ID: 959377348

View in Genome Browser
Species Human (GRCh38)
Location 3:105602864-105602886
Sequence AGTTATCTGCGGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959377345_959377348 4 Left 959377345 3:105602837-105602859 CCAAGAGCTGTCTTTCAAAAGGA 0: 7
1: 195
2: 205
3: 190
4: 402
Right 959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG No data
959377343_959377348 25 Left 959377343 3:105602816-105602838 CCTTGGTGAGTGGAAGTCAGGCC No data
Right 959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG No data
959377341_959377348 29 Left 959377341 3:105602812-105602834 CCAGCCTTGGTGAGTGGAAGTCA No data
Right 959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959377348 Original CRISPR AGTTATCTGCGGAAGATGGT AGG Intergenic
No off target data available for this crispr