ID: 959365312

View in Genome Browser
Species Human (GRCh38)
Location 3:105450954-105450976
Sequence ATGTAGAGGGAGAATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959365312 Original CRISPR ATGTAGAGGGAGAATTAGGA TGG Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901818531 1:11810049-11810071 ATGTAGAAGGATATTTAGTAAGG + Intronic
902705414 1:18200886-18200908 ATGAGGAGGGATAATGAGGAGGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905454123 1:38075896-38075918 ATGTACAGGGAGAGCCAGGAGGG - Intergenic
905893414 1:41530839-41530861 ATGGAGAGAGAGAGATAGGAAGG + Intronic
906400593 1:45501425-45501447 ATATAGAGGGAGAAGTAGGTTGG + Intronic
906562021 1:46765301-46765323 ATGAAGAGGGATAATTAGGTAGG - Intronic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
908394062 1:63709141-63709163 TTGTAGGGGAAGAACTAGGATGG + Intergenic
908488526 1:64619149-64619171 ATGTAGATGGTGAAATTGGAAGG + Intronic
908802635 1:67896455-67896477 ATGCAGAGGGATTATGAGGAGGG - Intergenic
909267867 1:73584799-73584821 GTGAAGAGGGAGAATAAAGATGG + Intergenic
910344389 1:86219156-86219178 ATATAAAGGTAGATTTAGGATGG + Intergenic
910592045 1:88936507-88936529 AGGTAGAGGGAGTCATAGGAAGG - Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916699092 1:167272605-167272627 AGGAAGAGAGAGAAGTAGGAGGG + Intronic
917726017 1:177828190-177828212 ATATAGAGAGATAATTAAGATGG + Intergenic
917903038 1:179562505-179562527 AAGTGGAGGGAGGATAAGGAAGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
919486117 1:198149339-198149361 GTGGAGAGGGAGGAGTAGGAAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920319980 1:205112754-205112776 ATGTCGAGACAGTATTAGGAGGG + Intronic
920971059 1:210744111-210744133 CTGTAGAGGGAGGATAAGCAAGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921770653 1:219035384-219035406 ATTTAAAGGAAGAATTGGGAGGG + Intergenic
921823796 1:219648494-219648516 GTGTAGAGGGAGAATTACAAAGG - Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924256899 1:242191807-242191829 AGGTACAGAGAGAATGAGGAGGG + Intronic
1063847717 10:10149791-10149813 ATGAAGAGGGAGGAGTGGGATGG - Intergenic
1063939644 10:11114091-11114113 AAGCAGAGGGAGAAATAGGGAGG - Intronic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1065126850 10:22582163-22582185 GTTCTGAGGGAGAATTAGGAAGG - Intronic
1067193100 10:44089097-44089119 ATGAAGAGGTAGAAGTAGCAGGG + Intergenic
1067258305 10:44664440-44664462 ATGGAGAGTGAGGAATAGGATGG + Intergenic
1068017982 10:51542236-51542258 ATAGAGAGAGAGAATTTGGAGGG + Intronic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1071463138 10:85917393-85917415 ATTTAGAGGGTAAATTTGGAGGG - Intronic
1072541992 10:96405641-96405663 ATGGAGACGGAGGATTTGGAAGG + Intronic
1072853682 10:98924495-98924517 AAGTGGAGGGAAAAATAGGAAGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1074672253 10:115805105-115805127 ATTAGGAGGTAGAATTAGGAGGG - Intronic
1076479700 10:130777067-130777089 ATTTAGGGAGAGAATAAGGAAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077448264 11:2613792-2613814 ATGGGTAGGGGGAATTAGGATGG - Intronic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1079321933 11:19458334-19458356 ATGTAGAGGAAGCATTAGGTGGG + Intronic
1079944621 11:26726216-26726238 ATAGAGAGGGAGAAGAAGGAAGG - Intergenic
1080643361 11:34171155-34171177 GTGTAGAGTGAGGATGAGGATGG + Intronic
1082743676 11:56939201-56939223 ATGGAGTGGGAGAAGTAGGGAGG - Intergenic
1084933365 11:72574234-72574256 ATGCAGAGGGAGGACTTGGAGGG - Intergenic
1086327222 11:85714688-85714710 ATATAGAGAGAGAACTAGCAAGG + Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1088245849 11:107817370-107817392 AAGTAAAGGGAGAACTAGGAAGG + Intronic
1088489119 11:110369912-110369934 ATGAAGAGAGGGAAATAGGAAGG - Intergenic
1090889932 11:130914914-130914936 CTGTAGAGGGAGATTTGGGTGGG - Exonic
1092430646 12:8405661-8405683 CTGTAGAGGGAGGAATAGAAGGG + Intergenic
1093618848 12:21263529-21263551 ATATATAGGGAAAATTAGAAAGG - Intergenic
1096929461 12:55190473-55190495 ATGTAGTTGGAGAATTGGCAAGG + Intergenic
1097144532 12:56930810-56930832 ATAGAGAGGGAGAAGTATGATGG - Intronic
1098437390 12:70482263-70482285 ATGAAGAGCAAGAATAAGGATGG - Intergenic
1098775542 12:74609625-74609647 ATGGTAAGGTAGAATTAGGATGG + Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100112223 12:91259665-91259687 AGGTAGAGGGACATTTAGAATGG - Intergenic
1100181325 12:92089146-92089168 ATGTATAGAGTGATTTAGGAGGG + Intronic
1100274891 12:93062881-93062903 AGGTTTAGGGAGAATTAGAAGGG + Intergenic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102424009 12:112826258-112826280 ATGTTGAGGGAGCAGCAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103454095 12:121051155-121051177 ATATGCAGGGAGAATTTGGAGGG + Intergenic
1104237594 12:126954178-126954200 CTGTAGAGAGACTATTAGGAAGG + Intergenic
1104827477 12:131723621-131723643 ATGAAGAGGGGAAATTAGCAAGG - Intronic
1107684201 13:42880276-42880298 ATTTAGAGCAAGAATAAGGAAGG - Intergenic
1107910579 13:45101657-45101679 AAGTAGAGGGAGAAATCGAAAGG - Intergenic
1108011670 13:46020212-46020234 TTCTAGAGGGAAAACTAGGAAGG + Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108513845 13:51178824-51178846 ATGTAAAGGGAACATTTGGAGGG - Intergenic
1110784068 13:79502553-79502575 AGATAGAGGGAAAATCAGGAGGG + Intronic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1114975247 14:28088516-28088538 AGGAAGAGGGAGAATTAGACAGG - Intergenic
1118515677 14:66526092-66526114 ATGGATAGGGAGAATCAGTATGG - Intronic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1119429047 14:74553818-74553840 AGGTTGAGGGAGAAATGGGAGGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120599441 14:86483328-86483350 AGGTAGAGGAAAAATTTGGAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121153329 14:91658404-91658426 ATGTAGGGGGAGAATGGCGATGG + Intronic
1121939822 14:98059436-98059458 GGGGAGAGGGAGAAGTAGGAGGG + Intergenic
1122254998 14:100470121-100470143 AGGTGGACAGAGAATTAGGATGG + Intronic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125233963 15:37490278-37490300 ATGAGGAGATAGAATTAGGAAGG + Intergenic
1125470091 15:39993924-39993946 ATGTTGGATGAGAATTAGGAAGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128595824 15:68948342-68948364 ATTAAGAGGGAGAATCAGGCCGG + Intronic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1129460022 15:75695923-75695945 AAGTAGAGGGAAAAGTAGAATGG + Intronic
1132624493 16:884865-884887 AGGTAGAGGGAGAATGATCACGG + Intronic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134449392 16:14354212-14354234 AGGTAGAGGGAGGAGGAGGAAGG + Intergenic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1137535734 16:49323661-49323683 ATGTTGAAGGAAAATTAGAAGGG - Intergenic
1137951406 16:52787126-52787148 ATGAAGAGGGAGAAATGGGGAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138330964 16:56214943-56214965 ATGCAGAGGGTGACTTAGCATGG - Intronic
1138863243 16:60785386-60785408 AGGCAGAGGGAGCTTTAGGAAGG - Intergenic
1139230973 16:65281879-65281901 TTGTAGAGAGAGATGTAGGAAGG - Intergenic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1141704430 16:85656884-85656906 ATGTAGCCGGGGCATTAGGAAGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1144593039 17:16540889-16540911 AAGTAAAGGGAGACTTAGGCTGG + Intergenic
1145058957 17:19720467-19720489 ATGGAGAGGGAGGAATAGAAAGG - Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146926070 17:36746456-36746478 ATGTAGAGGCTAAATTAGGCCGG - Intergenic
1147988023 17:44317586-44317608 AGGCATAGGGAGAACTAGGATGG - Intronic
1148891883 17:50813560-50813582 AGGTAGTAGAAGAATTAGGAAGG + Intergenic
1151095307 17:71490736-71490758 ATGTAGAGGGAAATCCAGGAGGG - Intergenic
1151122015 17:71803088-71803110 ATGTAGAGGGAGTAATATGGTGG + Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151216216 17:72578414-72578436 ATGCATTGGGAGAATAAGGAAGG + Intergenic
1151385871 17:73754962-73754984 AGGCAGAGGGAGATTTGGGAGGG + Intergenic
1151500828 17:74487598-74487620 GTGTAGAGGGATAACTAGTAAGG - Intergenic
1151823330 17:76509100-76509122 TGGGAGAGGGAGGATTAGGAAGG + Intergenic
1151825058 17:76519402-76519424 CGGGAGAGGGAGGATTAGGAAGG - Intergenic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1156445672 18:37235172-37235194 AAGGACAGGGAGAATTTGGATGG + Intergenic
1157425914 18:47584127-47584149 ATGTACAGGTAGAGTCAGGAAGG + Intergenic
1158293967 18:55973226-55973248 AAGTAGGGGGTGAAATAGGAAGG - Intergenic
1158338913 18:56444516-56444538 ATGTGGCTGGAAAATTAGGAAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165676211 19:37726228-37726250 CTGTAGAGAGAAAAATAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
926627690 2:15106769-15106791 AGGTAGAGGGAGCATTAGGAGGG + Intergenic
926630722 2:15133883-15133905 ATGTAGAGGATGAATTGGAAGGG + Intergenic
926951122 2:18244762-18244784 ATGTAGAGGGAGAACAGGCAAGG + Intronic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930460631 2:51670018-51670040 ACGTAGATGGAAAATTAGAAAGG - Intergenic
930968538 2:57364300-57364322 ATATGGAGAGAGAATTGGGAGGG - Intergenic
931066243 2:58590783-58590805 ATGTGGCAAGAGAATTAGGAAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932515230 2:72340198-72340220 TGGTAGAGTGAGAGTTAGGAGGG + Intronic
932770510 2:74498417-74498439 AAGTAGAGGGAGAGCCAGGAAGG + Intronic
932804640 2:74772835-74772857 ATATTTAGGGAGAATAAGGAGGG - Intergenic
935456120 2:103269316-103269338 ATTTAGAGGAAGAATTGGAAGGG + Intergenic
936912135 2:117604044-117604066 GTGGAGGGGGAGAATTAGGCGGG + Intergenic
937249627 2:120515270-120515292 AGGTGGAGGGAGAATCAGGGAGG - Intergenic
937249701 2:120515594-120515616 AGGTGGAGGGAGAATCAGGGAGG - Intergenic
940985883 2:160051830-160051852 ATGCAGAGAGAGAGGTAGGAAGG - Intronic
942663415 2:178290141-178290163 ATGTAGAAGGAATAATAGGATGG - Intronic
943306502 2:186269140-186269162 ATGAAGAGAGAGAAGTAGAAAGG + Intergenic
944256267 2:197626263-197626285 ATGTAAAAGGAGAATAAGCATGG + Intronic
947292382 2:228590614-228590636 AAGAAGAGAGAGAATTAGGAAGG + Intergenic
1168782289 20:503389-503411 ATGTAGAAAGAGAACTAGGTTGG - Intronic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1174587898 20:51623055-51623077 AAGTAAAGGGAGAGGTAGGATGG + Intronic
1178715892 21:34963964-34963986 ATGTAGATGGAAGATTGGGATGG + Intronic
1178894940 21:36550437-36550459 ATGTGGAGGGAGAATTGGAGGGG + Intronic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182794188 22:32978379-32978401 ATTGAGAGAGAGAATTAGGGAGG + Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1184272643 22:43393403-43393425 CTGAAGAGGGAGAATTGGGGTGG + Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1203278582 22_KI270734v1_random:110038-110060 ATATGGAGGGAGAACTTGGATGG + Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949626760 3:5875815-5875837 AGCTAGAGGGAGAATTGGTAAGG + Intergenic
950975585 3:17239459-17239481 AAGTAGAGGAAGAAATGGGATGG - Intronic
950983359 3:17332663-17332685 AAGTAGGGGGAAAATTAGAAGGG + Intronic
951432978 3:22629503-22629525 ATCTAGAGGGAAAACTAGAAGGG + Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
951811474 3:26705425-26705447 TTGCAGAGGGGGAGTTAGGAGGG + Intronic
953137305 3:40192259-40192281 AATCAGAGGGAGAATTAGAAAGG - Intronic
955252249 3:57295473-57295495 AAGTTTAGGGAGAATAAGGATGG - Intronic
955695211 3:61629053-61629075 AAGTTTAGGGAGAAGTAGGAGGG + Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958446453 3:94221527-94221549 GGGTGGAGGGAGAAATAGGAGGG + Intergenic
958745601 3:98129857-98129879 ATGCAAAGAGAGAATCAGGAAGG - Intergenic
958871969 3:99570318-99570340 TTGTAGAGGGTGGATGAGGAAGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
960141562 3:114156224-114156246 ATGTAGTTGGAGATTTAGGGAGG - Intronic
960480919 3:118189181-118189203 ATGAAGAGGGAGTAATATGAAGG + Intergenic
960665673 3:120106609-120106631 ATATAGAGTCAGAATTATGAAGG + Intergenic
961131126 3:124468089-124468111 CTGTTGAGGGAGAATGAGCAAGG + Intronic
962013395 3:131415932-131415954 ATGTAGAGAGAGAACTCTGAGGG - Intergenic
962079271 3:132119857-132119879 ATGTAGAGGGAAACCTAGGAAGG - Intronic
962778498 3:138687799-138687821 ATGTTGGGGGAGATGTAGGAAGG + Intronic
964151365 3:153528548-153528570 TTTTTAAGGGAGAATTAGGAAGG - Intergenic
964731574 3:159872376-159872398 ATGGAAAGGGGCAATTAGGATGG - Intronic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
966953661 3:184849713-184849735 ATCTAAAGGGAGAAGTAGGATGG + Intronic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
967807718 3:193730181-193730203 AAGTGGAGGGAGAAATGGGAAGG + Intergenic
968341262 3:197957877-197957899 GTGTAGAGGAAGAAATAGGGCGG + Intronic
968664324 4:1812667-1812689 ATGACGAGGGAGAATGACGAGGG + Exonic
968751473 4:2391624-2391646 ATGGGGAGGGAGAGTTAGGTGGG - Intronic
969261460 4:6036790-6036812 ATGTGGGTGGAGATTTAGGAAGG - Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970258775 4:14200487-14200509 TTGTAAAGCGAGAATTAGCATGG + Intergenic
971415624 4:26425694-26425716 AAGGAGAGGGAAAATTGGGAGGG - Intronic
971466381 4:26967419-26967441 ACATGGAGGGAGAATCAGGAAGG + Intronic
971978412 4:33721312-33721334 TAGCAGAGGGAGAATAAGGATGG + Intergenic
972190823 4:36588512-36588534 GTGTAGGGAGAGCATTAGGAAGG - Intergenic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
973936483 4:55851742-55851764 ATGGTGAGGGAAAATTAGAATGG + Intergenic
974725328 4:65791717-65791739 ATGTAGATAGAGAATTGTGATGG + Intergenic
975503069 4:75108902-75108924 ATGTAGAGGGCTCATTGGGAAGG + Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
977684390 4:99831518-99831540 ATGTCGATGGACATTTAGGATGG + Intronic
978234642 4:106443740-106443762 ATGTATAGGAAGAATTAGGCTGG - Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979153789 4:117356236-117356258 ATGTAAAGAGAGAAATAGAAAGG - Intergenic
979157867 4:117420644-117420666 ATTTTGAGGGAAAATTAGAATGG - Intergenic
979654729 4:123179207-123179229 ATCTAGAAGGAGGAGTAGGATGG + Intronic
980999246 4:139812414-139812436 GTGGAGAGGGAAAAGTAGGATGG - Intronic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
982995972 4:162346109-162346131 ATGTTGATGGAGAATAAGGAAGG + Intergenic
984312542 4:178081269-178081291 ATGTACAGGGACAATTAGTGGGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
989155317 5:38339371-38339393 GAGTAGTGGCAGAATTAGGAAGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990317835 5:54600841-54600863 AGGGAGAGAGAGTATTAGGAAGG + Intergenic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
992875388 5:81049480-81049502 GAGTAAAGGGAGAATCAGGAGGG - Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
994904301 5:105816963-105816985 ATATAAAGGGAGAACTAGGTTGG + Intergenic
997817849 5:137035475-137035497 TGGAAGAGGGTGAATTAGGAAGG + Intronic
998073345 5:139216451-139216473 ATGTGGAGGGAGCATTGGAAGGG + Intronic
998512606 5:142725771-142725793 ATGTAGAGTGTGAAGAAGGAGGG + Intergenic
998845113 5:146301051-146301073 ATGTATGGGGAGAAATAGCAAGG - Intronic
999051333 5:148526881-148526903 ATGTAGGGGGAGTATGAAGAGGG + Intronic
999357296 5:150947214-150947236 ATGTAGAGGGAGACTGCGTAAGG + Intergenic
1000145566 5:158450007-158450029 TTGTTGAGGGAGAGTTTGGAAGG - Intergenic
1001757617 5:174182657-174182679 ATGGCTAGGGAGAAATAGGACGG - Intronic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1002465965 5:179408796-179408818 ATCTTGAGGGAGAAATCGGAAGG + Intergenic
1003528474 6:6917993-6918015 AAGCAGAGGGAGAATTTGGAAGG + Intergenic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1005178871 6:23080477-23080499 ATTCAGAGGGTGAATTAGGTTGG - Intergenic
1005499948 6:26421099-26421121 ATGTAGAGGGAGATTTTGCTGGG - Intergenic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1006330383 6:33386159-33386181 AGGTAGAGATAGAAATAGGAGGG - Intergenic
1007110428 6:39310478-39310500 AAGTGGAGGGAAAGTTAGGAAGG - Intronic
1007616335 6:43181899-43181921 TGGGAGAGGGAGGATTAGGAGGG + Intergenic
1010039512 6:71364639-71364661 ATTTAGAGGGAGGATTTGGGTGG - Intergenic
1011160832 6:84388640-84388662 TTGGAGAGGATGAATTAGGAGGG + Intergenic
1011163426 6:84418876-84418898 AGATAGAGGGAGATTTGGGATGG - Intergenic
1011254390 6:85405892-85405914 GAGTAGGGGGAGAATGAGGATGG - Intergenic
1011490220 6:87883864-87883886 ATTAAGAGTGAGAATTAAGAGGG - Intergenic
1012684322 6:102225407-102225429 ATGTAGATGGAGATCTAGGAGGG + Intergenic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1013347975 6:109280751-109280773 ATGTAGAGAGAAAATTCGGAGGG + Intergenic
1014148711 6:118028486-118028508 ATATACAGGGCAAATTAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1017625609 6:156345391-156345413 AAGGAGAGGGAGAGATAGGAAGG - Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1021379121 7:19945500-19945522 ATTTAGAGGGGGAAATAGGCAGG - Intergenic
1025840067 7:65138199-65138221 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1025882996 7:65557765-65557787 TTGCAGAGAGAGAAATAGGAAGG - Intergenic
1025890448 7:65644840-65644862 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1028531041 7:91839140-91839162 AGGTAGGGGGAAAATTAGGAGGG - Intronic
1028849568 7:95522498-95522520 ATGTAGAGGCAAATTTATGATGG - Intronic
1028908688 7:96183427-96183449 ATCTAGAGAGAGCATTAGTAGGG + Intronic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1030090312 7:105852345-105852367 TTGTATAGGGAGGGTTAGGAAGG - Intronic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1032252053 7:130266349-130266371 ATGTAGAGTGAGGATTGGAATGG + Intergenic
1033039127 7:137902334-137902356 GTATAGAGGGAGAAGTATGATGG - Intronic
1033516580 7:142112554-142112576 AGGTAGAGAAAGAAGTAGGAAGG - Intronic
1033911572 7:146269375-146269397 GTGTAATGGGAGAGTTAGGAAGG + Intronic
1035060639 7:156066797-156066819 CTGCGGAGGGAGAATCAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035920213 8:3668296-3668318 ATGAAGTGAGAGGATTAGGAAGG + Intronic
1036115963 8:5961186-5961208 ATCTTGAGGGAGAATTGGGATGG - Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036920382 8:12847981-12848003 ATGTTGAGTGAGAATTAGGATGG + Intergenic
1037222959 8:16547799-16547821 AGGCAGAGGGAGAAATATGAAGG + Intronic
1037555726 8:20020365-20020387 ACGTGGAGGGAGAACTAGGCAGG - Intergenic
1037677018 8:21059649-21059671 ATCAAGAGGGAGAAGTTGGAAGG - Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039928760 8:41963012-41963034 AGGAAGAGGGAGAATTCAGAGGG - Intronic
1040671045 8:49691203-49691225 ATGTATAGGGAGGATTAGGTGGG + Intergenic
1041309229 8:56497352-56497374 ATTTTGAGTGAGAAGTAGGAAGG - Intergenic
1041819628 8:62016117-62016139 CTGTAGAGTGAGTATTAGGCTGG + Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043415732 8:80046916-80046938 GGGTAGAGGGAGGATAAGGAAGG + Intronic
1043571148 8:81603659-81603681 ATGCAGGGGGAGAATTCAGATGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046812316 8:118546275-118546297 ATGAAGAGGTGGAATTGGGAGGG + Intronic
1047416207 8:124666710-124666732 GGGTGGAGGGAGAATGAGGAGGG + Intronic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048261067 8:132945431-132945453 TGGGAGAGGGAGATTTAGGAAGG + Intronic
1049182779 8:141231469-141231491 ATGAAGAGGGCACATTAGGAGGG + Intronic
1050122421 9:2321149-2321171 GAGTAGAGGGAGAATGAGAAGGG + Intergenic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050646938 9:7730279-7730301 ATGTAGAGTGATTATTAGGATGG + Intergenic
1050656529 9:7834507-7834529 AAGAAAAGGGAGAATTGGGAGGG - Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1053438408 9:38093663-38093685 ATGTATAGGGAGAGAAAGGAAGG + Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1057834151 9:98430658-98430680 ATGGAGAGGGAGAACTATGCAGG - Intronic
1058300717 9:103369407-103369429 ATGTAGAGAGAGAACTACAAAGG + Intergenic
1058532189 9:105916924-105916946 ATGTAGAGAATGAATTTGGAGGG - Intergenic
1058562601 9:106245796-106245818 AGGTTGAGGTAGAATTAAGATGG - Intergenic
1058816161 9:108684588-108684610 ATGTAAACTGAGAATTAGGCAGG + Intergenic
1060396134 9:123318294-123318316 AGGCAGAGGGAGATTTAGGGAGG - Intergenic
1060695943 9:125708955-125708977 ATGGAGAGTAAGATTTAGGAAGG - Intergenic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1186352461 X:8754259-8754281 ATGTAGATGGAGAAATCAGAGGG - Intergenic
1186581497 X:10824706-10824728 ATGTAGAGGAAAAATTACGAAGG + Intronic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1186977946 X:14928359-14928381 ATGAAGAGGGAGAATTGGCAAGG - Intergenic
1187770921 X:22695088-22695110 ATGGATTGGAAGAATTAGGATGG + Intergenic
1187850086 X:23583117-23583139 AGGAAGAGGGAGATTTTGGAGGG + Intergenic
1191963824 X:66734085-66734107 ATTTGGAGGGACAAGTAGGAGGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1195891924 X:109704759-109704781 GGGTAGAGGGAGAAACAGGATGG + Intronic
1196250789 X:113457942-113457964 ATGTAAAGGGGGAATGATGAAGG + Intergenic
1197054862 X:122105436-122105458 TTGTAGACAGAAAATTAGGAAGG + Intergenic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1198064399 X:133082087-133082109 AAGCAGAGAGAGAAGTAGGAAGG + Intronic
1198580697 X:138061104-138061126 GTCTAGTGGGAGAATTAGGAGGG + Intergenic
1199329448 X:146542284-146542306 ATATTGAGGGACTATTAGGAAGG - Intergenic
1199828261 X:151522346-151522368 ATGTAGAGAGAGAATATGTAAGG - Intergenic
1200576670 Y:4896447-4896469 GTGTAGAGTGAGAAGAAGGAGGG - Intergenic
1200873359 Y:8126370-8126392 AGGCAGAGGGAGGAGTAGGAAGG + Intergenic