - Intronic
1174092238 20:48058752-48058774 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1174399817 20:50269983-50270005 CTGCGGGCAGGGAAGAGGGGAGG - Intergenic
1175970552 20:62684713-62684735 GTGTGTCCAGGGCAGTGGGGGGG - Intronic
1176155797 20:63619749-63619771 CTGCGTCCAGGGAAGTTGCTTGG - Exonic
1176238325 20:64064433-64064455 CTGCCTCCTGGGGGGTGGGGAGG + Intronic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1177043879 21:16145921-16145943 GTCCGTCGGGGGAGGTGGGGTGG + Intergenic
1179486449 21:41713778-41713800 CTGCGTCCAGCGACATGGGGAGG - Intergenic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1180070826 21:45435183-45435205 GTGAGTCCTGGGAAGTGGGTAGG + Intronic
1180933386 22:19608325-19608347 CAGCGTCCAGGGCAGTGGGGTGG + Intergenic
1181800923 22:25347289-25347311 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1182148820 22:28014311-28014333 CTGCCTCCTGGGAAGAGAGGAGG + Exonic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183452996 22:37906693-37906715 CGGCGTCCGGGGCCGTCGGGGGG - Intronic
1185229174 22:49670580-49670602 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
949754262 3:7391558-7391580 GTGGGGCGGGGGAAGTGGGGAGG + Intronic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954444810 3:50540908-50540930 CTGCGTCAGGGAGGGTGGGGTGG - Intergenic
954445182 3:50542486-50542508 CTGTGCCTGGGGGAGTGGGGGGG + Intergenic
954756804 3:52845003-52845025 GTGCGTGTGGGGGAGTGGGGTGG - Intronic
955303356 3:57805884-57805906 GTGAGTCAGGGGAAGTAGGGAGG - Intronic
956438784 3:69260245-69260267 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
958549688 3:95595863-95595885 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG + Intergenic
959422697 3:106148605-106148627 CAGCTTGCGGGGAAGTGTGGAGG + Intergenic
961957078 3:130815214-130815236 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
962025116 3:131539685-131539707 GTGTGTGTGGGGAAGTGGGGAGG + Intronic
963583298 3:147154065-147154087 CTGCTTCCAGGGAGGTGTGGAGG + Intergenic
966815192 3:183884722-183884744 CTGCGTCCGAGGAGCTGCGGCGG + Exonic
967309056 3:188089008-188089030 CTGGGTGCAGGGAACTGGGGTGG + Intergenic
968289213 3:197525815-197525837 CTGGGTCCAGGGAGGTGGTGTGG - Intronic
968501511 4:952264-952286 CAGCGTCCCGTGGAGTGGGGAGG + Intronic
969395080 4:6915339-6915361 CTGCGACCGGGGTAGGGGGTTGG + Intronic
969427025 4:7130404-7130426 CTGCGTGCGGGGAGCTGGTGGGG - Intergenic
970108278 4:12609612-12609634 CAGCTTCCGGGGAGGTGTGGAGG + Intergenic
971043386 4:22778962-22778984 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
971620763 4:28851669-28851691 TTGGGGTCGGGGAAGTGGGGAGG - Intergenic
972496448 4:39639030-39639052 GTGCGTCCCGGGAAGCCGGGCGG + Exonic
974079299 4:57195812-57195834 CTGCGTGCGGCGACGTTGGGAGG + Intergenic
974877728 4:67718191-67718213 CTGGAGCCGGGGAAGTGGGGAGG + Intergenic
975160662 4:71120906-71120928 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
975778736 4:77818778-77818800 AGGCGTCCGGGGAGGTGGGCGGG + Intronic
978030554 4:103936756-103936778 CTGCTTGTGGGGAAGTGTGGAGG + Intergenic
978466213 4:109012452-109012474 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979755828 4:124339032-124339054 CAGCTTCCGGGGAGGTGTGGAGG + Intergenic
979829314 4:125280928-125280950 CTGCTTGCGGGGAAGTGTGGAGG + Intergenic
979920420 4:126489998-126490020 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
980463900 4:133150494-133150516 CTGGCTCCGGGAAAGAGGGGGGG - Exonic
982863342 4:160481748-160481770 CAGCTTGCGGGGAAGTGTGGAGG + Intergenic
983843223 4:172482254-172482276 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
984805386 4:183746821-183746843 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
985269259 4:188178957-188178979 CTGCTTACGGGGAGGTGTGGAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986741742 5:10710892-10710914 CTGAGCCAGGGGAAGTGGTGAGG + Intronic
989777346 5:45225612-45225634 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
992050318 5:72935217-72935239 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
992158534 5:73978533-73978555 CAGCAGCCGTGGAAGTGGGGTGG + Intergenic
994213196 5:97108686-97108708 CTGGGTCCTGGTCAGTGGGGTGG + Intronic
994570261 5:101506006-101506028 CTGCTTGCGGGGAGGTGTGGCGG + Intergenic
995989824 5:118223928-118223950 ATGTGTCGAGGGAAGTGGGGAGG - Intergenic
996221357 5:120936799-120936821 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
997375462 5:133394332-133394354 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
997884141 5:137615530-137615552 CTGCCTCTGGGGAGGGGGGGCGG - Intergenic
998117496 5:139549322-139549344 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
998170272 5:139868644-139868666 CTGAGGCCCGGGAGGTGGGGTGG - Intronic
998262514 5:140642244-140642266 CTGCGTGTGGGGAGATGGGGAGG - Intronic
999330810 5:150672252-150672274 CCGCGTCCGCGGAATGGGGGTGG + Intronic
999723067 5:154412963-154412985 CTGCGTCCGAGGCCGTGGGGAGG + Exonic
999809539 5:155114821-155114843 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1003175815 6:3751678-3751700 CCGCGTTCGGGGCAGCGGGGCGG + Exonic
1003178445 6:3771617-3771639 CGGCTTGCGGGGAAGTGTGGAGG + Intergenic
1003571845 6:7261232-7261254 CTGGGTCCGGGGGAGAGGAGTGG + Intergenic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1003984015 6:11417376-11417398 CTGCTTGCGGCGAAGTGTGGAGG - Intergenic
1005048996 6:21666494-21666516 CGGCGTCCGGGGGAGAGGGGAGG - Intergenic
1005114312 6:22318785-22318807 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1006097680 6:31666094-31666116 CCGCGGCAGGCGAAGTGGGGTGG - Exonic
1008291850 6:49725138-49725160 ATGGGTCGGGGGGAGTGGGGAGG + Intergenic
1008446523 6:51598364-51598386 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1010269304 6:73903138-73903160 CTCCTTGCGGGGAAGTGTGGAGG + Intergenic
1010703376 6:79078016-79078038 CTGCGATCGGGTAAGTCGGGGGG - Exonic
1010730999 6:79391181-79391203 GTGGGTTGGGGGAAGTGGGGAGG + Intergenic
1011129367 6:84037823-84037845 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1011654823 6:89542505-89542527 CTGTGTCTCGGGAAGCGGGGGGG - Intronic
1013895838 6:115086570-115086592 GTGGGTTGGGGGAAGTGGGGAGG + Intergenic
1015456785 6:133435462-133435484 CTGTGTCTGGGGAAATGGGTTGG + Intronic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1018976822 6:168572980-168573002 CAGCACCCGGGGATGTGGGGAGG - Intronic
1019086188 6:169480015-169480037 CTGCTTGCGGGGAGGTGTGGAGG + Intronic
1019377133 7:698891-698913 CTGCGTGGGGAGAGGTGGGGTGG - Intronic
1019618391 7:1977499-1977521 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1019922807 7:4173723-4173745 CTGAGTCCGGCACAGTGGGGTGG + Intronic
1021006202 7:15397386-15397408 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022497110 7:30860163-30860185 GTGGGCCCTGGGAAGTGGGGAGG + Intronic
1023185109 7:37524941-37524963 CTGCCTGCTGGGATGTGGGGAGG + Intergenic
1023232466 7:38049755-38049777 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1023790519 7:43749908-43749930 CAGCCTCCAGGGAAGTTGGGGGG + Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026744350 7:72999448-72999470 GTGAGTCCTGGGAAGAGGGGAGG - Intergenic
1027001505 7:74657760-74657782 GCGCGTGCGGGGAAGCGGGGGGG - Intronic
1027030456 7:74884121-74884143 GTGAGTCCTGGGAAGAGGGGAGG - Intergenic
1027099387 7:75365644-75365666 GTGAGTCCTGGGAAGAGGGGAGG + Intergenic
1029378641 7:100198167-100198189 GTGAGTCCTGGGAAGAGGGGAGG + Intronic
1030292652 7:107887966-107887988 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1032339607 7:131058742-131058764 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1032437073 7:131909306-131909328 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1034470458 7:151251892-151251914 CGGCGGCCGGGGAGCTGGGGGGG + Intronic
1034900809 7:154906903-154906925 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1035356627 7:158279715-158279737 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036928694 8:12931686-12931708 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1037907787 8:22725562-22725584 TTGGGGCGGGGGAAGTGGGGTGG + Intronic
1039845728 8:41324216-41324238 CTGCTCCCTGGGAAGTGTGGAGG - Intergenic
1040000831 8:42575194-42575216 CTGCTTCCAGGGAGGTGTGGAGG + Intergenic
1040003740 8:42600443-42600465 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1040518085 8:48150769-48150791 ATGTGTCCGGGGAAGTGAGGGGG + Intergenic
1040964623 8:53071519-53071541 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1042169518 8:65978161-65978183 CTGCTTGCGAGGAAGTGTGGAGG - Intergenic
1046262235 8:111783574-111783596 GAGCTTCCTGGGAAGTGGGGAGG + Intergenic
1047573133 8:126122761-126122783 CTGCTTCTGGAGAAGTGGAGGGG + Intergenic
1048186925 8:132250038-132250060 CTGCTTGCGGGGAGGTGTGGAGG - Intronic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049713514 8:144078439-144078461 CTGTCTCCGGGGAACTGCGGCGG - Intergenic
1051671492 9:19515273-19515295 CTTGGTTTGGGGAAGTGGGGAGG - Exonic
1053137576 9:35661054-35661076 CTACTTCCTGGGAGGTGGGGCGG + Exonic
1053678259 9:40461014-40461036 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1054285467 9:63163932-63163954 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1054291335 9:63296551-63296573 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1054389355 9:64601091-64601113 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1054506362 9:65915281-65915303 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1055826899 9:80338449-80338471 CTGCTGCCAGGGAACTGGGGAGG - Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1057646869 9:96884557-96884579 CTGCCTTCGGGGTTGTGGGGTGG - Intergenic
1058065148 9:100540507-100540529 CTGCTAGCGGGGAGGTGGGGAGG - Intronic
1058309471 9:103483692-103483714 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1059530725 9:115033047-115033069 CTGCATCCTGGGAACTGGGAAGG + Intronic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1062460887 9:136662154-136662176 CTGCGGCCGGGGGTGTGGGGAGG - Intronic
1062462119 9:136666370-136666392 CTGCTGCCGGGCAGGTGGGGAGG + Intronic
1203760857 EBV:12563-12585 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203761786 EBV:15635-15657 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203762715 EBV:18707-18729 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203763644 EBV:21779-21801 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203764573 EBV:24851-24873 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203765502 EBV:27923-27945 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203766431 EBV:30995-31017 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203767360 EBV:34067-34089 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1186410234 X:9340388-9340410 CTGCTCCCAGGGAAGTGGGCGGG - Intergenic
1186541523 X:10405885-10405907 CTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1187305660 X:18093319-18093341 CTGGGTCCTGGGGAGTGGGGTGG + Intergenic
1189333188 X:40155331-40155353 CTGCGACCGGGGGAGAGGGTCGG + Intronic
1192022428 X:67408639-67408661 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1192233215 X:69279862-69279884 TTGCATACGGGGAAGTGAGGAGG - Intergenic
1192265247 X:69533239-69533261 CTGCTTTTGGGGAAGTGGAGTGG - Intergenic
1192400113 X:70826543-70826565 CTGCTGCCAGGGAAGCGGGGAGG - Intronic
1192425119 X:71068323-71068345 CTGGGACCGGGGAAAGGGGGTGG + Intronic
1192624768 X:72715361-72715383 CGGCGGCGGGGGAAGCGGGGGGG - Intergenic
1194077680 X:89417106-89417128 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1194340491 X:92699857-92699879 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1196741328 X:119028601-119028623 CTGCTTGCGGGGAGGTGTGGAGG - Intergenic
1200430331 Y:3072652-3072674 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic
1201424204 Y:13831328-13831350 CTGCTTGCGGGGAGGTGTGGAGG + Intergenic