ID: 959374485

View in Genome Browser
Species Human (GRCh38)
Location 3:105571693-105571715
Sequence CTGTGAGCCTTGACTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959374485_959374487 0 Left 959374485 3:105571693-105571715 CCATTATCAGTCAAGGCTCACAG 0: 1
1: 0
2: 2
3: 12
4: 127
Right 959374487 3:105571716-105571738 ATATGGAAATTTTTGCCTAGCGG 0: 1
1: 0
2: 2
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959374485 Original CRISPR CTGTGAGCCTTGACTGATAA TGG (reversed) Intronic
900250934 1:1669121-1669143 CAGTCAGCCTTGACAGCTAATGG + Intronic
900270961 1:1788413-1788435 CTGTGAGACTTGGCTGGAAATGG + Intronic
900998276 1:6134464-6134486 CTGTGAGCCCTGCCTGGGAACGG - Intronic
902518576 1:17003004-17003026 TTGTGTCCCGTGACTGATAATGG + Intronic
902573423 1:17361384-17361406 CTGTGTGCCTTCACTGTTCAAGG + Intronic
907360805 1:53913029-53913051 CTGTGAGTGTTGGCTGCTAATGG + Intergenic
908821780 1:68094348-68094370 CTGTGAGCCTAGTCTGATTAAGG + Intergenic
912421417 1:109544568-109544590 CTGTGATCTTTGACTGCTAGGGG + Exonic
912667738 1:111598071-111598093 CTGTGAGCCTTGTCTGAAAAAGG - Intronic
913343142 1:117780218-117780240 CTGTGATCATCGAGTGATAATGG - Intergenic
917766704 1:178227524-178227546 ATGTAAGCCTTTCCTGATAATGG + Intronic
917901000 1:179543261-179543283 CTCTGAGCTGTGACTGAAAAAGG + Intronic
918816329 1:189190294-189190316 CTGTGAGTTCTGACTGAAAACGG - Intergenic
921083528 1:211764885-211764907 CAGTTATCCTTGACTGAGAAGGG - Intronic
921551527 1:216541907-216541929 CTGGGAGCTTTGACTACTAAGGG + Intronic
923257673 1:232235141-232235163 CTGTGAGTGTTGCCTGCTAATGG + Intergenic
1062819768 10:525954-525976 GTGTGAGCCATGACTGGTGAGGG - Intronic
1067785370 10:49241919-49241941 GTGTGAACCCTGACTGAGAAAGG - Intergenic
1068517323 10:58040546-58040568 CTGTGAGCCCTGACTGCCACAGG - Intergenic
1073582937 10:104684158-104684180 ATGTGACCCTGGACTGGTAAAGG + Intronic
1075196567 10:120364580-120364602 TGGAGAGCCTTGACTGATAAAGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1087173632 11:95075903-95075925 CTATGAGCTTTGGGTGATAATGG - Intergenic
1087600559 11:100309811-100309833 CTGTGAGTGTTGACTGCTAATGG + Intronic
1087716689 11:101616726-101616748 CTCTGAGCCTTCACAGAAAAGGG - Intronic
1089626255 11:119752970-119752992 CTGTGAGCTCTGACTGTTGAGGG + Intergenic
1089676250 11:120091982-120092004 CAGAGAGCCTTGACTAATACAGG + Intergenic
1092235930 12:6809551-6809573 ATGTGAGCCTTGGCTGGTGATGG - Intronic
1092672879 12:10883134-10883156 CTATGAGCCTTGAATGATTCAGG - Intronic
1093294195 12:17367598-17367620 CTGTACACCTTGACTGATGATGG - Intergenic
1093734155 12:22600349-22600371 CTGAAAGCCTTGGTTGATAATGG - Intergenic
1097412963 12:59278638-59278660 CTGAGAGTATTGACTGCTAATGG + Intergenic
1098836170 12:75426974-75426996 CTGTGAGCCCTGAATCTTAATGG + Intronic
1100025635 12:90124412-90124434 CCCTGGGCCTTGGCTGATAAAGG + Intergenic
1102226101 12:111229389-111229411 CTGGGAGGTTTGACTGATATTGG - Intronic
1108381468 13:49858901-49858923 CTTGGAGCCTTTACTGATAAAGG - Intergenic
1109258822 13:60118893-60118915 CTGTGTGCTGTGACGGATAAGGG - Intronic
1113075965 13:106468361-106468383 CTGAGAGCCTTGGGTGATGAGGG + Intergenic
1115575501 14:34706772-34706794 TTGTGAGCCTTTAATGATACAGG + Exonic
1118549381 14:66932654-66932676 CCCTGAGCCTAGAGTGATAATGG - Intronic
1119339917 14:73868319-73868341 CTCTGAGCCTGGACAGGTAAAGG - Intronic
1125215501 15:37268920-37268942 CTGTGCCCCTTGGCTGGTAAAGG - Intergenic
1134090294 16:11387996-11388018 CTGTGAGATTTGAATGATCAGGG + Intronic
1138078284 16:54064511-54064533 CTGTGAACTTTGACTCCTAAAGG + Intronic
1138479564 16:57293223-57293245 CTGTGAGTCCTGGCTGATTATGG + Intergenic
1144679106 17:17181070-17181092 CTGTTAGCCTTGACAGACAGAGG - Intronic
1146525311 17:33562591-33562613 GAGTGAGTCTTGCCTGATAAGGG + Intronic
1147964697 17:44188040-44188062 CTGTGAGAATAGTCTGATAATGG + Intronic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1151285778 17:73110008-73110030 CTCAGAGCCTTCACTGAGAAAGG - Intergenic
1156127193 18:33920797-33920819 CTGTCAGCCCAGACTGAAAAGGG + Intronic
1156172017 18:34496637-34496659 CTGTGAGCCCTGACTGCACAGGG + Intronic
1156971034 18:43156259-43156281 CTGTGATCTATGTCTGATAATGG - Intergenic
1157823832 18:50794382-50794404 CTTTGAGCCTTGCCTGACATGGG - Intergenic
1158098203 18:53799041-53799063 GAGTGGGCCTTGACTGAGAAAGG - Intergenic
1163735455 19:18977631-18977653 TTGTGAGCCATTACTGATACAGG + Intergenic
1164658906 19:29945260-29945282 CTGGGAGCCTTGATTGAGAGGGG + Intronic
1166083176 19:40457951-40457973 CTGTGAGCCTTGTGTGAGCAGGG + Intronic
925920628 2:8635365-8635387 CTGTGGGCCTTGACAGAAAAAGG - Intergenic
928856123 2:35804395-35804417 CTGTGAGCCAGAAGTGATAAAGG + Intergenic
930730979 2:54727160-54727182 CAGGGAGCCTTAACTGATGAAGG + Intronic
935516505 2:104047147-104047169 GTGTGTACCTTGACTGATGAGGG + Intergenic
937155084 2:119713354-119713376 CTCTGTGCCTGGCCTGATAATGG + Intergenic
940280535 2:151984438-151984460 CTGTGAGCCTCAACTAATACAGG + Intronic
942077152 2:172366490-172366512 CTGTTAGCCAAGACTGAGAAAGG - Intergenic
943754598 2:191544906-191544928 CTGTGAGTCTTGTCTCCTAAAGG + Intergenic
946076983 2:217082486-217082508 TTCTGACCCTTGACTGAGAAAGG + Intergenic
948029788 2:234807956-234807978 CTCTGAGCCTTCTCTGCTAAGGG - Intergenic
1170309659 20:14978519-14978541 CTGTGACCAATGACTGATAATGG - Intronic
1173322916 20:42005412-42005434 CTGTGAGTCATGGCTGCTAATGG - Intergenic
1173648427 20:44648177-44648199 CTGTGAACATAGGCTGATAAGGG + Intronic
1177167968 21:17624214-17624236 CTGTGAGACTTGATTGAAATGGG - Intergenic
1177682847 21:24396049-24396071 CTGTGAGTCTGCTCTGATAAGGG - Intergenic
1183857142 22:40642440-40642462 CTGTGAGTGTTGGCTGCTAAGGG - Intergenic
1185076802 22:48687517-48687539 CTGTGAGCCTTGATGGATCCAGG + Intronic
952744682 3:36765240-36765262 CTTTGTGACTTGATTGATAAAGG - Intergenic
952805590 3:37348037-37348059 CTGTGTGCCGTGGCTGAGAATGG + Intronic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
957510627 3:81183202-81183224 CTGTCAGCTTGGACTGATAAGGG - Intergenic
959374485 3:105571693-105571715 CTGTGAGCCTTGACTGATAATGG - Intronic
959537744 3:107506080-107506102 CACTGAACCTTGACTGATACGGG + Intergenic
960704724 3:120470876-120470898 CTTTGAGCCTTGACTGACAAGGG + Intergenic
961702268 3:128754878-128754900 ATGTGAAACATGACTGATAATGG + Intronic
964017289 3:151963278-151963300 CTGTCAGCCTTGGCTTAGAAAGG + Intergenic
964105724 3:153037336-153037358 CAGTGGGCTTTGACAGATAAGGG + Intergenic
970534166 4:17012124-17012146 ATGTGAGCTTTGAATAATAAGGG + Intergenic
971278719 4:25223110-25223132 CAGTGAGCTTTGATTGATAGTGG + Intronic
972323669 4:37995212-37995234 CTAGGAGCCTGGACAGATAAAGG + Intronic
976673932 4:87683853-87683875 ATGTGAGCATTGAGTGATCAGGG - Intergenic
976755416 4:88492422-88492444 CTCTGGGGTTTGACTGATAAAGG + Intronic
977032936 4:91909845-91909867 CTTTGAGCCTGGACTGAACATGG + Intergenic
977036648 4:91961827-91961849 TTGTGAGCCCTAACTGAAAAAGG - Intergenic
981286670 4:143026173-143026195 CTTTGAGCCTTGCCTGGTGAGGG - Intergenic
981568422 4:146125792-146125814 CTTACAGCCTTGAATGATAAAGG - Intergenic
981977816 4:150752353-150752375 CTGAGAGCTTTAACTGAGAAAGG - Intronic
982079869 4:151778761-151778783 CTGTGAGGCCTGATTGCTAATGG - Intergenic
983144440 4:164196028-164196050 ATGAATGCCTTGACTGATAAAGG + Intronic
984869682 4:184315193-184315215 CTATGAGCTTTGGGTGATAATGG + Intergenic
986203598 5:5601656-5601678 CTGTGAGTGTTGGCTGCTAATGG - Intergenic
986795796 5:11210820-11210842 CTGTGGGCCTTGTCTGCTCAAGG + Intronic
990439822 5:55833321-55833343 CTGTGAGCCTTTCATGAGAAGGG + Intergenic
991284305 5:64954156-64954178 CTGTGAACTCTGACTGAGAAGGG - Intronic
996650931 5:125874964-125874986 CTGTGAGTGTTGGCTGATGATGG - Intergenic
996725371 5:126669526-126669548 CTGAGTGACTTGACTAATAAAGG + Intergenic
998038652 5:138937133-138937155 CTGTGAGCCTTGGCAGAGGATGG - Intergenic
999467388 5:151820747-151820769 CTTTGAGGCTTGAATGGTAAAGG - Intergenic
1001963780 5:175896054-175896076 CTTTGAGCCTGGGCTGAGAAAGG - Intergenic
1005710402 6:28498845-28498867 CTGTGAGTTTTGGCTGCTAATGG + Intergenic
1006029523 6:31169250-31169272 TGCTGAGCCTTGAATGATAATGG - Intronic
1007932264 6:45702314-45702336 CTGTCCGCCTTGAGTGATCAGGG + Intergenic
1008925224 6:56885149-56885171 CTGTGAGGGTTGGCTGCTAATGG + Intronic
1010368560 6:75080969-75080991 CTGTGAGCCTCCAATGATAAAGG + Intergenic
1011040054 6:83019983-83020005 CTGACAGCGTTGGCTGATAATGG - Intronic
1011623117 6:89261148-89261170 TTGTGAGCCTTGTCAGATGAAGG + Intronic
1011982552 6:93400593-93400615 CAGTGAGCAGTGAGTGATAATGG - Intronic
1014328647 6:120031552-120031574 CTGGCAGCCTTGATTAATAAAGG - Intergenic
1014886224 6:126784747-126784769 CTCTAACCCTTAACTGATAATGG - Intergenic
1017889020 6:158624375-158624397 CTCTGAGCCTTGACTGTAAGAGG + Intronic
1020844036 7:13260119-13260141 CTGTGAGCCTTGTCTGCTCATGG + Intergenic
1022429524 7:30302840-30302862 CTGTGGGCCCTGACAGTTAACGG - Intronic
1027643653 7:80769474-80769496 TTGTGAGCCTTGTCAGAAAATGG - Intronic
1031694985 7:124839839-124839861 CTGTGGACTTTGAGTGATAATGG - Intronic
1034130461 7:148711388-148711410 CTGTGAGCCTTGAGTGGTTCAGG + Intronic
1034231986 7:149537376-149537398 CTCTGAGCCTTGAGAGATAAAGG + Intergenic
1035191193 7:157170165-157170187 CTGTGAGCAAGGACCGATAATGG + Intronic
1035398171 7:158548633-158548655 CTGTGTGCCTTTTATGATAAAGG + Intronic
1041067463 8:54095959-54095981 ATGTGATCCTAGACTGATAAAGG + Intronic
1043961118 8:86419552-86419574 GTGTGAAATTTGACTGATAAAGG + Intronic
1045141646 8:99291738-99291760 ATTTAAGCCTTGAGTGATAAAGG + Intronic
1047851020 8:128858135-128858157 CTGTTTCCCTTGACTGTTAAGGG - Intergenic
1048495595 8:134933257-134933279 CTGAGAGCCCTGACAGATAGAGG + Intergenic
1048950422 8:139492127-139492149 CTGTGAGCACTGAGTGCTAATGG - Intergenic
1050014787 9:1222151-1222173 CTGTGAGTGTTGACTGCTAATGG - Intergenic
1050119897 9:2297527-2297549 GTGTGAGAATAGACTGATAAAGG - Intergenic
1050634110 9:7592100-7592122 TTTTGATCCTTGATTGATAATGG - Intergenic
1058761322 9:108136173-108136195 CTGAGAGCCTTCCCTAATAAAGG + Intergenic
1059059690 9:111022287-111022309 CTGGGAGCCTTGTCTTAAAATGG - Intronic
1185660818 X:1727622-1727644 CTGTGAGTCCTGGCTGCTAATGG + Intergenic
1188930678 X:36106967-36106989 CTGTGAACTTTGGGTGATAATGG + Intronic
1191604141 X:63043161-63043183 CTGTAAGCATTGACTGCTATGGG - Intergenic
1192792893 X:74400467-74400489 CTGTGGACTTTGAGTGATAATGG + Intergenic
1196007068 X:110848284-110848306 CTGTGAGGATTGACTGAGACTGG + Intergenic