ID: 959374267

View in Genome Browser
Species Human (GRCh38)
Location 3:105568689-105568711
Sequence GGTCTAAGTAGACCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959374267_959374272 9 Left 959374267 3:105568689-105568711 CCAGCTTTTGGTCTACTTAGACC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 959374272 3:105568721-105568743 AAGCTGAGAAGTGCCCTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959374267 Original CRISPR GGTCTAAGTAGACCAAAAGC TGG (reversed) Intronic
905000647 1:34665962-34665984 AGTCTAAGTGGACCAACAGATGG + Intergenic
906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG + Exonic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG + Intergenic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG + Intergenic
916963776 1:169914656-169914678 GCTCTCAGAAGACAAAAAGCGGG - Intergenic
917871382 1:179245146-179245168 GGCCTAAGTAGCCTTAAAGCGGG + Intergenic
918733880 1:188033817-188033839 GCTCTGAATAGACCAAAAACAGG - Intergenic
919749606 1:201028949-201028971 GCTCTAAGTAGCCCAAAAAGGGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1069289192 10:66756151-66756173 GATCTGACTAGACCAATAGCTGG + Intronic
1075203428 10:120425749-120425771 GGGCTAAGTCAACCAAAGGCAGG - Intergenic
1075314162 10:121438748-121438770 GGCCTTAGGGGACCAAAAGCTGG - Intergenic
1079624007 11:22593550-22593572 GGGCTGAGTAGGCCAAAAACAGG + Intergenic
1079790235 11:24728409-24728431 GGCCTAACTAGAGCAGAAGCAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG + Intergenic
1100548796 12:95627735-95627757 GGTCTAAGGGGCCCAAAGGCAGG - Intergenic
1101338540 12:103819662-103819684 GGGATAAGCAGACGAAAAGCTGG - Intronic
1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG + Intergenic
1109980917 13:69905393-69905415 AGTCTAAATTGACCAAATGCTGG + Intronic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1116978126 14:51138545-51138567 GGCCTGAGTAGAACAAAAGGTGG - Intergenic
1117386365 14:55217761-55217783 GTTCTAAGTAGAGAAAAAACAGG + Intergenic
1117614170 14:57516238-57516260 AGTCTGAATAGACCAATAGCAGG - Intergenic
1127333911 15:57965189-57965211 GGTATGAGTAGTCCTAAAGCTGG - Intronic
1128762372 15:70226109-70226131 GGTCTAGGTAGACAAGAAGGAGG + Intergenic
1131605651 15:93900456-93900478 GCTCTCAGTAGACCTGAAGCAGG + Intergenic
1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG + Intergenic
1133931691 16:10238061-10238083 GGTTAAAGTAGACGAATAGCAGG - Intergenic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1155983138 18:32201829-32201851 GGTCTAAGAAGATCAAGAACAGG - Intronic
1158410425 18:57200346-57200368 GGTCCCAGTAGACCAAAGGAAGG - Intergenic
1159306618 18:66651747-66651769 AGTTTAAATAGACAAAAAGCTGG - Intergenic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1162880118 19:13652527-13652549 GGCCTGAGTAGAACAAAAGATGG - Intergenic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG + Intergenic
928460956 2:31472127-31472149 GGCCTGAGTAGAGCAAAAGGTGG - Intergenic
928823759 2:35393417-35393439 TGTCTAGGTAGACCCTAAGCAGG - Intergenic
929847082 2:45541552-45541574 GCTCTCAGAAGACCCAAAGCGGG + Intronic
930352315 2:50272593-50272615 AGTAAAAGTAGACTAAAAGCAGG + Intronic
931145768 2:59515862-59515884 GGTCTGAGCAGACAAAATGCTGG + Intergenic
931975632 2:67640982-67641004 GGTCTGAAGAGACCCAAAGCTGG - Intergenic
934541135 2:95176042-95176064 GGTCTAAGTAAAGCAAAGCCAGG - Intronic
939589321 2:144044001-144044023 GATCTAAGTAGCCAAAAAGGAGG - Intronic
944334847 2:198520366-198520388 GGACTATGGACACCAAAAGCAGG - Intronic
945632766 2:212303101-212303123 GGGGTAAGTGGACCAAAAGGAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1176339007 21:5626201-5626223 TCTCTGAGTAGACCAATAGCAGG + Intergenic
1176340415 21:5689274-5689296 TCTCTGAGTAGACCAATAGCAGG + Intergenic
1176472669 21:7121427-7121449 TCTCTGAGTAGACCAATAGCAGG + Intergenic
1176504412 21:7635182-7635204 TCTCTGAGTAGACCAATAGCAGG - Intergenic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1203239677 22_KI270733v1_random:3732-3754 TCTCTGAGTAGACCAATAGCAGG + Intergenic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
954001188 3:47558410-47558432 GGTCCAAGTGGCCCAAACGCTGG - Intergenic
955636488 3:61035813-61035835 GGACTAACTAGAGTAAAAGCAGG - Intronic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
962983762 3:140515308-140515330 AGACTAATTAAACCAAAAGCTGG - Intronic
964949592 3:162273503-162273525 AGTCTAAGTGGACAATAAGCAGG + Intergenic
965464155 3:169006189-169006211 GGTCTGAATAGACCAATAACAGG - Intergenic
967366774 3:188695783-188695805 GTGCTAATTAGACCAGAAGCTGG - Intronic
975559538 4:75696123-75696145 GACCAAAATAGACCAAAAGCAGG + Intronic
979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG + Intronic
980389763 4:132128036-132128058 TGACTAAGTTGACCAAAAGAAGG - Intergenic
984188773 4:176579367-176579389 GGTGTAAACAGACCAACAGCAGG - Intergenic
985323476 4:188740549-188740571 AGTCTAACAAGTCCAAAAGCTGG + Intergenic
986516584 5:8571004-8571026 GGTCTAAGTGGCTCAAAATCTGG + Intergenic
986866156 5:11990202-11990224 GGCCTGACTAGACCATAAGCTGG + Intergenic
990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG + Intronic
997817051 5:137029015-137029037 GGACTCAGTTGACCATAAGCAGG - Intronic
1001170241 5:169412600-169412622 TTTCTAAGTAGACCCAAAGCTGG + Intergenic
1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG + Intergenic
1005121530 6:22394903-22394925 GTTCTAAATAAACCAACAGCTGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1017312379 6:152988818-152988840 AGTCTAACAAGTCCAAAAGCTGG - Exonic
1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG + Intergenic
1020664566 7:11023968-11023990 AGCCTAGGTAGGCCAAAAGCTGG + Intronic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024389721 7:48794344-48794366 GGACTAGGAAGGCCAAAAGCAGG + Intergenic
1026653018 7:72232080-72232102 GGTCAAAGAAGACAAAAGGCTGG + Intronic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030766243 7:113413337-113413359 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1032944888 7:136838198-136838220 GGTCTAAATTCACCAAAGGCTGG + Intergenic
1041295570 8:56353869-56353891 TCTCTGAATAGACCAAAAGCAGG - Intergenic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG + Intergenic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1057253959 9:93527925-93527947 GGTAGAAGTAGAAGAAAAGCAGG - Intronic
1057966634 9:99510438-99510460 GCTCCAAGTAGAACAAAAGCTGG + Intergenic
1058194536 9:101956540-101956562 GATCTAAGGTGACCAAAGGCAGG - Intergenic
1059180442 9:112207371-112207393 GCACTAAGTAGACCACAAGAAGG - Intergenic
1061280106 9:129593081-129593103 GGGTTAAGGAGACCCAAAGCAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1203422652 Un_GL000195v1:8719-8741 TCTCTGAGTAGACCAATAGCAGG - Intergenic
1193582538 X:83283588-83283610 TCTCTGAGTAGACCAATAGCAGG - Intergenic
1194050315 X:89059975-89059997 GGTCTAAGTATAACAGATGCAGG + Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1195790215 X:108576326-108576348 TGTTTAAGAAGAGCAAAAGCAGG + Intronic
1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG + Intronic
1199493215 X:148424113-148424135 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1200871083 Y:8099141-8099163 TCTCTCAGTAGACCAATAGCAGG - Intergenic