ID: 959384139

View in Genome Browser
Species Human (GRCh38)
Location 3:105680658-105680680
Sequence CAGTGGTACTTGTGAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959384139 Original CRISPR CAGTGGTACTTGTGAGAAAA TGG Intronic
900733357 1:4277934-4277956 CAGTTGGACTTGTGAAGAAAAGG - Intergenic
901101622 1:6723520-6723542 CAGGTGTCCTTATGAGAAAAAGG + Intergenic
901113790 1:6822684-6822706 CAGTGGTAAATGTGACCAAAGGG - Intronic
904083045 1:27884026-27884048 CAGGTCTACTGGTGAGAAAAAGG - Intronic
905491699 1:38349293-38349315 CAGTGGTTATTGTAAGAACATGG + Intergenic
905500940 1:38435880-38435902 AAGGAGTAGTTGTGAGAAAAGGG + Intergenic
907968670 1:59359052-59359074 CAGGGGTACCTGTGTGATAAAGG - Intronic
908598369 1:65711860-65711882 CAATGGTACTGGTTAGACAATGG - Intergenic
909874982 1:80790523-80790545 CAGTGAGGCTTCTGAGAAAAGGG + Intergenic
910223251 1:84910975-84910997 CAATGAAAGTTGTGAGAAAATGG - Intergenic
910454642 1:87384399-87384421 AGGTGGTACATGTAAGAAAATGG - Intergenic
910520126 1:88111425-88111447 CAGTTGTTCTGATGAGAAAAGGG - Intergenic
917608679 1:176663804-176663826 CAGGAGAACTTGAGAGAAAATGG - Intronic
921997976 1:221442365-221442387 CAGTGGTTCTGCTGAGAAAGTGG + Intergenic
1064088949 10:12367103-12367125 TAATTATACTTGTGAGAAAAAGG + Intronic
1066047609 10:31607015-31607037 CAGTGGGAGTTTTGAGAAAGAGG - Intergenic
1073439771 10:103545516-103545538 CAGAGGTACCTGTGAGTAATGGG - Intronic
1073515952 10:104075725-104075747 CAGTGGTACTTACGTGCAAAAGG - Intronic
1073586025 10:104710915-104710937 CAGTGGCATTTGTGAGTAGATGG + Intronic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1079118234 11:17654215-17654237 CAGTGGGACAACTGAGAAAAAGG - Intergenic
1079772865 11:24485776-24485798 CAATGTTACTTGTGATAAAAAGG - Intergenic
1080285460 11:30606324-30606346 CAGTGCTATTGGTGAGAAATGGG - Intergenic
1080685306 11:34510559-34510581 CAGTGTTACTTCTGAGAAAGGGG - Intronic
1087221848 11:95554799-95554821 TAGTGGTGCTTGTGTGTAAAGGG - Intergenic
1087223816 11:95575846-95575868 CAGTTGTATTTGTGAGACCATGG + Intergenic
1087672491 11:101124781-101124803 AAGTGGTACTTGAGAAAATAGGG - Intronic
1088177659 11:107072403-107072425 CATTGGGACTTGTGTGAAAGTGG - Intergenic
1088475487 11:110234087-110234109 CTGGAGTACTTTTGAGAAAAAGG - Intronic
1090096171 11:123743587-123743609 CAGTGATACTTGTTAGAGCATGG + Intergenic
1090466518 11:126939492-126939514 CATTGGAACTTGTGAAAATAAGG - Intronic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1092632221 12:10394352-10394374 CAGTATTAAATGTGAGAAAATGG + Intronic
1094233191 12:28132145-28132167 CAGTGCTATTTGTCTGAAAATGG + Intergenic
1094291016 12:28850263-28850285 CAATGGTACTAGCGACAAAATGG - Intergenic
1094579424 12:31720573-31720595 AATTGGTATTTGTGAGAAAAAGG - Intronic
1096432523 12:51558658-51558680 ATGTAGTTCTTGTGAGAAAATGG - Intergenic
1097226484 12:57479416-57479438 CACTGTCACCTGTGAGAAAAAGG + Exonic
1097691576 12:62739091-62739113 CAGTGGAAGCTGTGAGAAAATGG + Intronic
1099228857 12:80000328-80000350 TAGTGGTACTTGATGGAAAAGGG - Intergenic
1100934217 12:99644950-99644972 CAGTGGTCTTTGTAAGAGAAAGG - Intronic
1102656508 12:114486356-114486378 CAGTGATACTTGCAAGAACATGG - Intergenic
1104004779 12:124884310-124884332 CAGGGGTCCTTATGAGAAGAGGG + Intergenic
1105408037 13:20147603-20147625 CAGTGGTGCTTCTGAGAATGGGG + Intronic
1105467633 13:20660951-20660973 CAGTAATACTTTTGAAAAAATGG + Intronic
1106993303 13:35450166-35450188 CAGATGTACTTGCAAGAAAATGG + Intronic
1107513811 13:41109800-41109822 CAGTGGAAACTGTGAGAACATGG - Intergenic
1108789055 13:53944263-53944285 CACTGATACTTTTGAAAAAATGG - Intergenic
1110048364 13:70860357-70860379 CAATGGAAGTTGTGAGAAGAGGG - Intergenic
1110139219 13:72106515-72106537 CAGTGGTAATTGAAAGATAATGG + Intergenic
1110933245 13:81249811-81249833 CAAAAGTACTTGTAAGAAAATGG - Intergenic
1111398379 13:87698824-87698846 CAATGGTTCTTGTTAGAAATTGG + Intergenic
1111528863 13:89510513-89510535 CACTGTCATTTGTGAGAAAATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112131297 13:96526541-96526563 CAATGGTACTAGGGAAAAAAAGG - Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112785764 13:102950542-102950564 CAGTGGGACTTGGGAGACGAAGG - Intergenic
1113179192 13:107606162-107606184 CAATGGTACTAGTGAGCACATGG + Intronic
1120103186 14:80467177-80467199 CAGTGGCCCTTGTTAGAAAGGGG - Intergenic
1120453863 14:84706759-84706781 CATTAGTAATTGTGAGGAAATGG - Intergenic
1127252759 15:57258163-57258185 CCCAGGTACTTGTGAGAAAGAGG + Intronic
1127738085 15:61865902-61865924 AAGTAGTACTTAGGAGAAAAAGG + Intronic
1127738415 15:61870436-61870458 TACTGGTACTTGTTACAAAATGG - Intronic
1129096179 15:73211071-73211093 CAGTGGTACTTCTTTGAAAGAGG + Intronic
1129162888 15:73756921-73756943 CAGTGGTCCATGTGAGAGATGGG - Intergenic
1129942604 15:79511439-79511461 CAGTGGTAATTGTTAGACCAGGG - Intergenic
1130520938 15:84660148-84660170 CAGTGGGACTTCTGGGAAAGTGG - Intergenic
1132947972 16:2543141-2543163 CAGTGGAACATGTGGGAAAGGGG + Intronic
1132966475 16:2658201-2658223 CAGTGGAACATGTGGGAAAGGGG - Intergenic
1133148413 16:3807988-3808010 CAGGGGTTCTTGTGAGACAGTGG + Intronic
1133449608 16:5892731-5892753 CAGGGGTAGTGGGGAGAAAATGG + Intergenic
1135408736 16:22217376-22217398 CAGTGGCCCTAGTAAGAAAAAGG + Intronic
1135648666 16:24186518-24186540 CAGTGGTACAGGTTAGAACATGG + Intronic
1135728564 16:24875892-24875914 CAGAGGGAATTGGGAGAAAATGG + Intronic
1135734742 16:24921663-24921685 CAGGAGTAACTGTGAGAAAAAGG - Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1139753523 16:69124018-69124040 CAGTGGAACCTGGGAGATAAAGG + Intronic
1141580951 16:84998329-84998351 CAGGGGTCCCTGGGAGAAAAGGG + Intronic
1143160323 17:4865512-4865534 CATTTGTCCTTATGAGAAAAAGG - Intronic
1146945271 17:36869342-36869364 TGGTGGCACTTGGGAGAAAATGG + Intergenic
1153157535 18:2166666-2166688 AAGTGGCATTTTTGAGAAAATGG + Intergenic
1155323948 18:24647290-24647312 CAGTCCTACTTGTGATCAAAAGG - Intergenic
1159967910 18:74614798-74614820 CAGTTGCATTTCTGAGAAAAAGG + Intronic
1160330423 18:77986582-77986604 CAGTGGTCCTTGTTTGAAGAAGG + Intergenic
1161510249 19:4666576-4666598 CAGTTTTACTTTTAAGAAAATGG + Intronic
1162563716 19:11433412-11433434 CAGTGGTTCTTGTTGGAAAAGGG - Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
925960834 2:9013748-9013770 CATTGGAACTTATAAGAAAATGG - Intergenic
928056632 2:28062641-28062663 CAATGATACTTGTGTTAAAAAGG + Intronic
929367083 2:41172177-41172199 AAATGGTACTTTTGACAAAAGGG - Intergenic
930574532 2:53130101-53130123 CAGTGGCACTTGTGGGATACAGG + Intergenic
931409297 2:62013578-62013600 CAGTGGTCCAGGTGAGATAACGG + Intronic
933820193 2:86104253-86104275 CAGTAGCAATTGGGAGAAAAAGG + Intronic
934074700 2:88418074-88418096 CTGTGGTACTTGTGGGGCAAGGG - Intergenic
934688439 2:96338595-96338617 CAGTGGTCCTTGTAAGAGGAAGG + Intronic
934749430 2:96783297-96783319 CAGAGGTGCTTCTGAGAATACGG + Intronic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939852073 2:147315246-147315268 CTCTGGTACTTGAGAGAGAAGGG - Intergenic
940525236 2:154806294-154806316 CATTGGTACTTGAGAGGCAAAGG - Intronic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
941728453 2:168889802-168889824 CAGTTTTACTTGTGAGAAAATGG - Intronic
943393559 2:187302453-187302475 CAGTGTTACTTAGGAGAAATGGG + Intergenic
945512133 2:210715512-210715534 CAGAGGCACTTGAGAGATAAAGG + Intergenic
945654815 2:212610525-212610547 CAGTAGTACTTGAGAGAGATGGG + Intergenic
945997540 2:216450744-216450766 CAGGGGTGGTTGTGAGAAGAGGG + Intronic
947614980 2:231550109-231550131 GAGTGGGACTTATGAGGAAACGG + Intergenic
1170045224 20:12078025-12078047 CAGCGGTAATTCTGAGAAAATGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1171771652 20:29326777-29326799 GTGTGGACCTTGTGAGAAAAAGG - Intergenic
1173156370 20:40614718-40614740 CAGTTATTCTCGTGAGAAAAAGG - Intergenic
1174325971 20:49779185-49779207 CAGGGGGACTTGGGAGAAAATGG + Intergenic
1174779249 20:53373076-53373098 AACTTGTTCTTGTGAGAAAATGG + Intronic
1177011694 21:15738263-15738285 AAGTGTTACTTCTGAAAAAAAGG - Intronic
1177442395 21:21143220-21143242 CATTGGAAGATGTGAGAAAATGG + Intronic
1179623929 21:42637552-42637574 CTGTGGTACTTCTGAGAAGGAGG - Intergenic
1181019290 22:20090347-20090369 TAGTTGTACTTGTGAGCAAGGGG + Intronic
1181878369 22:25957807-25957829 CAGTTGTCCTTATAAGAAAAAGG - Intronic
950957127 3:17065908-17065930 CAGTGATACTTATGAGAATATGG + Intronic
952450381 3:33426735-33426757 CATTGGTACATGTTAGAACACGG - Intronic
952589910 3:34939403-34939425 CATTGGTATTTGTGAGAAATCGG - Intergenic
955062230 3:55503210-55503232 CAGTGGTTCTTGTGAGAGAATGG + Intergenic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
955987139 3:64585343-64585365 CAGAGGTAGTTGTGAGAATGAGG + Intronic
956387124 3:68731371-68731393 CAGTGGTCCATTTGGGAAAATGG - Intergenic
957782204 3:84834263-84834285 CAATGGTACTTGTTAAAACATGG + Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
960023143 3:112978009-112978031 CAATGGTACTGGGGAGCAAAGGG - Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
964975263 3:162610844-162610866 CAGTGGTACATTTGAGAAAGAGG + Intergenic
966077086 3:175949976-175949998 GAGTGGTTATTGTGAGAAATAGG + Intergenic
969142154 4:5085990-5086012 CAGTGCTACTTGGGAGGAGAAGG + Intronic
970448020 4:16140103-16140125 CTGTTGTACTTATCAGAAAAGGG + Intergenic
971212480 4:24632609-24632631 AAGTTTTACTTGTGAAAAAATGG + Intergenic
972683828 4:41332532-41332554 GAGTGGGACTTGGAAGAAAAGGG + Intergenic
973685947 4:53370135-53370157 CAGTGGCAAGTGTCAGAAAAGGG + Intergenic
974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG + Intergenic
975323352 4:73033368-73033390 TAATGGTACTTGTTAAAAAATGG - Intergenic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
975925906 4:79453216-79453238 CAGTGTTATTTGTAATAAAAAGG - Intergenic
976180999 4:82398638-82398660 CAATGGTACTTCTGAAACAAAGG - Intergenic
976903607 4:90208834-90208856 CAGTGGGACTGGTTAGAAACTGG - Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
978501168 4:109411354-109411376 CAGTGGTACTTGGGATTCAAAGG - Intergenic
978617828 4:110613590-110613612 CAGTGGTAGTTGTGGAAAACAGG - Intergenic
979235703 4:118397890-118397912 CAGTTGTTCTAGTGAGGAAAAGG + Intergenic
980491026 4:133529461-133529483 CAGTGGTATTTCTGAGAAGCAGG + Intergenic
981602272 4:146503578-146503600 CAGTGGAAATTGGGAGACAAAGG - Intronic
982685693 4:158486188-158486210 CAGTGGTGCTTTGGAGATAACGG - Intronic
983362346 4:166743595-166743617 CATTGGGACTGGTCAGAAAATGG + Intronic
983711109 4:170716607-170716629 CAGAGGAACTGGTGAGAAAAGGG + Intergenic
984080887 4:175248508-175248530 CAGAGTTATTTATGAGAAAAAGG + Intergenic
985133190 4:186759409-186759431 CAGTTTTACGTGTGAGTAAACGG - Intergenic
985308912 4:188575946-188575968 CAAAGGAACTTGGGAGAAAATGG + Intergenic
986091343 5:4511563-4511585 CAGTGGAACTTGTTAGATCAGGG + Intergenic
986875366 5:12100967-12100989 TAAAGGTACTTGTGGGAAAAAGG + Intergenic
989322160 5:40148380-40148402 CTGTGGAACCTGTGAAAAAAAGG + Intergenic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990332441 5:54740958-54740980 CAGGGATACTGGTGAGAACAAGG + Intergenic
990551880 5:56889721-56889743 CAATTTTACATGTGAGAAAATGG - Intronic
991141581 5:63250375-63250397 CAGTGGTACTCTTAAGAACAAGG - Intergenic
991161189 5:63505389-63505411 AAATGGTACTTTTGTGAAAAAGG - Intergenic
993052688 5:82944171-82944193 CACTGGGGCTTGTCAGAAAATGG + Intergenic
993069063 5:83135224-83135246 CACTGGGACTTGTGAGACAGTGG - Intronic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
994868995 5:105319418-105319440 CATTGGTTGTTGTGAGAAAATGG + Intergenic
995059420 5:107797315-107797337 CAGTGGTACTTGGGACCTAAGGG - Intergenic
997274792 5:132575708-132575730 CAGTGTTGGTTCTGAGAAAAAGG - Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001074203 5:168613225-168613247 CACTGGTACTTCTGCCAAAAAGG + Intergenic
1002342078 5:178523803-178523825 CAGTGATTCTTGGGAGAACAAGG - Intronic
1003166050 6:3679514-3679536 CAGTGGTGCCTAAGAGAAAATGG + Intergenic
1004026968 6:11828240-11828262 CATAGGTATTTGTGGGAAAAGGG - Intergenic
1004884221 6:20036421-20036443 CAGTGATATCTGTGAGAAACAGG - Intergenic
1004950848 6:20670041-20670063 CAGAGTTACTTATAAGAAAAGGG - Intronic
1006922608 6:37636570-37636592 CAGTGGGACTCCTGAGAACACGG - Exonic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007638220 6:43314003-43314025 CAGTGGTCTTTGTGAGAAAGAGG - Intronic
1010569286 6:77458510-77458532 CAGGGGTACTTGGGAGAAGTTGG - Intergenic
1011132479 6:84065584-84065606 CATTGGTTCTTCTGAGGAAAAGG - Intronic
1011524880 6:88253727-88253749 CACTGGGACTTGTTAGACAATGG + Intergenic
1011904689 6:92350291-92350313 CAGTGATAGTTTTGAAAAAAAGG + Intergenic
1014385733 6:120799581-120799603 CGGTGGTACTTGGCAGAAAGAGG + Intergenic
1016212742 6:141560026-141560048 CAATGGTACAAGTGACAAAAAGG - Intergenic
1019208571 6:170384686-170384708 CAGTGGGACGTGTGAGCACAGGG + Intronic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1022623288 7:32007215-32007237 CAGTGGTACTGAACAGAAAATGG - Intronic
1024563518 7:50663638-50663660 CACTGCTGCTTGTGAGAGAAGGG - Intronic
1025154531 7:56592280-56592302 CAGGGGTAATTGTCAAAAAATGG + Intergenic
1028575785 7:92348732-92348754 AAATGGCACTTGTGAAAAAATGG + Intronic
1030595648 7:111535763-111535785 CAGTGGTGACTGTGGGAAAAGGG + Intronic
1031726143 7:125241903-125241925 CAGTAGATCTTGTGAGCAAAAGG - Intergenic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032571261 7:133001325-133001347 CAGTGTTAGATGTGAGAGAAAGG - Intronic
1035004660 7:155646430-155646452 CTTTGGCACTTGTGACAAAATGG - Intronic
1035736360 8:1890109-1890131 CCGTGTGAGTTGTGAGAAAACGG + Intronic
1038009662 8:23464975-23464997 CACTGGTAGGTGAGAGAAAAGGG + Intergenic
1040383309 8:46894084-46894106 CATTGGGACTTGTCAGAAAGTGG + Intergenic
1040676781 8:49759505-49759527 CAGTGTCAGTTTTGAGAAAAAGG - Intergenic
1041348360 8:56924383-56924405 CAGTGATACTTGTCAGACTATGG - Intergenic
1042299534 8:67261797-67261819 CAGAGTTACTTCTGAGGAAAGGG - Intronic
1045550800 8:103170465-103170487 CTGTTGTTCTTGTAAGAAAAAGG + Intronic
1046098048 8:109583533-109583555 CAGTGGGACATGTGAGGAACAGG - Intronic
1046176409 8:110581613-110581635 CAGTGGTATATATGTGAAAATGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1051260645 9:15261156-15261178 CAGTGGTTTTTATGAGAAAGAGG + Intronic
1052033211 9:23651548-23651570 CAGTGGTACTAGTGTGTGAAGGG - Intergenic
1055157176 9:73078751-73078773 CAGAGGTACTTGACAGAAAATGG + Intronic
1057016218 9:91655371-91655393 CAGTGATTCATGTGACAAAAAGG + Intronic
1058163377 9:101594385-101594407 GGGTGGTGCTTGTAAGAAAAAGG + Exonic
1060148900 9:121274522-121274544 CAGTGACACTTGTGAAAACACGG + Intronic
1061021740 9:128020191-128020213 CAGTGGTACTTGTGAGGCTGAGG - Intergenic
1186669675 X:11756989-11757011 CAGTGGTACATGCAAGAAAGGGG + Intergenic
1188146116 X:26616061-26616083 CAGTAGTAGTTGGGAGAATAAGG + Intergenic
1190652163 X:52577901-52577923 CACTGGTTCTTGGGAGAAAGGGG - Intergenic
1191634662 X:63362942-63362964 CAGTGGTCATTATCAGAAAAAGG + Intergenic
1192483990 X:71509326-71509348 AAGTGGTAATTGTGATAAAAAGG + Intronic
1192829173 X:74732234-74732256 CAGTGGTAATGGTGATAGAAAGG + Intergenic
1197015593 X:121621931-121621953 CAGTGGAACTTTTCAGTAAATGG - Intergenic
1197670947 X:129276597-129276619 CAGTGGCACCTGGAAGAAAAGGG + Intergenic
1199576013 X:149314693-149314715 CAGCTGTTCTTCTGAGAAAAAGG + Intergenic
1199800504 X:151246761-151246783 AAGTGTCACTTGTGAGTAAATGG + Intergenic
1200824631 Y:7625245-7625267 CAGTGGTCATTGTTAGAAAGGGG + Intergenic
1201065110 Y:10089468-10089490 GAGTGGGCATTGTGAGAAAAAGG - Intergenic
1201353411 Y:13071737-13071759 CACTGATACTAGTCAGAAAATGG + Intergenic
1202191773 Y:22253332-22253354 CAGTGGCCATTGTTAGAAAAGGG + Intergenic
1202235424 Y:22705842-22705864 CAGTGGTCATTGTTAGAAAGGGG - Intergenic
1202307735 Y:23490326-23490348 CAGTGGTCATTGTTAGAAAGGGG + Intergenic
1202563066 Y:26180260-26180282 CAGTGGTCATTGTTAGAAAGGGG - Intergenic