ID: 959363094

View in Genome Browser
Species Human (GRCh38)
Location 3:105419965-105419987
Sequence CTGGATATATAGATGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 574}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959363089_959363094 16 Left 959363089 3:105419926-105419948 CCTACTGTGTGCCTGGCACAGCT 0: 1
1: 0
2: 45
3: 270
4: 1364
Right 959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG 0: 1
1: 0
2: 2
3: 52
4: 574
959363091_959363094 5 Left 959363091 3:105419937-105419959 CCTGGCACAGCTAGCTTCACGGT 0: 1
1: 0
2: 0
3: 9
4: 86
Right 959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG 0: 1
1: 0
2: 2
3: 52
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959363094 Original CRISPR CTGGATATATAGATGGAAGA CGG Intronic
900039741 1:448977-448999 TTGGATATATACAAGGAAGTGGG - Intergenic
900061173 1:683953-683975 TTGGATATATACAAGGAAGTGGG - Intergenic
900081512 1:861845-861867 GTAGATAAATAGATGGATGATGG + Intergenic
900081528 1:862059-862081 GTAGATAAATAGATGGATGATGG + Intergenic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
902469839 1:16641244-16641266 CTGGGTATATACCTGAAAGAAGG + Intergenic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
906030513 1:42716418-42716440 GTGGATATGTAGATGGGAGATGG + Intergenic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906240923 1:44241859-44241881 ATGGACAGATGGATGGAAGAAGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
908516287 1:64896030-64896052 TTGGAGATTTAGATGGTAGATGG + Intronic
908894496 1:68883098-68883120 CTGGATATAAAGACTGGAGAAGG + Intergenic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913919094 1:124810309-124810331 TTGGAGATTTCGATGGAAGAGGG + Intergenic
913919229 1:124811839-124811861 TTGGAGATTTCGATGGAAGAGGG + Intergenic
915544050 1:156585965-156585987 CTGGACCTACAAATGGAAGATGG - Exonic
916015796 1:160748919-160748941 ATTGATAAATAGATGCAAGAAGG + Intronic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916646917 1:166795965-166795987 TTAGATATATAGATGGAGGGAGG - Intergenic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917309865 1:173667805-173667827 ATAGATATATAGTTGGAAAAGGG - Intronic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
918065797 1:181100869-181100891 GTTGATATCTAGAGGGAAGAGGG + Intergenic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918565243 1:185921991-185922013 CTGGATGTATTTGTGGAAGAAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919935143 1:202246117-202246139 ATGGATATATGGATGGAAAGAGG - Intronic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
924268091 1:242302983-242303005 CTGGATATTTTGATGGAGTAGGG + Intronic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066456796 10:35579268-35579290 CTGGATATATAGCCAGAAGTGGG - Intergenic
1066716814 10:38295758-38295780 CTGGATATTTTGATGGAGTAGGG - Intergenic
1067030168 10:42874620-42874642 CTGGATAGATAGATGCGTGATGG - Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067833704 10:49624952-49624974 ATGGATATATGGATGGATGATGG + Intronic
1067940964 10:50655534-50655556 GAAGATATATAGATAGAAGATGG - Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1069170642 10:65224716-65224738 GTGGATATGTAGATGAAAGAAGG - Intergenic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069393627 10:67964474-67964496 ATGGTTATTTAGATGGAAGAAGG - Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1071590316 10:86866196-86866218 CAGAATCTATAGATAGAAGAGGG + Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075142219 10:119849134-119849156 CTGGCTATGAATATGGAAGAAGG + Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075487027 10:122830768-122830790 CTGGATAGAGAGATGGCTGAAGG + Intergenic
1075535900 10:123271892-123271914 ATGTATATATATATAGAAGAAGG - Intergenic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1076910579 10:133386449-133386471 ATGGATATGTGGTTGGAAGAAGG + Intronic
1076965964 11:84890-84912 TTGGATATATACAAGGAAGTGGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1078508884 11:11970751-11970773 CTGGCTTTGTAGATGGAAGGGGG + Intronic
1079254363 11:18814190-18814212 TTGGATATATACCTAGAAGAGGG + Intergenic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079738324 11:24025779-24025801 CTGGAAATATAGTTGGGAGGTGG - Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1084445115 11:69199148-69199170 ATGGAGATATGGATGGATGATGG - Intergenic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1085679304 11:78556604-78556626 CTAGTTTTATAGATGGAAAAAGG - Intronic
1086377276 11:86214207-86214229 ATGGATATATAGATAGGAAATGG - Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090321299 11:125845631-125845653 ATGGATAAATTGATGGAAGTAGG + Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091166751 11:133483830-133483852 ATGGATACATAGATGATAGATGG + Intronic
1091187383 11:133658556-133658578 GTGGGTGTATAGATGGATGATGG + Intergenic
1091594575 12:1868103-1868125 TTGGGTATATACATGGAAGTGGG - Intronic
1092671980 12:10873587-10873609 CTAGCTTTAAAGATGGAAGAGGG - Intronic
1094316798 12:29144888-29144910 GGGGATATGAAGATGGAAGAAGG - Intergenic
1094346638 12:29477193-29477215 CTGGCTATATTGGTAGAAGAAGG - Exonic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1096527413 12:52219417-52219439 ATGGATAGATAGATAGATGATGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096635973 12:52959850-52959872 CTGGCTTTAAAGATGGCAGATGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098373933 12:69791804-69791826 TTGGATATATATCTGGAAGTGGG - Intronic
1098562095 12:71886117-71886139 TTGGATATATGGAGGTAAGAAGG + Intronic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099374895 12:81887041-81887063 ATAGATGGATAGATGGAAGAAGG + Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1100950002 12:99837151-99837173 TTGGCTCTAAAGATGGAAGAGGG + Intronic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102537068 12:113589601-113589623 ATGGATAGATAGGTGAAAGATGG - Intergenic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034744 12:125090501-125090523 GTGGATGGAGAGATGGAAGATGG - Intronic
1104468372 12:129008240-129008262 CTGGCAGTAAAGATGGAAGAAGG - Intergenic
1104469131 12:129014971-129014993 TTGGATACATACATGGATGAAGG - Intergenic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1106721937 13:32443856-32443878 CTGGATATAAAGAAAAAAGATGG - Exonic
1106864200 13:33945904-33945926 CTGGATATATAGAAGATAAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112195032 13:97217517-97217539 CTGGATAGAAAGATGTTAGATGG + Intergenic
1112208126 13:97346088-97346110 CTGGATGGATAGATGATAGATGG + Intronic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112801561 13:103116221-103116243 TTGGATATATAGATAGCAGTGGG + Intergenic
1113072945 13:106439003-106439025 ATGGATATATGGATGGATGAAGG + Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113224755 13:108147454-108147476 GTGGCTGAATAGATGGAAGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113684811 13:112275647-112275669 ATAGATAGATAGATGGAAAAAGG + Intergenic
1114176630 14:20326734-20326756 CTGGATTTCTAGATAGAAGCTGG - Exonic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115050056 14:29048467-29048489 ATTGATATATAGATTGTAGATGG - Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1115170207 14:30496368-30496390 AAGCATATATAGATGGATGATGG + Intergenic
1115174227 14:30544175-30544197 CTGGCTTTAAAGATGAAAGAAGG + Intergenic
1115916739 14:38323088-38323110 CTGGATATATACCCAGAAGATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118242586 14:64074380-64074402 CTGGAAACATAGTTGAAAGAAGG - Intronic
1119177967 14:72583368-72583390 CTGGATAGATAGATGATAGACGG + Intergenic
1119399661 14:74354240-74354262 TCAGATATATAGATGGAAAAAGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119706953 14:76788947-76788969 CTGGATACATGGAAGGAAGGGGG + Exonic
1121005019 14:90484562-90484584 ATGGATAGATGGATGGCAGATGG - Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121627191 14:95394520-95394542 TTGAATATATGGATGGATGATGG + Intergenic
1122011124 14:98749078-98749100 ATGGATAGATAGATAGATGATGG + Intergenic
1122140943 14:99662728-99662750 GTGGATATGTAGATGGATGGTGG + Intronic
1122365090 14:101190274-101190296 ATGGATATATGGATGGAGGGAGG + Intergenic
1122794171 14:104197497-104197519 GTGGATATATGGATAGATGATGG - Intergenic
1122794194 14:104197690-104197712 ATGGATGGATAGATGAAAGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123818010 15:23999167-23999189 CTGGAAATATTGCTGGAGGAGGG + Intergenic
1123938636 15:25206062-25206084 CTGGTGAGATAGCTGGAAGATGG - Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1125063473 15:35453276-35453298 GTGTATATATATATGGAAGAAGG - Intronic
1126309505 15:47299769-47299791 CAGGATCTATAGTTGCAAGATGG - Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1128303589 15:66582878-66582900 CTGGTTATATTGATGTAGGATGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1130219454 15:82006886-82006908 CTGGATTCAAACATGGAAGAAGG + Intergenic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131067884 15:89445586-89445608 ATGTATATATCAATGGAAGAAGG - Intergenic
1131797631 15:96035613-96035635 CTAGATGTAGAGATGAAAGATGG + Intergenic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132442167 15:101878635-101878657 TTGGATATATACAAGGAAGTGGG + Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134904396 16:17967645-17967667 GTGGATATGTTCATGGAAGACGG - Intergenic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137736100 16:50725011-50725033 CTGGGTATATAGATCGAATCCGG - Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1137999703 16:53263202-53263224 CTAGATATATAAATTGAAGTAGG + Intronic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141591836 16:85074273-85074295 ATGTATATATAAATGGAATATGG - Intronic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1141899339 16:86980379-86980401 ATGGATAAATAGATGATAGAGGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143737741 17:8925104-8925126 ATGGATAGATAGATAGTAGATGG + Intronic
1143737747 17:8925223-8925245 ATGGATAGATAGATAGTAGATGG + Intronic
1144242944 17:13331887-13331909 CTGGATTTAAAGATGGAATGAGG + Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144463247 17:15475380-15475402 GTGGATATCTAGATAGATGATGG + Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146099046 17:29960773-29960795 TTGGATATATACATAGAAGTGGG + Intronic
1146547285 17:33750004-33750026 GTGGATATTTAGATCAAAGAGGG - Intronic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152766974 17:82147090-82147112 ATGGATATATGGATGGTAGGTGG + Intronic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153968507 18:10203420-10203442 CTGATTATCTGGATGGAAGAAGG - Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1158495535 18:57951979-57952001 CTGGTTTTATACATGGAAGAGGG - Intergenic
1158550433 18:58431136-58431158 CTGGAGATATATCTGGTAGAGGG - Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159556439 18:69950688-69950710 CTGGATACATTGAGGGGAGATGG + Intronic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160052852 18:75452812-75452834 TTGGATATCTACATGGAAAATGG - Intergenic
1160642768 19:154520-154542 TTGGATATATACAAGGAAGTGGG - Intergenic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1165272126 19:34719083-34719105 TTGGATATATACATAGAAGTGGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167119862 19:47510370-47510392 CTGGAGAAATAGGTGGCAGAGGG - Intronic
1167233818 19:48301943-48301965 CTGGATAGATAGATGGATATGGG + Intronic
1167233864 19:48302196-48302218 CTGGATAGATAGATGGATATGGG + Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926495309 2:13579599-13579621 ATGAATATATAGTTGGAAGTTGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927239082 2:20903989-20904011 GTAGATATATAGTTGGAAAAGGG + Intergenic
927260334 2:21081903-21081925 CTCAATATATAAATGGCAGAGGG - Intergenic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
929191245 2:39142113-39142135 CTAGAAAGATAGATGAAAGAGGG - Intergenic
929865684 2:45715494-45715516 CTGGATAGATGGAAGCAAGAGGG - Intronic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935106013 2:100044428-100044450 TTGGGTAGATAGATGGAAGGGGG - Intronic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936756046 2:115713876-115713898 CTGGCTTTATAAATGGATGATGG - Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937665701 2:124484357-124484379 CAGGAAATATATATGGATGAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938215080 2:129504522-129504544 GTGGCTATACAGCTGGAAGATGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941705584 2:168655367-168655389 TTGGATATATACCTAGAAGAGGG - Intronic
941752270 2:169145665-169145687 ATGGCTATATTGCTGGAAGATGG - Intronic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
943720086 2:191194814-191194836 ATGGATAGATAAATGGAAGAAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945567526 2:211420463-211420485 CTGGAAGTATAGATGGGAGGTGG + Exonic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946469805 2:219947965-219947987 CTGGATATAGAGATGGATTGTGG + Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947329132 2:229009865-229009887 CTGGATAAAATGCTGGAAGAGGG - Intronic
947443690 2:230145910-230145932 CTGGATATATACCTAGAAGTGGG - Intergenic
947764400 2:232627524-232627546 TTGGATATATAGCTGAAAAAAGG - Intronic
948769192 2:240239517-240239539 GTGGATGGATAGATGGCAGATGG + Intergenic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1170238871 20:14140397-14140419 CTGAAGATATAGTTGTAAGAAGG + Intronic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172572649 20:35982518-35982540 GTGGACAAAGAGATGGAAGAGGG - Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175780280 20:61677782-61677804 ATGGATAGATACATGGATGATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1179474741 21:41635981-41636003 GTGGATGTATAGAAGGATGATGG - Intergenic
1179589110 21:42393988-42394010 ATAGATATATAGATAGAAAAAGG + Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184677284 22:46050631-46050653 CTGGCTTTAAAGACGGAAGAAGG - Exonic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949655645 3:6215402-6215424 TTGGATAGATAGAGGGAAGCAGG + Intergenic
950657651 3:14446987-14447009 ATGGATAGATGGATGGAAAATGG - Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
950993131 3:17463097-17463119 CAGGATATAATGATGGAAGGAGG - Intronic
952162483 3:30707766-30707788 CTGGATATCTAGAAGGATAATGG + Intergenic
952497247 3:33926620-33926642 TGGGAAATATAGATGGAATAAGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954299594 3:49692970-49692992 CTGGGTATATACCTGAAAGAAGG - Intronic
954861826 3:53696677-53696699 CTGGATTCAAAGATGGGAGAAGG + Intronic
955441273 3:58957497-58957519 CTGGGTATATACCTAGAAGAAGG + Intronic
955693556 3:61613676-61613698 ATGGTTATATAAATTGAAGATGG + Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956181312 3:66520396-66520418 CTGGAATTAAAGACGGAAGATGG - Intergenic
956780820 3:72601736-72601758 CTTGCTATCTGGATGGAAGAAGG + Intergenic
956905930 3:73765133-73765155 TTGGATAAATATATGGAAGTGGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957488920 3:80897861-80897883 CTCGATTGATAGATGGGAGATGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960790964 3:121430434-121430456 CTGGCTTTAAAGTTGGAAGAAGG - Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526665 3:146423778-146423800 CTGGTTTTAAAGATGGAAGGAGG + Intronic
964898346 3:161625623-161625645 CTGAATATATAAGTTGAAGAAGG + Intergenic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967612859 3:191528394-191528416 CTGGATATCTAGCTTGCAGATGG + Intergenic
967662739 3:192133137-192133159 CTGGATCTCTAGACGGCAGATGG - Intergenic
968930958 4:3578500-3578522 TTGGATATAGACATGGAAGCTGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969309226 4:6343029-6343051 TTGGATACATGGATGGAAGTGGG + Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
970215250 4:13751993-13752015 TTGGCTGTATAGATGGAAGGAGG - Intergenic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970517053 4:16843156-16843178 CTGGATATAGACATTGAACAAGG - Intronic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971425022 4:26507532-26507554 ATGGATAAATCAATGGAAGAGGG + Intergenic
972051279 4:34737449-34737471 TTGGATATATACATGGCAGTGGG - Intergenic
972256437 4:37360804-37360826 CTGCATATTTATAGGGAAGAGGG + Intronic
972620937 4:40748126-40748148 GTGGATAGAAAGATGGCAGAAGG + Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
974343038 4:60638600-60638622 AGGGATATATAGATCCAAGATGG - Intergenic
975067432 4:70085526-70085548 TGGGATAGATAGATGGAAGCAGG - Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978307697 4:107349829-107349851 CAAGATGTATAGATGGAAAAAGG + Intergenic
980190175 4:129514984-129515006 CTGCAGCTAAAGATGGAAGATGG + Intergenic
980236542 4:130114454-130114476 CTGGAAAGATAATTGGAAGAGGG - Intergenic
981057745 4:140383166-140383188 TTGTATTTATAGCTGGAAGATGG - Exonic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982263008 4:153511656-153511678 ATACATATATAGATGGAAAAAGG - Intronic
982924065 4:161313735-161313757 CTAGATGTAGAGTTGGAAGAAGG + Intergenic
983245990 4:165287497-165287519 CTGGATATATACACAGAAGTGGG + Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
993508077 5:88736080-88736102 TTGGATATGGAGATGGAAGGAGG - Intronic
993818669 5:92585576-92585598 ATGGATATATAGTTGGAAGAGGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
996702099 5:126460624-126460646 TGGGCTATAGAGATGGAAGAGGG - Intronic
996739061 5:126782515-126782537 CTGGAAGTATAGATAAAAGATGG + Intronic
997018530 5:129967013-129967035 TTGGTTATATAAATAGAAGATGG - Intronic
997044586 5:130298993-130299015 CTGGATACATAGTTGGGAGGAGG + Intergenic
998569838 5:143247358-143247380 ATGGATATATAGATAGTAGGTGG + Intergenic
998745635 5:145256203-145256225 CTGGATTTGAAGATGGAAGGAGG - Intergenic
999273013 5:150308786-150308808 CTGGATATATGGAAGGTAAATGG + Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001701717 5:173711632-173711654 GTGGACAGATGGATGGAAGATGG + Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002734106 5:181369966-181369988 TTGGATATATACAAGGAAGTGGG + Intergenic
1002750435 6:104160-104182 TTGGATATATACAAGGAAGTGGG - Intergenic
1003932586 6:10940316-10940338 TTGGATATATACATGGAAGTGGG - Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1007142164 6:39587121-39587143 CTAGATAGATGGATGGCAGATGG + Intronic
1007306379 6:40909212-40909234 CTGGATAGATACATGAAATATGG - Intergenic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1008472896 6:51903616-51903638 CTGCAGATATAGATGCCAGATGG + Exonic
1008483859 6:52014482-52014504 CTGGATAGATGGATGGATCATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008483911 6:52014771-52014793 CTGGATAGATGGATGGATCATGG + Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1010999757 6:82574602-82574624 CTGGATATTTATATGCAAGATGG + Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1012679392 6:102160116-102160138 CTGGGTATATAACTGAAAGAAGG + Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013264596 6:108483027-108483049 GTGGATATGTAGTTGAAAGAGGG - Intronic
1013295207 6:108752625-108752647 TGGGATGTATAGGTGGAAGAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014473299 6:121842413-121842435 CTAGAGATAAAGATGCAAGAAGG - Intergenic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015388310 6:132651450-132651472 CTAGATATATAGAGAGCAGAAGG - Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016283497 6:142447171-142447193 CTTGAAATAAAGATGGAAGGAGG - Intergenic
1016522057 6:144956720-144956742 ATGGATAGATAGATGATAGATGG - Intergenic
1016522060 6:144956804-144956826 ATGGATAGATAGATGATAGATGG - Intergenic
1016522064 6:144956910-144956932 ATGGATAGATAGATGATAGATGG - Intergenic
1016522065 6:144956929-144956951 ATGGATAGATAGATGATAGATGG - Intergenic
1016592374 6:145760975-145760997 TTGGATATATACCTAGAAGAGGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1019076539 6:169393004-169393026 AGGGATATAAGGATGGAAGAAGG - Intergenic
1019238354 6:170642280-170642302 TTGGATATATACAAGGAAGTGGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1019860935 7:3657503-3657525 CTGGATTTAAAGCAGGAAGAGGG + Intronic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021518996 7:21519802-21519824 CTGGACATAGTAATGGAAGAAGG + Intergenic
1021940071 7:25670301-25670323 CTGGCTCTCTAGATGGGAGAGGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022376035 7:29812218-29812240 CTGGATATATATACGGGAGTGGG - Intronic
1024840882 7:53586047-53586069 CTAGAAATATACAGGGAAGATGG + Intergenic
1025014407 7:55427312-55427334 CTGGATACTGATATGGAAGATGG + Intronic
1026080160 7:67210857-67210879 ATGGATAGATAGATGATAGAAGG - Intronic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1030388358 7:108893678-108893700 CTGGATATATATCTGAAAAAGGG + Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1030897992 7:115085508-115085530 CTGGATATATACAGGCATGAAGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1032725212 7:134584556-134584578 ATGGATAAATGGATGGAAGCAGG + Intergenic
1032790201 7:135237121-135237143 ATGGTATTATAGATGGAAGAAGG + Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035509415 8:164327-164349 TTGGATATATACAAGGAAGTGGG - Intergenic
1035523739 8:295488-295510 GTAGATAAATAGATGGATGATGG - Intergenic
1035611347 8:966810-966832 GTGGAAATAAAGCTGGAAGAAGG - Intergenic
1036225160 8:6951660-6951682 CTAGATTTATAGCTGGGAGAAGG + Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037608584 8:20457811-20457833 ATGGATAGATGGATGGAAGCGGG - Intergenic
1037871147 8:22497778-22497800 CTAGATATTTAGATAGAACATGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1039908554 8:41805878-41805900 TTGGATATGTAGTTGGAAAAAGG + Intronic
1040805124 8:51386616-51386638 GTGGATAAATAGATGATAGATGG + Intronic
1040886828 8:52272710-52272732 CTGGATATATACCCAGAAGATGG - Intronic
1041333338 8:56751995-56752017 TGGGATATATACATGGAGGATGG + Intergenic
1041492404 8:58449029-58449051 CTGGTTTTTAAGATGGAAGAAGG - Exonic
1041762706 8:61384288-61384310 CTGGACATATGGAAGCAAGATGG + Intronic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042580685 8:70275839-70275861 ATAGATATATAGATAGACGATGG + Intronic
1042662308 8:71168359-71168381 CGGGATATACAGACTGAAGAAGG - Intergenic
1043104089 8:76085929-76085951 CTATATAAATACATGGAAGAAGG - Intergenic
1044647935 8:94464306-94464328 CTGGCTATGAAGACGGAAGAAGG + Intronic
1044868550 8:96596334-96596356 CTGGATAGCTGGATGAAAGAAGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045002732 8:97892567-97892589 ATGGATATGTAGTTGGAAAAGGG + Intronic
1045650752 8:104339783-104339805 CTTGATATATAGCAGGAAAAAGG - Intronic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047738938 8:127791753-127791775 ATAGATATATAGATGGATGCAGG - Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048024115 8:130568702-130568724 CTGGATAAATGGATGTTAGATGG + Intergenic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048756407 8:137743287-137743309 CTGGGTATATACATAGAAGTGGG + Intergenic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989302 8:139751990-139752012 ATGGATAGATGGATGGTAGACGG - Intronic
1048989398 8:139752456-139752478 TTGGATAGATGGATGGTAGATGG - Intronic
1048989430 8:139752618-139752640 ATGGATAGATGGATGGTAGATGG - Intronic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049416110 8:142496102-142496124 CTGGATGTATAGATGGTAGATGG + Intronic
1049416138 8:142496225-142496247 CTGGATGTAGAGATGGTAGATGG + Intronic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1050742923 9:8843053-8843075 GTGGCAATATAGTTGGAAGAGGG - Intronic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052220077 9:26010187-26010209 CTGGATAGGTGGATGGATGACGG - Intergenic
1055241409 9:74190858-74190880 CTGGAGATCTCAATGGAAGAAGG - Intergenic
1055710496 9:79055725-79055747 GTAGATAGATAGATGGATGAGGG - Intergenic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057278118 9:93686969-93686991 CTGGAAGTCTAGATGGCAGAGGG + Intergenic
1057551250 9:96052530-96052552 GTGGATAGTAAGATGGAAGAGGG - Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057977138 9:99617933-99617955 ATGGATAGATAGATAGAACATGG + Intergenic
1058090953 9:100804752-100804774 CTGGATTTGAAGATGGAAGGAGG + Intergenic
1058230883 9:102422898-102422920 CTGGATGGATCGATGGATGATGG - Intergenic
1058315793 9:103564320-103564342 TTGTAGATATAGATTGAAGACGG - Intergenic
1058731680 9:107856541-107856563 CTGCTTCTATAGCTGGAAGATGG + Intergenic
1059212224 9:112524061-112524083 GTGGAGATATAGATGGGAAATGG - Intronic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059868323 9:118542655-118542677 CTGGATACATCTATGGAAGTGGG - Intergenic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062301156 9:135871021-135871043 GTAGATATATAATTGGAAGAGGG - Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062758558 9:138322572-138322594 TTGGATATATACAAGGAAGTGGG + Intergenic
1185480461 X:442383-442405 ATGGATAGATAGATGATAGATGG - Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185498679 X:580688-580710 ATGGATAAATAGATGATAGATGG + Intergenic
1185498683 X:580749-580771 ATGGATAAATAGATGATAGATGG + Intergenic
1185498684 X:580768-580790 ATGGATAGATAGATGATAGATGG + Intergenic
1185498692 X:580892-580914 ATGGATAAATAGATGATAGACGG + Intergenic
1185498701 X:581035-581057 ATGGATAAATAGATGATAGACGG + Intergenic
1185498708 X:581152-581174 ATGGATAAATAGATGATAGATGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1185695792 X:2193482-2193504 CTAGATACATAGATGATAGACGG - Intergenic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185780568 X:2841118-2841140 ATGGATAGATAGATGATAGATGG + Intronic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186010642 X:5128314-5128336 CTTGTTGTATAGATGGAAGGTGG + Intergenic
1186150461 X:6669408-6669430 ATGGATCTATAGAGGGAAGCAGG + Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1187118763 X:16382466-16382488 TTGGATATATAGTCGGAAGTGGG - Intergenic
1187756849 X:22537563-22537585 CTGGATATAAAATTGGAATAGGG + Intergenic
1187764459 X:22624662-22624684 ATAGATAGATAGATAGAAGATGG - Intergenic
1187987221 X:24827486-24827508 CTGGATACATAGGTGGGAGCTGG - Intronic
1188047081 X:25438195-25438217 CTGGATATATCACTGGAACATGG + Intergenic
1188413551 X:29904168-29904190 TTCGATATCTAAATGGAAGAGGG + Intronic
1188942369 X:36255599-36255621 CTGGATATAATGCTGGAAGATGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189561772 X:42198514-42198536 TTGGATATATACCTGGAAGCAGG + Intergenic
1190231398 X:48585067-48585089 TTGGATATATACCTGGAAGTAGG + Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1191943818 X:66507982-66508004 CTGGGTATATACCTGAAAGAAGG + Intergenic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194059709 X:89181897-89181919 GGGGATATAAGGATGGAAGAAGG - Intergenic
1194523808 X:94951035-94951057 TTGGCTATAGAGATGGAAAAAGG + Intergenic
1195027531 X:100892815-100892837 TTGGATATATACCTGGAATAGGG - Intergenic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195756897 X:108207532-108207554 ATGGATAGATAGATAGAAGGAGG + Intronic
1196185887 X:112744399-112744421 ATGGCTATGCAGATGGAAGAAGG - Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197074075 X:122334872-122334894 TTGGATTAATAGATGGGAGATGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1201343833 Y:12961038-12961060 ATGGATATATAGATGTAACCAGG + Intergenic
1201983934 Y:19940856-19940878 TTGGATATATATCTGGAAGTGGG - Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic