ID: 959362762

View in Genome Browser
Species Human (GRCh38)
Location 3:105414902-105414924
Sequence GCAGAGAGTGAGTTTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959362758_959362762 29 Left 959362758 3:105414850-105414872 CCAATTTTTATTTGAGAAAGATA 0: 1
1: 0
2: 11
3: 106
4: 1118
Right 959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 206
959362759_959362762 5 Left 959362759 3:105414874-105414896 CCCTGATGCCATTGTTTAAGATA 0: 1
1: 0
2: 0
3: 14
4: 185
Right 959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 206
959362757_959362762 30 Left 959362757 3:105414849-105414871 CCCAATTTTTATTTGAGAAAGAT 0: 1
1: 1
2: 9
3: 93
4: 894
Right 959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 206
959362760_959362762 4 Left 959362760 3:105414875-105414897 CCTGATGCCATTGTTTAAGATAT 0: 1
1: 0
2: 0
3: 12
4: 181
Right 959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 206
959362761_959362762 -3 Left 959362761 3:105414882-105414904 CCATTGTTTAAGATATGTCTGCA 0: 1
1: 0
2: 0
3: 12
4: 232
Right 959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959362762 Original CRISPR GCAGAGAGTGAGTTTAAAGC TGG Intronic
901195143 1:7436224-7436246 GAAGAGAGTGTGTTTGAAGCTGG + Intronic
901861048 1:12074574-12074596 CCAGAAAGTGAGTTTGAGGCCGG - Intronic
901937214 1:12635216-12635238 GCAAGGAGTGAGTTTAAGGGTGG - Intergenic
903130333 1:21275144-21275166 GCTGAGAGTGAGCCTAACGCGGG + Intronic
907752117 1:57272733-57272755 TAAGAGAGTGAGTTTAAATAAGG + Intronic
910646783 1:89523842-89523864 GCAGAGACTGAGTTAAAACTGGG + Intergenic
910704551 1:90113929-90113951 GCAGAGTGTGGGTTTAGAGCAGG + Intergenic
911744320 1:101423376-101423398 GCTGTGAGTGAATATAAAGCAGG - Intergenic
911947421 1:104130183-104130205 GAAGAGAGTAGGTTTGAAGCAGG - Intergenic
912076929 1:105886335-105886357 GCTGAGACTGAGTTTAAATCTGG + Intergenic
912958495 1:114173846-114173868 GCAGAGAGTTAGATTTAATCAGG + Intergenic
916912431 1:169365317-169365339 GCAGAGAAAGAGTTTAATGGAGG - Intronic
917821118 1:178765314-178765336 GAAGAGAGAAATTTTAAAGCTGG + Intronic
919827305 1:201512388-201512410 GGAGAAAGAGATTTTAAAGCAGG - Intergenic
921361571 1:214334809-214334831 GAAGAAAGTGAGGTTCAAGCAGG + Intronic
921600678 1:217103279-217103301 GCAGAGAGTGAGGAGAAAGAGGG + Intronic
922920794 1:229301220-229301242 GCAAAGGGTTAATTTAAAGCTGG + Intronic
923410195 1:233700531-233700553 ACAGACAGTGAGGTGAAAGCTGG - Intergenic
923535300 1:234845356-234845378 CCAGAGACTGAGTATAAAGAAGG + Intergenic
1063370235 10:5516476-5516498 GCAGAGAGTTAATTAAAAGTGGG + Intergenic
1063702200 10:8395280-8395302 GCAGAGAGTGCCATTTAAGCTGG + Intergenic
1064336646 10:14448952-14448974 GCTGGGACTGAGTTAAAAGCTGG - Intronic
1064375613 10:14792888-14792910 GTAGAGAGTGAGTGAAGAGCAGG - Intergenic
1064640837 10:17414365-17414387 GCAGAGAGTGAGTGTGGAGGTGG - Intronic
1065432559 10:25674208-25674230 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1067480604 10:46594915-46594937 GCAGAGAGTGATTTTATACAGGG + Intergenic
1067614135 10:47746887-47746909 GCAGAGAGTGATTTTATACAGGG - Intergenic
1067859012 10:49825281-49825303 AGAGAGAGTGTATTTAAAGCAGG - Intronic
1070796716 10:79221174-79221196 GCAGTGAGTGAGCTTGGAGCGGG + Intronic
1071183958 10:83019361-83019383 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071235452 10:83642176-83642198 GGATAAAGTGAGTTTACAGCTGG + Intergenic
1071557277 10:86614298-86614320 GCAGAGACTCAGATAAAAGCAGG - Intergenic
1071629545 10:87206863-87206885 GCAGAGAGTGATTTTATACACGG - Intergenic
1072345816 10:94504899-94504921 GCAAAGGGAGAGTTTGAAGCAGG - Intronic
1076486644 10:130824544-130824566 GCAGAGAGTGAGTTTGTGGTAGG - Intergenic
1077464400 11:2726730-2726752 GGAAATAGTGATTTTAAAGCCGG + Intronic
1080793540 11:35542170-35542192 TCACAGAGTGAGGTTAAATCTGG + Intergenic
1084144134 11:67255147-67255169 GCAGAGAGGGAGTGTGACGCTGG - Exonic
1086069588 11:82786156-82786178 GCAGAGACAGAATTTAAACCTGG - Intergenic
1086582619 11:88416717-88416739 GCACAGATTAAGCTTAAAGCAGG - Intergenic
1088712757 11:112523539-112523561 GCTGGGAGTGAGCCTAAAGCAGG + Intergenic
1090028939 11:123191437-123191459 GCAGAAAGTGAGTTTGAAGAAGG - Intronic
1090064784 11:123493402-123493424 GTGGAGAGTGAGTTTTGAGCAGG + Intergenic
1094733294 12:33202808-33202830 GCAGAGAAATAGTTTAAAACGGG - Intergenic
1097513365 12:60571244-60571266 GCTGACAGTGAATATAAAGCGGG + Intergenic
1099243726 12:80169426-80169448 GCAAACAGTGAGTTTTGAGCAGG - Intergenic
1099631490 12:85151670-85151692 TAAGAGAGGGAGTTTAAAACAGG + Intronic
1100067156 12:90663284-90663306 GCACAGAGTGAGTTTACACTTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102304163 12:111792157-111792179 GCCGATAGTGAGTTTCCAGCTGG + Exonic
1102371868 12:112388499-112388521 GAAGATGTTGAGTTTAAAGCTGG + Intergenic
1104660892 12:130610865-130610887 GGTGACAGTGAATTTAAAGCAGG - Intronic
1105621903 13:22076127-22076149 GCACAGTGTGAGTTTACTGCTGG + Intergenic
1105685078 13:22772644-22772666 GCAGAGAGGGACTTTAAACAAGG - Intergenic
1108851241 13:54732974-54732996 GCAAAGAGTGGGTTTAAGGAAGG + Intergenic
1109450970 13:62513479-62513501 GAGGAGAGTGAGTTTTAATCAGG + Intergenic
1109993992 13:70097842-70097864 TCAGAGAATTAGTTTAAAGAGGG + Intronic
1112341324 13:98555280-98555302 GCCGAGAGTGAGTTTAAACATGG - Intronic
1112441502 13:99427373-99427395 GCAGGGAGTCAGTTTTCAGCAGG + Intergenic
1112841689 13:103587115-103587137 GCTGACAGTGAATATAAAGCAGG - Intergenic
1114159355 14:20146214-20146236 TCAGAGACTGATTTTAAACCTGG + Intergenic
1115556999 14:34551810-34551832 GCAGAGAGTGAGTTTCACAGTGG + Intergenic
1116449806 14:45051506-45051528 GAAGACAGTGACTTTAAAGGGGG + Intronic
1117643799 14:57829341-57829363 GCAGAGATGTAGTTCAAAGCTGG + Intronic
1118163900 14:63317288-63317310 GTAGAGCGTCAGTGTAAAGCTGG - Intronic
1118573257 14:67215533-67215555 GGAGAGAGTGAGAGTAAAGTAGG + Intronic
1120361145 14:83504079-83504101 AAAGAGAGGGAGTTTAAAGCAGG + Intergenic
1125602485 15:40923261-40923283 GCAGAGCCTGAGCTGAAAGCAGG - Intergenic
1125885791 15:43228582-43228604 GCAGAGAGTGAACTTGAAACTGG + Intergenic
1126548357 15:49898530-49898552 GGAGAGAGAGAGTTAAATGCTGG + Intronic
1130003513 15:80069139-80069161 GGAGAGAGAGAATTTAAAGTTGG + Intronic
1131671348 15:94623035-94623057 GCTGAGAGAGAGTTTAATGAGGG + Intergenic
1133522174 16:6569103-6569125 GCAGAGAGAGTATTCAAAGCTGG - Intronic
1133675390 16:8066037-8066059 GCAGAGAAAGAGTTTAATGATGG - Intergenic
1137813704 16:51377816-51377838 GCAGGGACTGAGTTTGGAGCAGG + Intergenic
1139434795 16:66930202-66930224 TCAGAGAATGAGACTAAAGCAGG + Intergenic
1140206966 16:72940909-72940931 GCAGAGAGTAGGTTTAAATTGGG - Intronic
1141632670 16:85296970-85296992 GCACAGAGTGAGGTCAAAGGAGG - Intergenic
1143231764 17:5362086-5362108 GCTGAGAGTGGGTTTAAAGAGGG + Intronic
1144377813 17:14663132-14663154 GCTGCGAGTGAATATAAAGCAGG - Intergenic
1145749994 17:27348996-27349018 TCACAAAGTGAGTTTAAACCAGG - Intergenic
1146493530 17:33299984-33300006 GCAGAGAATGAGTTAGAAGTTGG - Intronic
1146816011 17:35943157-35943179 ACACAGAGTGAGTTTGGAGCAGG - Intronic
1148776001 17:50096033-50096055 GCAGAGGGTGAGATTAAGCCAGG + Intronic
1203168819 17_GL000205v2_random:126946-126968 GCTGACAGTGAATATAAAGCAGG + Intergenic
1155673981 18:28407463-28407485 GCAGAGAGTGGGATTTAACCAGG - Intergenic
1156599365 18:38586600-38586622 GCAAAGAGTGTGTTGAACGCTGG + Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1159078981 18:63714126-63714148 ACAGAGAGAAATTTTAAAGCTGG + Intronic
1159931607 18:74317908-74317930 GCACAGAGTTTGTTTAAATCTGG - Exonic
1160249183 18:77186161-77186183 AAAGAGAGAAAGTTTAAAGCTGG + Intergenic
1164978607 19:32595119-32595141 GCTGTGAGTGTGTTTAAAGATGG + Intergenic
1165484998 19:36090147-36090169 GCAGAGAGTGAGTGTGCAGAGGG + Intronic
1166770953 19:45281926-45281948 ACAGAGTCTGAGTTTAAATCTGG + Intronic
1167784324 19:51625121-51625143 GCAGATACTGAGATTAGAGCTGG + Intronic
1168115154 19:54218202-54218224 GAAGAGAGTGAGGTCACAGCAGG + Intronic
1168124430 19:54275791-54275813 GGAGAGAGTGAGGTCACAGCAGG + Intronic
1168678696 19:58297911-58297933 GCTGAGCCTGAGTTCAAAGCAGG + Exonic
925316312 2:2928401-2928423 GCATAGAGTTATTTGAAAGCAGG - Intergenic
929437852 2:41941836-41941858 GCACAGATGGATTTTAAAGCAGG - Intronic
929655279 2:43724953-43724975 AGACAGAGTGAGTTTAGAGCAGG + Intronic
930764387 2:55070083-55070105 GCAAAGAGACAGTCTAAAGCAGG + Intronic
932143097 2:69296889-69296911 GCAGTGTGAGAGTTTCAAGCAGG - Intergenic
935823728 2:106920321-106920343 GGAGTGAGAGAGTGTAAAGCTGG + Intergenic
937163709 2:119792767-119792789 AAAGAGAGAGATTTTAAAGCTGG + Intronic
939671547 2:145018703-145018725 GCAGAGCGAGGGTTTAAAGCAGG + Intergenic
939889422 2:147719331-147719353 GCAAAGAGAGAGATTAGAGCTGG + Intergenic
940504258 2:154532821-154532843 GCAGAGCTAGAATTTAAAGCAGG + Intergenic
940922064 2:159318824-159318846 GAAGAGGGTGAGTTTAAGTCAGG - Intergenic
941673654 2:168321529-168321551 GCAGAGAAAGAGTTTAATGGAGG + Intergenic
946598078 2:221328391-221328413 GGAGAGAGAGAGTGTAAAGGGGG - Intergenic
1170391638 20:15881249-15881271 GTAGAGAAAGAGTTTAATGCAGG + Intronic
1172543297 20:35738952-35738974 GCAAAAAGTGAGTTTTAAGAAGG - Exonic
1175824871 20:61931353-61931375 GCAGAGGGTGAGGTGACAGCCGG - Intronic
1176402937 21:6332205-6332227 GCTGACAGTGAATATAAAGCAGG - Intergenic
1176434220 21:6656899-6656921 GCTGACAGTGAATATAAAGCAGG + Intergenic
1180101334 21:45588571-45588593 GCAGAGACTGAGTTATAAGTTGG - Intergenic
1181531625 22:23520699-23520721 GCAGGGAGGTAGTTTGAAGCAGG + Intergenic
1183486627 22:38090609-38090631 GCAGATAAAGCGTTTAAAGCAGG - Intronic
1184449216 22:44573080-44573102 GCTGTGGGTGAGCTTAAAGCAGG - Intergenic
1185116461 22:48941001-48941023 GCAGAGTGTGAGCCTGAAGCTGG - Intergenic
949535902 3:4995893-4995915 GGAGAGAGTGAATTTACTGCGGG - Intergenic
950122276 3:10489712-10489734 GCAGAGGCTGAGTTGAAGGCAGG - Intronic
952629150 3:35443737-35443759 GCATAGAATTGGTTTAAAGCAGG - Intergenic
952668740 3:35939964-35939986 GCTAGGAGTGAGCTTAAAGCAGG - Intergenic
953061361 3:39430689-39430711 GAACAAAGTGAGTTAAAAGCAGG + Intergenic
953673764 3:44984038-44984060 GCAGAGAGTGAATTAAAGGCTGG + Intronic
953772070 3:45785390-45785412 GCTGACAGTGAATATAAAGCAGG + Intronic
957120007 3:76078001-76078023 GAAGAGAGGGAGTGGAAAGCAGG - Intronic
957426190 3:80043148-80043170 ACAGGGAGTCAGTTTACAGCAGG - Intergenic
957439017 3:80218005-80218027 GCAGTGAGTGAGTGTGAAGGTGG + Intergenic
957504381 3:81100893-81100915 GAAGAGATGGAGTTGAAAGCAGG + Intergenic
957806874 3:85159281-85159303 GGAGAGAACGAGTTTAAAGATGG + Intronic
959194566 3:103163098-103163120 AAACAGATTGAGTTTAAAGCTGG - Intergenic
959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG + Intronic
960090848 3:113636628-113636650 GCAGAAACTTAGTTAAAAGCTGG + Intergenic
960815198 3:121664799-121664821 GCAGCGAATGAGTCTAAGGCTGG - Intronic
963855173 3:150245938-150245960 GAAGTGACTGACTTTAAAGCAGG + Intergenic
964548745 3:157863589-157863611 ACAGAGAGTGGGTCTAAAGTGGG + Intergenic
964894830 3:161583124-161583146 GCAGATAGTGAGTGGAGAGCTGG + Intergenic
965862643 3:173165646-173165668 CCTGAGAGTGAGCTTAAAACAGG - Intergenic
966282418 3:178247466-178247488 TCAGACAATGACTTTAAAGCAGG + Intergenic
966597242 3:181735615-181735637 GCACGGAGTGAGTCTAAAACAGG + Intergenic
969591005 4:8121965-8121987 CCAGAGAGGGAGTTGAGAGCTGG - Intronic
970028249 4:11647426-11647448 TCACAGAGTGATTTAAAAGCAGG - Intergenic
971059419 4:22950838-22950860 TCAGATAGTTAGTTTAAACCTGG + Intergenic
971083952 4:23248396-23248418 GTAGGGAATGAGTTTAAAGAAGG - Intergenic
972180869 4:36463482-36463504 GCATAGGGTGAGTTGTAAGCTGG - Intergenic
973621680 4:52732924-52732946 GAATAGAGTGAGTTTATAGGTGG + Intronic
974596803 4:64024170-64024192 ACACAGAGTGAGTTTAGAGCAGG + Intergenic
977423417 4:96833217-96833239 GCAGAGAGTGAGAGTGAAGAAGG + Intergenic
979254387 4:118596721-118596743 GTAGGGATTGAGGTTAAAGCAGG + Intergenic
979334577 4:119449311-119449333 GTAGGGATTGAGGTTAAAGCAGG - Intergenic
983064728 4:163195179-163195201 ACACAGAGTGAGATTAGAGCAGG + Intergenic
985004507 4:185520716-185520738 GCACAAAGTGAGTTTAGACCAGG - Intronic
985565471 5:613293-613315 GCAGAGAAAGAGTTTAAGGCTGG + Intronic
986102990 5:4631104-4631126 GCAGGAAGTGAGTTTAATCCGGG + Intergenic
986626741 5:9729638-9729660 GGAGACAATTAGTTTAAAGCAGG + Intergenic
987689791 5:21252006-21252028 AAAGAGAGAGATTTTAAAGCTGG - Intergenic
990474045 5:56144368-56144390 GCAGAGAGTAAGTTAAAGGAAGG + Intronic
991568315 5:68028525-68028547 GCAGGGAGTGGGTGTGAAGCAGG + Intergenic
992739653 5:79760570-79760592 GAAGAGAGAGAGAGTAAAGCAGG + Intronic
993413021 5:87595372-87595394 GCAGCCAGTGAATATAAAGCAGG - Intergenic
995815329 5:116161211-116161233 GCAGAGAAAGAATTTAAACCAGG - Intronic
998481894 5:142469812-142469834 GCAGAGAGTGAGGAGACAGCAGG - Intergenic
998558986 5:143153487-143153509 GGAGAGAGTGATTTTAAAGGAGG + Intronic
999308736 5:150537838-150537860 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1001131209 5:169065216-169065238 GCAGTGACTGCGTTTGAAGCAGG - Intronic
1001522148 5:172402562-172402584 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1002879784 6:1240823-1240845 GCAGATACTGAGCTTTAAGCTGG + Intergenic
1009768723 6:68117786-68117808 GCAGATAGTGAGATAAAATCTGG + Intergenic
1011066137 6:83327869-83327891 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1013381186 6:109572842-109572864 CTAGAGAGTGGGCTTAAAGCAGG - Intronic
1013697697 6:112723726-112723748 GCAGAGTGTGAGTTTGATTCTGG + Intergenic
1015354158 6:132257334-132257356 GCAGGGAATGAGTTTACATCGGG - Intergenic
1017020586 6:150136924-150136946 GCAGAGAGTGAATTTGATCCAGG + Intergenic
1018148390 6:160915272-160915294 GAAGAGAGTGAGGCTAAAACAGG - Intergenic
1020048426 7:5062312-5062334 GAAGAGAGAAATTTTAAAGCTGG + Intronic
1021769493 7:23984333-23984355 GCAGAGAGAGAGGCAAAAGCAGG - Intergenic
1022023509 7:26424065-26424087 GCAGTGAGTGAGTTTCAGGAAGG - Intergenic
1023140878 7:37101194-37101216 GCAGAGAGAGAGATAAAAGTAGG + Intronic
1028876157 7:95825594-95825616 GCAGAGAATGAATTCAGAGCAGG + Intronic
1029003176 7:97177861-97177883 GCAGAGATAGATTTTAAAGCAGG - Intronic
1029210654 7:98905586-98905608 GCAGAGAGTAAGTTTAGGGGTGG + Intronic
1030056081 7:105584692-105584714 GGAGAGAGAAATTTTAAAGCTGG - Intronic
1030156412 7:106460244-106460266 GCAGAGAGGGATTTTACTGCGGG + Intergenic
1033128992 7:138729461-138729483 ACCGAGAGTGAGTTCAAAGTGGG - Intronic
1033604366 7:142915062-142915084 GCAGAGAGTGAGAGACAAGCTGG + Intronic
1036647627 8:10621881-10621903 CCAGAGAGTGAATTGGAAGCTGG - Intronic
1044577696 8:93788874-93788896 GCAGAGAATGAGCCTAAAGAAGG + Intronic
1046484849 8:114874551-114874573 GCAGTGATTCAGTTTCAAGCTGG - Intergenic
1048497538 8:134947528-134947550 GCAAAGAGTGATTTTAATGATGG - Intergenic
1048941020 8:139400954-139400976 GCAGAGATTTACTTTAAAGGAGG - Intergenic
1049524641 8:143117079-143117101 GCAGAGAGTAAGTGAAAAGCAGG + Intergenic
1049654496 8:143791767-143791789 GCAGAGAGTGAGAGGAAAGGGGG + Intronic
1049854599 8:144853310-144853332 GCGCAGAGTGAGGGTAAAGCGGG + Intronic
1050186461 9:2980239-2980261 GCAGTAAGTCAGTTTCAAGCAGG + Intergenic
1054868976 9:70031709-70031731 GCAAAGACTGAGTTAAGAGCAGG - Intergenic
1056266642 9:84903381-84903403 GTAGAGAATTAGTTTAGAGCTGG + Intronic
1056524165 9:87427205-87427227 GCAGAGAAAGAATTTAAAGCTGG - Intergenic
1056894896 9:90536065-90536087 GAAGAGAGAAATTTTAAAGCTGG + Intergenic
1057911499 9:99023443-99023465 GCTGAGAGTGAGTGTGAAGGAGG + Exonic
1058028900 9:100174161-100174183 GCAGACAAGGAATTTAAAGCAGG + Intronic
1060600379 9:124873470-124873492 GTAGAGAGGGAGTTGAAAGGAGG + Intronic
1060718424 9:125956254-125956276 GCAGAGCGTGAATTTGAAACCGG + Intronic
1060934260 9:127506479-127506501 GGAGAGAGGGAGGTGAAAGCTGG - Exonic
1061042836 9:128149779-128149801 GCACAGAGTGAGCTGAAACCTGG - Intronic
1203437316 Un_GL000195v1:151751-151773 GCTGACAGTGAATATAAAGCAGG - Intergenic
1185534266 X:848298-848320 GCAAAGAGTGAGGTGTAAGCAGG + Intergenic
1187431306 X:19227882-19227904 GCAGGGAGAGAGTTTGAACCGGG + Intergenic
1187685234 X:21809271-21809293 GCAGAGAGGGGGTATAAAGTGGG + Intergenic
1189107342 X:38250779-38250801 GCAGAGACTGCCTTCAAAGCAGG + Intronic
1189734550 X:44056407-44056429 GAAGGAAGTGAGTTCAAAGCAGG - Intergenic
1190616351 X:52236887-52236909 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1191051853 X:56202096-56202118 CCAGAGAGTGAGTATGAAGAAGG + Intergenic
1191972068 X:66827647-66827669 AAAGAGAGAAAGTTTAAAGCTGG + Intergenic
1193144488 X:78063061-78063083 GCTGCGAGTGAATATAAAGCAGG - Intergenic
1193355171 X:80512093-80512115 ACACAGAGTGAGTTTGGAGCAGG + Intergenic
1196243342 X:113369346-113369368 GAAGACAGTGATTTTAAAGGAGG + Intergenic
1197396934 X:125939168-125939190 GCAGAGAGAGAGAGAAAAGCTGG + Intergenic
1202021042 Y:20465438-20465460 CCATAGAATGAGTTTAGAGCAGG + Intergenic
1202178644 Y:22120518-22120540 GCAGGGATGGAGTTTAAAGAAGG + Intergenic
1202212717 Y:22465876-22465898 GCAGGGATGGAGTTTAAAGAAGG - Intergenic