ID: 959374272

View in Genome Browser
Species Human (GRCh38)
Location 3:105568721-105568743
Sequence AAGCTGAGAAGTGCCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959374267_959374272 9 Left 959374267 3:105568689-105568711 CCAGCTTTTGGTCTACTTAGACC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 959374272 3:105568721-105568743 AAGCTGAGAAGTGCCCTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 219
959374266_959374272 18 Left 959374266 3:105568680-105568702 CCTTGATTTCCAGCTTTTGGTCT 0: 1
1: 1
2: 3
3: 70
4: 477
Right 959374272 3:105568721-105568743 AAGCTGAGAAGTGCCCTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959374272 Original CRISPR AAGCTGAGAAGTGCCCTCAG AGG Intronic
902777576 1:18684531-18684553 CAGCTGAGCAGTTCCCTCGGAGG + Intronic
903130748 1:21278115-21278137 ATGCTGAGCAGAGCCCCCAGAGG + Intronic
904500764 1:30911599-30911621 AAGATGAGAAGGACCTTCAGGGG - Intergenic
905411186 1:37769507-37769529 CAGCTGACAAGTGGCATCAGAGG + Intergenic
905490292 1:38338052-38338074 AATCTGAGAAGGGCTTTCAGAGG + Intergenic
906817628 1:48895339-48895361 ATGGTGAGAAGTGACCCCAGAGG - Intronic
906876956 1:49549854-49549876 AAGCTGTGTAGTGCTGTCAGTGG + Intronic
906951044 1:50334683-50334705 AAGCTGAGAAAGGCACTCAGAGG + Intergenic
907426703 1:54384228-54384250 CAGATGTGAAGTGTCCTCAGAGG - Intronic
908723368 1:67149193-67149215 ATGCTGAGAAGAGCTCCCAGGGG - Intronic
908823444 1:68111993-68112015 AAGCTAAGCAGTGCCCTCCTTGG + Intronic
909180196 1:72414285-72414307 ATTCTGAGAAGTGGCTTCAGGGG + Intergenic
910099617 1:83562111-83562133 AATCTGAGCAGAGCTCTCAGAGG - Intergenic
910294566 1:85631330-85631352 AAGGTGAGGAGTGGCTTCAGTGG + Intergenic
913409299 1:118533350-118533372 AAGCTGAGAAGAACCCTGACAGG - Intergenic
913476176 1:119240512-119240534 ATGCTGGGAAAGGCCCTCAGTGG + Intergenic
916842579 1:168615129-168615151 AAGCTCAGATGTTCCCTCAGGGG + Intergenic
917751711 1:178059290-178059312 AAGCTGACAAGTGCTTTCGGGGG + Intergenic
921270385 1:213463603-213463625 AAGCTGAGCAGAGAGCTCAGAGG - Intergenic
921986671 1:221319725-221319747 AGGCTGAGAAGTGCCATGACAGG - Intergenic
922475989 1:225907335-225907357 AAGATGAGGAGTGCTCACAGTGG + Intronic
922528490 1:226325061-226325083 AAGCTGAGAAGTCCCATGACAGG + Intergenic
922712236 1:227842875-227842897 ATGGTAAGAAGTTCCCTCAGAGG - Intronic
923849673 1:237780174-237780196 AAGTTGAGAAGAGGGCTCAGAGG + Intronic
1063054881 10:2494230-2494252 AAGCTTGGAAATGCCCACAGAGG + Intergenic
1063067998 10:2628850-2628872 AAGCAAAGAAGTGATCTCAGAGG + Intergenic
1067837864 10:49652728-49652750 AGGCTTAGAAGTGCCCCCTGTGG + Intronic
1068070610 10:52189861-52189883 AAGCTGACAACAGCCCTCAATGG - Intronic
1068909247 10:62360499-62360521 AAGCTGAGAAGTTCCATGACAGG - Intergenic
1069906389 10:71734929-71734951 GAGCTGGGATGAGCCCTCAGTGG - Intronic
1071359244 10:84829180-84829202 GAGCTGTGAAGTTCCATCAGCGG + Intergenic
1073455917 10:103636709-103636731 AGGCTGAGCTGTGACCTCAGAGG - Intronic
1073586105 10:104711696-104711718 AAGGTGAGAACTGGCCTCTGGGG + Intronic
1075990489 10:126834240-126834262 ATAATGAGAAGTGCTCTCAGTGG - Intergenic
1076565397 10:131395073-131395095 GAGCTGGGAAGTGTCCACAGTGG - Intergenic
1077971365 11:7194645-7194667 AAGCTGAGACTTGCTCTCATGGG + Intergenic
1079176925 11:18150862-18150884 AAACTGTTAAGTGCCCTGAGTGG + Intronic
1083272737 11:61580453-61580475 GAGCCGGGCAGTGCCCTCAGAGG - Intronic
1084467533 11:69334851-69334873 AAGCTGGAAAGGGCCCCCAGTGG - Intronic
1087116256 11:94528243-94528265 AAACTGTAAAGTCCCCTCAGGGG - Intergenic
1087181265 11:95144762-95144784 AAGATGAGGAGTCCCCCCAGTGG + Intergenic
1088879900 11:113964975-113964997 AAGGTGAGGTGTCCCCTCAGAGG + Intergenic
1088915498 11:114224823-114224845 GTGCTGAGAAGTCCCCTAAGAGG + Intronic
1089463021 11:118663809-118663831 AACCTGGGAGGTGCACTCAGTGG + Intronic
1089792371 11:120954142-120954164 AGTCTGGGAAGTGCCCTCAGGGG - Intronic
1091265768 11:134270023-134270045 AAGCGGAGAAGGACCCTCAGGGG + Intergenic
1094617610 12:32049842-32049864 AGGCTGAGAAGTTCCATCACAGG - Intergenic
1094649907 12:32365532-32365554 AAGCAGAGTAGTGGCCTCTGTGG - Intronic
1096239510 12:49952107-49952129 AAGCAGAGAAGTTCCCTAATTGG - Intronic
1096453639 12:51767341-51767363 AACCTGAAAAGTGTCATCAGGGG - Intronic
1102512510 12:113425302-113425324 AAGCTGAGAGGTGCCCTGGGTGG + Intronic
1106111782 13:26783776-26783798 GAGCTGAGAGGTGACCTCGGTGG + Intergenic
1107552329 13:41488313-41488335 AAGCTGACACATGCCCACAGAGG - Intergenic
1108283561 13:48883315-48883337 ATGTTGAGAAGTAGCCTCAGAGG - Intergenic
1111818719 13:93187753-93187775 AAGCTGAGAATTGCTCTTACAGG + Intergenic
1112355712 13:98673383-98673405 AAACAGAGCAGTGACCTCAGTGG - Intergenic
1113231305 13:108216418-108216440 GAGCTGTTAAGTGCCCTTAGAGG + Intronic
1114813666 14:25929858-25929880 AAGCTGTGCATTTCCCTCAGGGG + Intergenic
1117645872 14:57852200-57852222 AAGCTGGAAAGGGCTCTCAGAGG + Intronic
1118135267 14:63018212-63018234 AAACTGGCAAGTGCTCTCAGCGG - Intronic
1120364096 14:83542948-83542970 AATCTGAGAAGGGCCCACAGAGG + Intergenic
1121634467 14:95444524-95444546 AAGCCGAGAAGGGGCTTCAGCGG - Exonic
1121642284 14:95493735-95493757 AAGCTGAGTGATGCCCTCAGGGG + Intergenic
1122860777 14:104581459-104581481 ACACTGAGCAGTGGCCTCAGCGG - Intronic
1125428053 15:39569423-39569445 AAACTGAGTAGTGTCCTCATAGG + Intergenic
1125589662 15:40846339-40846361 AAGCTGTAAAGTGCTCACAGAGG - Intronic
1125608970 15:40958195-40958217 AACCTGAGAAGGGGCCTCTGAGG + Intergenic
1126182255 15:45796958-45796980 AAGCATAGCTGTGCCCTCAGTGG - Intergenic
1128185474 15:65640449-65640471 TAGCTGAGAAGTGCCCTTTAGGG - Intronic
1129865848 15:78907981-78908003 ATGCTCAGAAGTGGCCTCAGAGG + Intergenic
1129946149 15:79540846-79540868 AAGCTGGGCAGTGCCCTTATCGG - Intergenic
1131334313 15:91532963-91532985 AAGCTAAGAAGTGCTCTCTGGGG - Intergenic
1131335797 15:91547379-91547401 AAGCAGAGAACAGCCCTCACTGG + Intergenic
1132262512 15:100438956-100438978 AACATGAGAAGTGCCTTGAGAGG - Intronic
1132325040 15:100961782-100961804 AAGGTGACCAGTGCCCTGAGTGG - Intronic
1136693926 16:32059063-32059085 ATGGTGAGATGTGCTCTCAGGGG - Intergenic
1137332628 16:47514271-47514293 AGGCTGAGAAGTCCCATGAGAGG + Intronic
1137614417 16:49838442-49838464 TACCTGGGAAGTGCGCTCAGCGG + Intronic
1139455146 16:67068500-67068522 AAACTGAGCAGTGACATCAGAGG + Intronic
1139836616 16:69843969-69843991 AAGCTGACAGCTGTCCTCAGAGG - Intronic
1141457689 16:84154850-84154872 AAGCTTAGAACATCCCTCAGGGG - Intronic
1203096682 16_KI270728v1_random:1263979-1264001 ATGGTGAGATGTGCTCTCAGGGG - Intergenic
1144851207 17:18244964-18244986 ACCCTGACAGGTGCCCTCAGGGG - Exonic
1145935988 17:28715163-28715185 AAGCTGGGAAGTCCCCCCACTGG + Intronic
1145992298 17:29086418-29086440 CAGGTGAGAAGTGGCCTCTGGGG - Exonic
1146059110 17:29595301-29595323 AAGCAGAGAAGAGCCAGCAGAGG - Intronic
1146534201 17:33635736-33635758 AAGCTGAGAACTGACAACAGAGG + Intronic
1151746469 17:76014350-76014372 AAGCTCAGAAGCGCTCTAAGGGG - Intronic
1153814716 18:8782601-8782623 AACCTAAGAAGTGTCCTCATAGG - Intronic
1155146927 18:23092159-23092181 AAGCTGAGAAGTCCCATGACAGG + Intergenic
1156442712 18:37207675-37207697 AAGATGTGAAGTGGCCTCACAGG - Intronic
1158621789 18:59039457-59039479 AAGCTGAGAAGAACCCACAAAGG + Intergenic
1158821272 18:61162018-61162040 AAGCTGAGAAGTCCCATGATCGG + Intergenic
1159006473 18:63017372-63017394 AAGCTGTGAAGGGCCAGCAGAGG - Intergenic
1160338396 18:78064012-78064034 AAGCTGGGAAGTGCCTTCATGGG - Intergenic
1161420983 19:4175772-4175794 AAGCTGAGGAGAGTCCTCAGGGG + Intronic
1161536697 19:4823734-4823756 AAGCTAAGGAGAGTCCTCAGAGG + Intronic
1162177116 19:8839098-8839120 AAATTGAGATGTGCCATCAGTGG - Intronic
1163059199 19:14746136-14746158 ACCCTGAGAAGGGACCTCAGTGG + Intronic
1163647142 19:18495862-18495884 AAGATCAGAAGAGGCCTCAGTGG - Intronic
1165363507 19:35350791-35350813 AGGCTCAGCAGTCCCCTCAGCGG - Intergenic
1165365649 19:35363248-35363270 AGGCTCAGCAGTCCCCTCAGCGG - Intergenic
925180340 2:1813364-1813386 CAGCTGAGAAATGGCCCCAGGGG + Intronic
925426220 2:3750929-3750951 AAACTGAGGAATGCCCTTAGAGG - Intronic
926682647 2:15675535-15675557 AAGCTGAGCAGAGTCCTCACTGG - Intergenic
926775977 2:16423678-16423700 AAGCTGAGAAAAGCCTTCAAGGG + Intergenic
927230198 2:20815430-20815452 AAGCTGAGAAAAACCCTAAGTGG + Intronic
927521406 2:23700874-23700896 GAGCTGAGAGGCGTCCTCAGAGG - Intronic
927751756 2:25675882-25675904 AAACTGAGAAGTGGTCACAGGGG - Intergenic
929097950 2:38281728-38281750 AGTATGAGAAGAGCCCTCAGAGG - Intergenic
930155930 2:48107621-48107643 AAGCTGGGAAGTGCACTTTGAGG + Intergenic
934573415 2:95385609-95385631 AGGGTGAGCAGGGCCCTCAGAGG + Exonic
934735180 2:96686382-96686404 GGGCTGAGAAATGCCCCCAGGGG + Intergenic
935112063 2:100103957-100103979 CTGCTGCGAAGTGCCCTTAGAGG - Intronic
936122909 2:109761194-109761216 CTGCTGCGAAGTGCCCTTAGAGG + Intergenic
936221779 2:110610270-110610292 CTGCTGCGAAGTGCCCTTAGAGG - Intergenic
937955318 2:127418806-127418828 AATCTCAGAAGTGGCCTCAGAGG + Intronic
941227088 2:162864191-162864213 AGAGTGAGAAGTGCCATCAGGGG + Intergenic
941443285 2:165565958-165565980 AAGCACAGAATTTCCCTCAGTGG - Intronic
943552090 2:189353652-189353674 AAGCTGATAAGCACCTTCAGCGG - Intergenic
943808749 2:192157628-192157650 AAGCTTAGAAGTGCCATACGTGG - Intronic
946276307 2:218634324-218634346 AGGCTGAGAAATGCTATCAGTGG + Intronic
947004701 2:225497479-225497501 AAGCTGAGAAGTGTCCTCCCTGG - Intronic
947249595 2:228086897-228086919 CAGCTAAGAAGAGCCCTCAGGGG + Intronic
948548172 2:238747074-238747096 CAGCTGAGAAGTGCTCACTGAGG - Intergenic
1170072755 20:12386110-12386132 ACTCTGAGTAGTGTCCTCAGTGG + Intergenic
1170315870 20:15040549-15040571 AAGGTGAGGAGTGTCTTCAGGGG + Intronic
1174066259 20:47867939-47867961 ACGCTGAGGAGCGGCCTCAGAGG + Intergenic
1175130536 20:56786153-56786175 AAGCCTAGAAGGGCCTTCAGGGG + Intergenic
1175279650 20:57794531-57794553 TGGCTGAGAAGAGGCCTCAGAGG + Intergenic
1175482663 20:59322415-59322437 AAGGTGAGAGGTGCCAACAGAGG + Exonic
1175677935 20:60962653-60962675 ATGCTGAGAACTGGCCTGAGGGG - Intergenic
1177062055 21:16388419-16388441 AGGCTGAGAAGTCCCATCACAGG + Intergenic
1177092883 21:16791891-16791913 AAGCTTAGAAGTGAGTTCAGTGG - Intergenic
1177577821 21:22981963-22981985 TAGCTGACAACTGCCCACAGAGG + Intergenic
1178171304 21:30043100-30043122 ATGCTGAGCAGAGACCTCAGGGG - Intergenic
1178224787 21:30703280-30703302 AAGCTGAGCAGAGCTTTCAGTGG + Intergenic
1178511041 21:33205221-33205243 AAGCTGAGAAGTGGCCAGAGAGG - Intergenic
1178724470 21:35038684-35038706 AAGCTCAGAAGTGGCCTCTCAGG - Intronic
1179800999 21:43811444-43811466 AGGGTCAGAAGTGCCCTCTGGGG - Intergenic
1181052862 22:20245971-20245993 AGGCTGAGGAGAGCCCTCTGGGG - Intronic
1182374140 22:29834009-29834031 ATGCTGAGAAGAGCACTTAGAGG - Intronic
1182502081 22:30755110-30755132 CAGCTGAGAAGTGCCCACAGGGG - Intronic
1183385332 22:37510836-37510858 AGGCTGAGGCGGGCCCTCAGTGG + Intronic
1185241091 22:49748024-49748046 TAGCTAAGAAGTGCCCTCCTGGG - Intergenic
951047609 3:18058277-18058299 AAAATGAGAAGTGCCCACAGAGG + Intronic
951621162 3:24603473-24603495 AAGCTGAGGAATGCCCTGAGGGG - Intergenic
951623884 3:24638961-24638983 GAGCTGCAAGGTGCCCTCAGAGG - Intergenic
951707311 3:25556269-25556291 AAACTGATAAGTTCACTCAGGGG + Intronic
951771047 3:26258189-26258211 AAACTGAGATGTGGCCTCACAGG - Intergenic
954328585 3:49877211-49877233 CAGCTGGGGAGTGGCCTCAGAGG - Intergenic
956168379 3:66413484-66413506 ATGCTGTGAAATGCCCCCAGTGG - Intronic
959374272 3:105568721-105568743 AAGCTGAGAAGTGCCCTCAGAGG + Intronic
959847710 3:111053727-111053749 AAGCTGAGAAGTCCCACCACAGG - Intergenic
960901361 3:122557520-122557542 AAGCTGAGATGAACCCTGAGGGG - Intronic
961022765 3:123523094-123523116 AACCAGGGAAGTGGCCTCAGAGG + Intronic
961449936 3:126998129-126998151 AAGCTCAGAGGTGCCCCCCGTGG + Intronic
962852878 3:139320757-139320779 CAGCTGAGAGGAGCCCACAGAGG - Intronic
963022726 3:140887508-140887530 AAGCTCAGAGGTGATCTCAGGGG - Intergenic
963941718 3:151102329-151102351 AGGCTGAGAAGTGCTAACAGAGG + Intronic
964321019 3:155497415-155497437 AATCTGTGAAGTACCCACAGAGG + Exonic
967040685 3:185689465-185689487 GGCCTGAGAAGTGCCCCCAGGGG + Exonic
967121685 3:186387920-186387942 AAGAGGAGCAGTGCCCTCTGAGG - Intergenic
967137885 3:186528034-186528056 CAGCTTAGATGTCCCCTCAGGGG - Intergenic
967386909 3:188920913-188920935 AACCTGAGAGGTGCTCCCAGGGG - Intergenic
968876291 4:3269513-3269535 AGGCTGAGAGGTGCTCGCAGAGG - Intronic
969723685 4:8907064-8907086 AAGGTGAGAAGAGCCATGAGGGG - Intergenic
970093687 4:12437740-12437762 ATTCTCAGAAGTGTCCTCAGTGG - Intergenic
975494263 4:75020606-75020628 AAGCAGCGGAGTGCCCCCAGGGG - Intronic
976322499 4:83731845-83731867 AAGCTGAGAAGTCCCATGACAGG - Intergenic
978498116 4:109381509-109381531 TTGCTGAGAAGGGCCCTTAGAGG - Intergenic
979627084 4:122857182-122857204 AGGCCAAGAAGTGTCCTCAGTGG + Intronic
979779986 4:124638824-124638846 TAGCTGAGAAGAGGGCTCAGAGG - Intergenic
979808476 4:125004858-125004880 AATCTGAGAAGTGTCCTGAATGG + Intergenic
980877185 4:138673223-138673245 AAGTTGAGAATTCCCCTCGGTGG - Intergenic
981041879 4:140230710-140230732 AGGCTGAGAAATCCCCTGAGCGG + Intergenic
981633432 4:146847933-146847955 TACCTGTGAAGTTCCCTCAGTGG - Intronic
982227889 4:153182430-153182452 GAGCTGAGAAGTGGGGTCAGTGG - Intronic
983292795 4:165827128-165827150 GAACTCAGAAGGGCCCTCAGTGG + Intergenic
984633995 4:182091613-182091635 CAGCTAGGATGTGCCCTCAGAGG - Intergenic
985238527 4:187903093-187903115 AACCTTTGATGTGCCCTCAGTGG - Intergenic
986013360 5:3737160-3737182 CAGCTGAGAAGTGCCCTTCCTGG + Intergenic
986292210 5:6409254-6409276 AAGCTGAGAGCAGCCCTCACTGG + Intergenic
986550916 5:8954225-8954247 AAGCTGAAAGCTGCTCTCAGGGG - Intergenic
988778241 5:34496402-34496424 AGGCTCTGGAGTGCCCTCAGAGG + Intergenic
988855039 5:35220115-35220137 AAGCTGGGAAGAGCTCTCAAAGG + Intronic
990089498 5:52024396-52024418 AGGCTGAGAAGTTCCATCATAGG + Intronic
991656660 5:68910925-68910947 ATGCTGTGAATTGCCCACAGTGG - Intergenic
993548211 5:89239992-89240014 AAACTGAAAAGTGCTGTCAGAGG + Intergenic
994994526 5:107042985-107043007 TGGCTGAGAGTTGCCCTCAGTGG + Intergenic
998515151 5:142746840-142746862 AATCTGTGAGGTTCCCTCAGTGG - Intergenic
1000139082 5:158383837-158383859 GAGCTGAGCCCTGCCCTCAGGGG + Intergenic
1002033716 5:176449030-176449052 AAGATGATAAGTGTCATCAGTGG + Intronic
1002611735 5:180423876-180423898 AAGGAGAGAAGTGACCACAGAGG - Intergenic
1005962819 6:30705625-30705647 AACCTGAGATGTGGGCTCAGAGG + Exonic
1011877354 6:91977438-91977460 AAGCTGGGAAGAGTCCTCACTGG - Intergenic
1012971396 6:105735600-105735622 AAGATGAGAATTGTCTTCAGCGG - Intergenic
1016290817 6:142526572-142526594 AAGCTGGGATGTACCTTCAGAGG + Intergenic
1016515046 6:144884015-144884037 AACCTGACAAGTGCCCTAAGAGG + Intergenic
1018388740 6:163327520-163327542 CTCCTGAGCAGTGCCCTCAGTGG + Intergenic
1020131027 7:5558746-5558768 CAGCTGAGAAGGGCAGTCAGGGG + Intronic
1029661172 7:101963117-101963139 AAGGTGACAAGTGGCATCAGAGG - Intronic
1030362112 7:108605984-108606006 AAGGTGAGAAGTCCCTTCTGTGG + Intergenic
1032174619 7:129612571-129612593 CAGCTGAGATGTGCCCGCGGAGG + Intronic
1032918006 7:136512626-136512648 CAGCAGAGAAGTGACCTCACTGG - Intergenic
1034687349 7:152984537-152984559 AAGCTGAGAGGAGCCCTCCTAGG - Intergenic
1037383647 8:18314569-18314591 AAGTAGAGAAGAGCCATCAGGGG - Intergenic
1038478571 8:27886081-27886103 GAACTGAAAAGTGCCCTCAAGGG + Intronic
1039677513 8:39685516-39685538 AATCTGTGAAATGCCTTCAGGGG + Intronic
1039799816 8:40944522-40944544 AAGCACAGAAGTGCCCATAGAGG + Intergenic
1040871102 8:52100920-52100942 GAGCTAAGAAGTAGCCTCAGCGG - Intergenic
1041512008 8:58662987-58663009 TAGTTGAGAAGTGGGCTCAGAGG - Intergenic
1043752996 8:83964303-83964325 GAGCGGAGAAGTTCCTTCAGAGG - Intergenic
1044717550 8:95114199-95114221 AAAGGGAGAAGGGCCCTCAGTGG + Intronic
1046705382 8:117444064-117444086 AAGCTGAGAATTGCCTTAGGTGG - Intergenic
1047291708 8:123537559-123537581 AAGCTGTGACGTGCCCCCAGAGG + Intronic
1048350773 8:133614256-133614278 AAGCTGAGAAGGCCTTTCAGAGG + Intergenic
1051562163 9:18454076-18454098 AAGCTGAGAAGTTCCATCGCAGG + Intergenic
1052881459 9:33603157-33603179 AGGCAGAGAAGTGTGCTCAGAGG + Intergenic
1055015619 9:71614733-71614755 AAACTGAGAAGTGCACACACTGG + Intergenic
1055798358 9:80001533-80001555 AAACAGAGAAGTGTCATCAGTGG + Intergenic
1056553388 9:87669915-87669937 ATTCTGAGAACTGGCCTCAGAGG + Intronic
1056883764 9:90420383-90420405 CAGCTGAGAAGTGCCCTCTTGGG + Intergenic
1057302625 9:93895623-93895645 CACCTGAGAAGGGCCCTGAGAGG + Intergenic
1058959184 9:109976896-109976918 AAGATGAGCAGTGCCCACTGCGG - Intronic
1059678916 9:116567384-116567406 CAACTGAGAAGAGCACTCAGTGG - Intronic
1061324428 9:129854796-129854818 AAGCTGAGATCTGCACTCTGTGG - Intronic
1061857368 9:133449660-133449682 AAGCTGGGAAGGGCCCGGAGAGG - Intronic
1062359240 9:136179650-136179672 AATCAGAGAAGTGGCCTCGGAGG + Intergenic
1188525724 X:31085810-31085832 AAGCTCAGGAGTGCCCTCATAGG + Intergenic
1188677493 X:32960300-32960322 TAGCTGAGAAGAGGGCTCAGAGG - Intronic
1189112278 X:38304056-38304078 AGGCTGAGAAGTGGGCTCAAAGG + Intronic
1190180353 X:48186481-48186503 ACACTCAGAACTGCCCTCAGTGG + Exonic
1192047184 X:67688101-67688123 AAGCTGAGAAGTGCTGTGACTGG + Intronic
1192451081 X:71245491-71245513 AAGCAGAGAAGTTGGCTCAGTGG + Intronic
1194370647 X:93066835-93066857 ATGCTGAGAAATGCTTTCAGTGG + Intergenic
1194659917 X:96619213-96619235 AAGCTGAGAAGTTCCATGACAGG - Intergenic
1194793668 X:98183049-98183071 AAGTTGAGAAGTGCCACAAGAGG + Intergenic
1196021045 X:110991253-110991275 AAGCTGAGAAAAGCCCTATGAGG - Intronic
1198018937 X:132639609-132639631 AAGCTGAGAAGTTCCATATGTGG - Intronic
1198423311 X:136490053-136490075 AGGGTGAGAAGTGACCTTAGTGG - Intronic
1198642421 X:138770900-138770922 AAGGTGGGAAGTGCCTTCTGTGG + Intronic