ID: 959364148

View in Genome Browser
Species Human (GRCh38)
Location 3:105435702-105435724
Sequence CTAATACACAAGTGAAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959364148_959364154 30 Left 959364148 3:105435702-105435724 CCATTGCTTCACTTGTGTATTAG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 959364154 3:105435755-105435777 CCAAACCTGGGAAGAAAAAGAGG 0: 1
1: 21
2: 375
3: 731
4: 1736
959364148_959364150 17 Left 959364148 3:105435702-105435724 CCATTGCTTCACTTGTGTATTAG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 959364150 3:105435742-105435764 GATAAAGACATACCCAAACCTGG 0: 2
1: 127
2: 1720
3: 3792
4: 6109
959364148_959364151 18 Left 959364148 3:105435702-105435724 CCATTGCTTCACTTGTGTATTAG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 959364151 3:105435743-105435765 ATAAAGACATACCCAAACCTGGG 0: 3
1: 181
2: 2651
3: 4653
4: 8231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959364148 Original CRISPR CTAATACACAAGTGAAGCAA TGG (reversed) Intronic
901349964 1:8586041-8586063 CTAATACACAAGAAATGCAGGGG + Intronic
901381435 1:8877478-8877500 CTGAAAGGCAAGTGAAGCAATGG + Intronic
901921140 1:12538509-12538531 CTTAGACACATGTAAAGCAAGGG + Intergenic
904126260 1:28241866-28241888 CTAATAGGCAACTGAAGCACTGG - Intronic
907689746 1:56651025-56651047 CTAGCACACAAGTCAAGCAAGGG - Intronic
907846256 1:58210464-58210486 CCAACACACAAGTGAATTAAAGG + Intronic
908158674 1:61384482-61384504 ATAATACACAAATGAAAGAAGGG - Intronic
908644113 1:66258598-66258620 CTACTAAACAAGAGAATCAATGG - Intronic
909106530 1:71416789-71416811 CAAATACAAAAGTGCAGCAAAGG - Intronic
909815693 1:79990734-79990756 CTAAAACACAACTTAAGAAATGG + Intergenic
910090578 1:83458419-83458441 CAAATACACAAGCTCAGCAATGG + Intergenic
917290554 1:173468299-173468321 CTCACACACGAGTGAAGAAAGGG + Intergenic
918436611 1:184520464-184520486 CTCATACTCAGGAGAAGCAAAGG - Intronic
918802896 1:188996390-188996412 CTCATAGACATGAGAAGCAAAGG + Intergenic
919243457 1:194945614-194945636 CTAACAAATAAGTGAAGCACAGG + Intergenic
923476310 1:234334759-234334781 CTAAAACTCAAGAGAAGAAAAGG + Intergenic
923986094 1:239384284-239384306 AAAATACACAAGATAAGCAAAGG - Intergenic
924266624 1:242289250-242289272 CTAATTCAGAAGTGAAAAAAAGG - Intronic
1065539517 10:26747874-26747896 TAAATACATAAGTGAACCAAAGG - Exonic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1067208571 10:44239863-44239885 CTGAGACACCAGTCAAGCAATGG + Intergenic
1067984940 10:51132821-51132843 CTGATAAATAAGTGAAGTAATGG + Intronic
1070341680 10:75503972-75503994 CTAACACACAAATGAATGAATGG - Intronic
1071317702 10:84418678-84418700 CTAACACCCCAGTGAAGCACTGG - Intronic
1072500028 10:96005643-96005665 CTAATACATAACTGAAGAAAGGG - Intronic
1074309031 10:112306202-112306224 ATAATACACAGATGAAGGAATGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1079683707 11:23330187-23330209 CCAATACTCAAATGAAGAAAAGG - Intergenic
1080045145 11:27800334-27800356 CTAAAAGACAAGTTAAGGAAAGG + Intergenic
1080135896 11:28854545-28854567 CTATTTCACAAATGAAGGAATGG + Intergenic
1080823804 11:35831049-35831071 CTAATTTATAAGGGAAGCAAGGG - Intergenic
1081153836 11:39664724-39664746 CTGAGACAGAAGAGAAGCAATGG - Intergenic
1081191687 11:40111669-40111691 CTAATACATCAGTGCAGCTACGG + Intergenic
1081732803 11:45383512-45383534 GGAATACAGAAGTGAAGGAAGGG - Intergenic
1082190210 11:49233993-49234015 CTATTATAGAAGTGAAGCACAGG - Intergenic
1084925153 11:72505546-72505568 CTAATACACAAGCTAAACTAAGG - Intergenic
1086529635 11:87769521-87769543 CTAATACACGTGTTAAGAAAGGG + Intergenic
1086675915 11:89606915-89606937 CTATTATAGAAGTGAAGCACAGG + Intergenic
1086747655 11:90450326-90450348 GTAATTCACAACTGTAGCAATGG - Intergenic
1091152822 11:133344522-133344544 GTAATGCACAGGGGAAGCAAGGG - Intronic
1091841635 12:3625584-3625606 CTCATTCAAAAGTGAAGAAAGGG - Intronic
1095458481 12:42415638-42415660 CTAATACAGTGGTGAAGCCATGG - Intronic
1096951009 12:55471306-55471328 ATAGTACAGAAGTAAAGCAAAGG + Intergenic
1098479137 12:70940295-70940317 CTAATAACCAGGTGAAGTAAAGG - Intergenic
1098548395 12:71736344-71736366 AAAATACACAAGTGAATTAAAGG - Intergenic
1098987084 12:77024254-77024276 CTAACACACAGGTCAAGAAAGGG - Intronic
1099482694 12:83188769-83188791 CTAATGCACAAGAGTAGCAATGG + Intergenic
1100885385 12:99064333-99064355 GTAAAATAGAAGTGAAGCAATGG + Intronic
1102209263 12:111112778-111112800 ATAAAACACAGGAGAAGCAAGGG - Intronic
1104073692 12:125370827-125370849 CTAATACACCAGTCAAACATTGG - Intronic
1106996849 13:35494565-35494587 TTAAAAAACAAGTGAAGGAATGG + Intronic
1109142289 13:58729332-58729354 CACATATACAACTGAAGCAAAGG + Intergenic
1110576986 13:77068996-77069018 CTAAGAAACAAGTAAAGCTAAGG + Intronic
1112695391 13:101942796-101942818 TGATTATACAAGTGAAGCAAAGG - Intronic
1114775985 14:25482047-25482069 CTCATAAACAACTGAAGCCAGGG - Intergenic
1116605511 14:46988423-46988445 CTGAAACACCAGGGAAGCAAAGG + Intronic
1118513015 14:66496996-66497018 ATAATACTAAAGTGAAGTAAAGG - Intergenic
1118805732 14:69235192-69235214 AAAATACACAAATAAAGCAAAGG - Intronic
1119342925 14:73895907-73895929 CTAATACAAAAGTTAAGGAGAGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1128023271 15:64412123-64412145 CTAACATACAACTAAAGCAAAGG - Intronic
1128763315 15:70234455-70234477 CTCATACACAATTGATGCATAGG - Intergenic
1129043884 15:72715497-72715519 CTGATACACAAGTGGGGGAATGG + Intronic
1131814726 15:96210713-96210735 ATAATAAACAAATTAAGCAAGGG + Intergenic
1131902816 15:97106711-97106733 CTAATACTCCCTTGAAGCAAAGG + Intergenic
1135952399 16:26927387-26927409 CTAATACACTGGTCAAGCAGTGG + Intergenic
1139179776 16:64732754-64732776 CTAATACAGAAATTAAGAAAAGG - Intergenic
1141018101 16:80469018-80469040 CTAAGAAACAAGTCAATCAATGG + Intergenic
1141270377 16:82534631-82534653 GTAAGACAAAAGTGAAACAATGG + Intergenic
1146581034 17:34039341-34039363 CTGAAACAAAAGTGAAGCAGAGG + Intronic
1146910388 17:36644837-36644859 CTAGTTCACAAGTAGAGCAAGGG - Intergenic
1149084193 17:52694565-52694587 CTAAGACACTAATGAAGCAAGGG + Intergenic
1149976690 17:61272898-61272920 CTAATGCAGAAGTGAGCCAAAGG - Intronic
1150114675 17:62536316-62536338 CTGAAACAAAAGTGAAGCAGAGG - Exonic
1151068643 17:71182358-71182380 ATTATAAACAAGTGAAGTAATGG - Intergenic
1151099652 17:71542248-71542270 CTAATTAACAGGTGAAGAAATGG - Intergenic
1156970062 18:43143562-43143584 CCAATTCACAAATGAAGAAATGG + Intergenic
1157103702 18:44753463-44753485 CTAATACACAAGTCTGTCAAAGG - Intronic
1158450768 18:57562751-57562773 CAAACACACAATTTAAGCAAGGG + Intronic
1159682023 18:71366881-71366903 CTAATACACCAAGGAAGCCACGG - Intergenic
1165196705 19:34109720-34109742 CTGATCCACAAGTGAAGGAGAGG - Intergenic
925246477 2:2388132-2388154 CTAATACAGACGTGAAGGAAGGG - Intergenic
925786472 2:7435851-7435873 GCAACACACAAGTGAATCAAAGG - Intergenic
929036291 2:37695159-37695181 GGAATACACAAATGAAACAATGG + Intronic
929714539 2:44297066-44297088 CTAATACACAAGTGAACTGTGGG + Intronic
929774385 2:44919336-44919358 CCAGAACACAAGTGAAGGAATGG - Intergenic
930846325 2:55908598-55908620 CAAAAAAACAAGTGAAGTAATGG + Intronic
930909097 2:56609004-56609026 CTAATAAGCAATTGTAGCAAGGG - Intergenic
931712400 2:64999884-64999906 CTAATGAACAAATGCAGCAAAGG - Intronic
931905988 2:66844606-66844628 ATCATACACAGGTGACGCAAAGG + Intergenic
932549259 2:72750788-72750810 CAAATAACCAACTGAAGCAAAGG + Intronic
935264268 2:101381301-101381323 CGAATAAACAAGCCAAGCAAGGG - Intronic
937593325 2:123641808-123641830 GTATCACACAAGTGAAGCCAAGG - Intergenic
938608196 2:132918698-132918720 ATAAAACACAAGTGATTCAAAGG + Intronic
939252979 2:139706998-139707020 CTGATAAACAAGGGAAGAAAGGG - Intergenic
939374927 2:141352185-141352207 TTAATACAAAAGTGGATCAAAGG - Intronic
939426452 2:142044200-142044222 TTAATGCACAAATAAAGCAAGGG - Intronic
939604265 2:144234400-144234422 CTAATGCACAAGATAAGTAAAGG + Intronic
941568395 2:167138506-167138528 CCAATACATAAGTGAGGAAAAGG - Intronic
942503795 2:176620203-176620225 CCAATACACAAATGAAGAAATGG + Intergenic
943246983 2:185467291-185467313 CAAGTACACAAGTGAAGGAAGGG - Intergenic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
943699722 2:190976592-190976614 CAAATACACAAGACCAGCAATGG + Intronic
948249855 2:236518385-236518407 ATAAAACAAAAGTGAAGCTAGGG + Intergenic
1169797326 20:9477617-9477639 CTAATAGAGAAATGAAGAAATGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170647777 20:18212244-18212266 GTAATAGAAAAGTGAAACAATGG - Intergenic
1170949421 20:20923096-20923118 TTAAGACAGAAGTGAAACAATGG - Intergenic
1171438018 20:25138865-25138887 CTAATTCAAAAGTGACACAAAGG - Intergenic
1172573841 20:35991710-35991732 CCATTTCACAGGTGAAGCAATGG - Intronic
1174714552 20:52743830-52743852 CTAATTGAAATGTGAAGCAATGG - Intergenic
1175322458 20:58098908-58098930 CTGATTCAGAAGTGAAGCAAAGG - Intergenic
1176333430 21:5572817-5572839 CCAATAAACAAATGAAGAAAAGG - Intergenic
1176394327 21:6248135-6248157 CCAATAAACAAATGAAGAAAAGG + Intergenic
1176467092 21:7068039-7068061 CCAATAAACAAATGAAGAAAAGG - Intronic
1176490653 21:7449817-7449839 CCAATAAACAAATGAAGAAAAGG - Intergenic
1176509989 21:7688566-7688588 CCAATAAACAAATGAAGAAAAGG + Intergenic
1177411734 21:20738638-20738660 CTGATACAGAACTGAAGCAATGG + Intergenic
1177544076 21:22534287-22534309 CCAATGCAAAAGAGAAGCAAAGG + Intergenic
1177839513 21:26220128-26220150 CTAATACACCATTTTAGCAAAGG - Intergenic
1178404779 21:32315260-32315282 TTAACACAAAAGTTAAGCAAAGG - Intronic
1181418834 22:22782525-22782547 CTAATACATAAATTAAGCAAAGG + Intronic
1182017838 22:27055811-27055833 CTAAGACACCAATGAATCAAAGG + Intergenic
953069272 3:39503090-39503112 CTATTAGACAACGGAAGCAATGG - Intronic
955935640 3:64099955-64099977 TTAATACAGATGTGCAGCAATGG + Intronic
957298331 3:78360131-78360153 CAACAAAACAAGTGAAGCAATGG - Intergenic
957598590 3:82301762-82301784 CTAAAACACAATCTAAGCAATGG + Intergenic
958044937 3:88272432-88272454 CTAGTAAATAAGTTAAGCAATGG - Intergenic
959059912 3:101606888-101606910 ATAATACAAAAGTGAGGAAAAGG - Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
960109229 3:113829090-113829112 CTAAGTCACAAGAGAAGCAAGGG - Intronic
961229299 3:125287831-125287853 CTAATACAAATGAGAAGAAAGGG + Intronic
966897670 3:184457842-184457864 CTAATACAGGAGTGAAGGAAGGG - Intronic
969066426 4:4485491-4485513 CTGATTCACAACTGAAGAAATGG - Intronic
970628255 4:17913412-17913434 ATAAAACACAATTAAAGCAATGG + Intronic
970888270 4:21012039-21012061 CTAATTCGAAAGGGAAGCAAGGG + Intronic
972040958 4:34598153-34598175 TTAATACAAAAGTGATTCAATGG + Intergenic
975941461 4:79652230-79652252 TAAAAACACAAGTTAAGCAATGG + Intergenic
976851153 4:89547243-89547265 CTAATACACAAGCTCAGTAAAGG + Intergenic
977249062 4:94668672-94668694 CTAATAAACAAATGAGGCAGAGG - Intergenic
978896993 4:113901084-113901106 CTAATAGGCAATTGAAGGAATGG - Exonic
979672506 4:123374926-123374948 CTACTACACACTTGAAGGAATGG - Intergenic
980802380 4:137769083-137769105 CTATTACACAAGTGAATGAGGGG + Intergenic
983423424 4:167550524-167550546 CAAAGACAAAAGTGCAGCAAAGG + Intergenic
983664836 4:170169111-170169133 CTAATACACCAGAGCAGCCAGGG - Intergenic
983860278 4:172697533-172697555 CCAATACACAAGTGAACAATTGG + Intronic
987895168 5:23936001-23936023 CTAATAAACAAATTCAGCAAGGG - Intergenic
988074531 5:26336076-26336098 AAAATAAACAAGTGAAGAAAAGG + Intergenic
990170024 5:53037683-53037705 CTAATAAAGAAGGTAAGCAAAGG + Intronic
992161500 5:74008460-74008482 CTAATATACAAATGAATCACTGG - Intergenic
993245698 5:85450220-85450242 CTTATAGACAAGTGATGCAGAGG + Intergenic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
995383088 5:111557116-111557138 CTAATACATGAGTTCAGCAAAGG - Intergenic
997396523 5:133564417-133564439 GTAATATACAAGTGAGGCACTGG - Intronic
999085721 5:148887451-148887473 CTGATACATTAGTGATGCAAGGG + Intergenic
1000681912 5:164195842-164195864 CTAATACAGAAGTGGAAAAATGG - Intergenic
1002887053 6:1307056-1307078 CTTGTTCACAATTGAAGCAAGGG + Intergenic
1004966356 6:20856172-20856194 CTAAAATACAGATGAAGCAATGG - Intronic
1004973298 6:20935994-20936016 CTAATACAAAGGAGAAGCTATGG - Intronic
1005085406 6:22001308-22001330 CTAATAAACACATGAACCAAAGG - Intergenic
1008956350 6:57221087-57221109 CTAATAAATTAGAGAAGCAAAGG + Intronic
1009673992 6:66793239-66793261 CTAATACCCAAGTTATTCAAAGG + Intergenic
1011452344 6:87507447-87507469 TTAATACACAATTGAGGAAATGG + Intronic
1011974932 6:93283832-93283854 CACATAAACATGTGAAGCAAAGG - Intronic
1012390818 6:98737575-98737597 CTAAGACTCAAATGAAGAAAAGG - Intergenic
1018233390 6:161698331-161698353 ATACTATACAAGTCAAGCAAAGG + Intronic
1020559074 7:9706681-9706703 GTCATAGACAAGTAAAGCAAAGG - Intergenic
1020663521 7:11010406-11010428 ATAACACACAAGATAAGCAAAGG - Intronic
1021036685 7:15808870-15808892 CTAATACATATATGAAGCAATGG - Intergenic
1021611504 7:22462159-22462181 CTAATCCAGGAGTGAAGCTAGGG - Intronic
1022069683 7:26900475-26900497 CTAATACAGGAGAGAGGCAAAGG - Intronic
1022090841 7:27107247-27107269 CCAATACACAATTGAACAAAAGG + Exonic
1022108267 7:27212375-27212397 CTAAGACTCAAGGGAAGCTAGGG + Intergenic
1022377677 7:29829658-29829680 CTAATTTACAAATGAAGAAAAGG + Intronic
1023981329 7:45072342-45072364 CTAATCTACAAGTGAAGACAGGG + Intronic
1024692074 7:51813978-51814000 GTAATACACAGGTGACTCAATGG + Intergenic
1025791038 7:64686850-64686872 CTAACACCCAAGTGAATAAACGG + Intronic
1027307426 7:76914882-76914904 CAAATACACAAGCTCAGCAATGG + Intergenic
1027469819 7:78559301-78559323 TTAATACACAAGTCAACCAAGGG - Intronic
1032044384 7:128591996-128592018 CTGAAACAAAAGTGAAGCAGAGG - Intergenic
1032315492 7:130834775-130834797 TTAATTCACAAGGGAAGAAATGG - Intergenic
1033147283 7:138882301-138882323 CAAATAGACAAGAGAGGCAAAGG + Intronic
1038699714 8:29838368-29838390 CAAATAAAGAAGTGAAGAAATGG + Intergenic
1041098104 8:54369725-54369747 CTAATACAGAAGAGAAAAAAGGG - Intergenic
1043855542 8:85261163-85261185 TAAATACATAAGTGAACCAAAGG - Intronic
1047153613 8:122293508-122293530 CTAATACACAGGTCAAGTCATGG - Intergenic
1048445056 8:134487162-134487184 GAGATACACAAGTGTAGCAATGG - Intronic
1050574920 9:6984862-6984884 TTAGTACAAAAGAGAAGCAAGGG - Intronic
1052539441 9:29789726-29789748 CTAATACAACAGTGAAATAATGG - Intergenic
1053522618 9:38796350-38796372 CTAATAAACAAATTCAGCAAAGG - Intergenic
1054194846 9:62020773-62020795 CTAATAAACAAATTCAGCAAAGG - Intergenic
1054643562 9:67567917-67567939 CTAATAAACAAATTCAGCAAAGG + Intergenic
1054937971 9:70709611-70709633 CTAATAAACCAGGGAAGCATGGG - Intronic
1054939662 9:70727604-70727626 CTAATAAACCAGGGAAGCATGGG - Intronic
1056333400 9:85540744-85540766 CTAAAACACTGGTGAAGCAAAGG + Intergenic
1057434653 9:95028728-95028750 TAAATACAACAGTGAAGCAATGG - Intronic
1058457148 9:105148088-105148110 GTAATCCACAAATGAAGCGAGGG + Intergenic
1061216366 9:129224240-129224262 CTAAAACACAAATGAAGAAGTGG - Intergenic
1061559343 9:131393145-131393167 CTAATTCACAGGTGAGACAAAGG - Intergenic
1203428267 Un_GL000195v1:62405-62427 CCAATAAACAAATGAAGAAAAGG + Intergenic
1187750410 X:22457415-22457437 ATAGTACACAAGAGAAGGAAAGG + Intergenic
1188830513 X:34891046-34891068 GTAATAAACAACTGAAACAATGG - Intergenic
1195250994 X:103046947-103046969 ATAATACAACAGTGTAGCAAGGG + Intergenic
1197296317 X:124723432-124723454 CTAATACATAAGTGTTGCCATGG + Intronic
1197552186 X:127904942-127904964 CTAATAAACAACTTCAGCAAAGG + Intergenic
1200824755 Y:7626279-7626301 CTAATACCCATGGGAAGGAAAGG - Intergenic
1202235300 Y:22704808-22704830 CTAATACCCATGGGAAGGAAAGG + Intergenic
1202307859 Y:23491360-23491382 CTAATACCCATGGGAAGGAAAGG - Intergenic
1202562942 Y:26179226-26179248 CTAATACCCATGGGAAGGAAAGG + Intergenic