ID: 959385118

View in Genome Browser
Species Human (GRCh38)
Location 3:105694628-105694650
Sequence GTTTCTTATTTTAAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959385118 Original CRISPR GTTTCTTATTTTAAGTTGAT AGG (reversed) Intronic
902273230 1:15320902-15320924 TTTCCTTCTTTTGAGTTGATGGG + Intronic
904551991 1:31326433-31326455 GTTTCTCATTTTATGTTGTCTGG + Intronic
907154141 1:52317000-52317022 GTTTCTTATTTAAAGCTGTGTGG - Intronic
908139667 1:61171280-61171302 GCTTTTTATTTCAAGTAGATGGG - Intronic
908376862 1:63551682-63551704 ATTGCTTATTTTAAGGTGTTTGG + Intronic
909749875 1:79145463-79145485 ATTTATTATTTTAAGTTTAGGGG - Intergenic
910042120 1:82865213-82865235 GTTTTTTATTTTTACCTGATGGG + Intergenic
910170870 1:84375545-84375567 GCATCATATTTTTAGTTGATGGG - Intronic
910186104 1:84542243-84542265 GTTTCTTTTTTTAAGTAAATGGG + Intergenic
910933964 1:92471245-92471267 GTATCTTTTTATAAGTTGATGGG - Intergenic
911005428 1:93216884-93216906 GTTTATATTTTTAAGTTAATAGG + Intronic
911528352 1:99013217-99013239 GTTTCTTTGTTTAAGATGAATGG - Intergenic
911771883 1:101754052-101754074 TTTCCTTATTTTAAGTTCAGGGG + Intergenic
911817773 1:102375457-102375479 GATTTTTATTTTCAGTTAATTGG + Intergenic
912442445 1:109709838-109709860 GTTTATGATTTTGAGTTAATGGG - Intergenic
913446242 1:118953702-118953724 TTTTCTTTTTTTAAGTTTATTGG + Intronic
913707747 1:121444219-121444241 GTATGTTATTTAAAGTTGAGAGG + Intergenic
914729841 1:150360657-150360679 TTTTCTTTTTTTAAGTAGCTGGG + Intergenic
915193622 1:154172683-154172705 CTTTCTTATTTTTTGTTGGTAGG - Intronic
915489754 1:156244479-156244501 GTTTCTTATTCTCAATTTATGGG - Intronic
916375147 1:164145499-164145521 GTTTTTTTTTTTAAGATGAGAGG + Intergenic
916407491 1:164511642-164511664 GTTTTTTTTTTTAAGTTATTAGG - Intergenic
916985335 1:170185224-170185246 GTTTTTTTTTTTAAGTTCAGGGG + Intergenic
917268725 1:173250006-173250028 TTTTTTTATTTTAAGTTCAGAGG - Intergenic
917446814 1:175113065-175113087 GTTTCTTATTGTGATTTGGTAGG + Intronic
918765358 1:188475307-188475329 GATTTTTATTTTAGGTTCATGGG + Intergenic
919112062 1:193232999-193233021 GTTTCTTCTTTTCATCTGATGGG - Exonic
920018953 1:202938884-202938906 GTTTGTTATTTTAAGTTAGGTGG - Intergenic
921175483 1:212590248-212590270 TTTTTTTTTTTTAAGTTAATGGG + Intronic
921632568 1:217453671-217453693 GTTTTTTGTTTTGAGTTTATTGG - Intronic
921737511 1:218645161-218645183 GTTTGTTAATTCAGGTTGATGGG + Intergenic
922399036 1:225232802-225232824 GATTCTTATTTTAAGTTCAGGGG + Intronic
922638717 1:227204928-227204950 GATTTTTTTTTTAAGTTTATGGG - Intronic
1064174181 10:13059915-13059937 GTTTCGTATTTTTAGTAGAGAGG - Intronic
1064189131 10:13189958-13189980 CTTTCTTTTTTTAAGCTTATAGG - Intronic
1064526166 10:16259122-16259144 GATTCTTCTTTTCAGTTGAGTGG - Intergenic
1064958416 10:20937331-20937353 GATGCTTATTTTAAGTTGGGAGG - Intronic
1064973521 10:21089804-21089826 GTTTCTTATTTTAACTCGAATGG - Intronic
1065788315 10:29236942-29236964 TTTTCTTATTTTTAGTAGAGAGG + Intergenic
1066481579 10:35800345-35800367 GTTTCTTATTTAAATTATATTGG + Intergenic
1067391500 10:45867037-45867059 GATTATTTTTTTAAGTTGAATGG - Intergenic
1067403183 10:45996630-45996652 GATTATTTTTTTAAGTTGAATGG + Intronic
1067798239 10:49336472-49336494 TTTTCTTATTTTAAATTGTTGGG + Intergenic
1067871789 10:49969102-49969124 GATTATTTTTTTAAGTTGAATGG + Intronic
1067958545 10:50821194-50821216 GTTTTTTATTTAAAGATTATTGG - Intronic
1067995853 10:51272504-51272526 GTTTTTTTTTTTAAGTAGTTTGG + Intronic
1068459826 10:57313162-57313184 GTTTTTTTTTTTAAATTTATAGG - Intergenic
1068822033 10:61388399-61388421 GGTTGTTATTTTAGGTAGATTGG - Intergenic
1069690974 10:70352229-70352251 TTTTTTTTTTTTAAGTTAATGGG + Intronic
1070899674 10:80017205-80017227 TTTTCATATTTTTAGTAGATAGG - Intergenic
1071370203 10:84943629-84943651 TTTGATTATTTTAAGTTGACAGG + Intergenic
1071472075 10:85990743-85990765 GGGTTTTATTTTAAGTTGAATGG + Intronic
1071496642 10:86172106-86172128 GGTTCCTTTTTTGAGTTGATGGG - Intronic
1071605692 10:86986333-86986355 GTTTCTTAATTTTATTTTATAGG + Intergenic
1072105031 10:92265583-92265605 TTTTGTTATTTTTAGTAGATGGG - Intronic
1074485172 10:113869777-113869799 GATTCTTATTTAAAATTCATTGG + Intronic
1074759780 10:116658465-116658487 GCCTCTTATTTTCAGCTGATGGG - Intergenic
1075527851 10:123201338-123201360 GTTTCTTTTCTTTAGTTAATGGG + Intergenic
1076274406 10:129184605-129184627 GTTTCTTAGTTTATGGGGATGGG - Intergenic
1078865196 11:15290576-15290598 GTTTATTATTTTCATTTTATAGG + Intergenic
1078959801 11:16251893-16251915 GTTTATTATGTTATATTGATTGG - Intronic
1079672004 11:23182627-23182649 GATTCTTATTTTACTTTGAAAGG + Intergenic
1080218384 11:29871762-29871784 GTTTCTCTTTTTAAGTTCAGGGG + Intergenic
1080888867 11:36391202-36391224 CTTCTTTATTTTAAGTTGTTGGG + Intronic
1081307070 11:41525984-41526006 CTTCTTTATTTTAAGTTGAGGGG + Intergenic
1081512119 11:43785958-43785980 GTTTTTTCTCTTAAGCTGATGGG + Intronic
1081725767 11:45327988-45328010 CTTTTTTTTTTTAAGTTGAGAGG - Intergenic
1082619794 11:55406199-55406221 GTTTCTTACTTTAAGTTCTGGGG + Intergenic
1082941843 11:58713890-58713912 GTTTATTTTTTTATTTTGATTGG + Intronic
1083395522 11:62389025-62389047 GTTTCATGTTATATGTTGATGGG - Intronic
1085094240 11:73746152-73746174 TTTTTTTCTTTTAAATTGATGGG - Intronic
1087920119 11:103857099-103857121 GTTTTTTTTTTAAAGTTCATAGG + Intergenic
1088701204 11:112413676-112413698 GTTTAATGTTTTAAGTTGCTAGG + Intergenic
1088832402 11:113548571-113548593 GTTTTTTCTTATAAGTTCATAGG - Intergenic
1090386294 11:126359287-126359309 TTTTTTTTTTTTAAGTTTATTGG - Intronic
1090913102 11:131138874-131138896 GTTTCTTGATCTAAGTTGACAGG + Intergenic
1091489878 12:923884-923906 TTTTTTTATTTTTAGTAGATGGG - Intronic
1093095475 12:14966853-14966875 ATTTTTTATTTTAAGTTCAGGGG - Intergenic
1093167190 12:15817642-15817664 GTTTAAAATTTTAAGTTGAGGGG - Intronic
1093652905 12:21664339-21664361 TTTTCTTATTTTAAGGATATGGG + Intronic
1094224589 12:28030817-28030839 ATTTTTTATTTTAAGTTCAGAGG - Intergenic
1094468656 12:30781744-30781766 TTTTTTTATTTTTAGTAGATGGG + Intergenic
1095258539 12:40070816-40070838 GTTTATTATTTTATGTGGTTAGG - Intronic
1095994266 12:48066483-48066505 GTTTATACTTTTAAGTTGTTGGG - Intronic
1096267329 12:50134207-50134229 TTTTCTTATTTTTTGTAGATAGG - Intronic
1096487841 12:51995558-51995580 ATTTCTTTTTTTAATTTTATTGG + Intronic
1096783243 12:54002792-54002814 GTTTTTCTTTTTAAGCTGATTGG - Exonic
1097973702 12:65662760-65662782 GTTTCTTATTGGAAGCAGATGGG - Intergenic
1098105480 12:67065859-67065881 ATTACTTAATTTAATTTGATTGG + Intergenic
1098593368 12:72240875-72240897 GTTTATTTTTTAAAATTGATTGG - Intronic
1098712496 12:73781516-73781538 GTTTGTTTTTTTTAGTTCATCGG + Intergenic
1099088103 12:78272361-78272383 TTTTCTTATTTTAGGTTCAAGGG + Intergenic
1099331311 12:81292321-81292343 GTTTCTTATTTTAAATATACAGG + Intronic
1099500602 12:83409779-83409801 GTTCATTATTTTAAGATGCTAGG - Intergenic
1099842269 12:87981051-87981073 TTTTCTTATTTTCTTTTGATTGG - Intronic
1099966430 12:89451174-89451196 GTTGTTTGTTTTAAGTTGAAGGG - Intronic
1100119624 12:91353903-91353925 TTTACTTATTTTAAGTTTAGGGG + Intergenic
1100228661 12:92585212-92585234 GTATGTTATTTTAGGTAGATTGG - Intergenic
1100263296 12:92952456-92952478 GTTTCTTTTTTCAAGTTCTTAGG - Intergenic
1100556292 12:95697195-95697217 GTTATTTATTCTAACTTGATAGG + Intronic
1100727207 12:97421238-97421260 GTTTCTGTTTTTAAAATGATTGG - Intergenic
1101236860 12:102798383-102798405 GTTTCTTATATGAAATGGATTGG - Intergenic
1102745747 12:115247483-115247505 ATTTTTTATTTTAAGTTCAGGGG - Intergenic
1105064937 12:133188364-133188386 GTTTTTTATTTTTAGTAGAGAGG + Intronic
1105835474 13:24207364-24207386 GATTTTTATTTTAAGTTCAGGGG - Intronic
1106107367 13:26744637-26744659 GTTTTTTTTTTTAAGTCCATGGG + Intergenic
1107190940 13:37585091-37585113 GTTTCTATTTTATAGTTGATAGG - Intronic
1108229816 13:48324984-48325006 GTTTTTTTTTTTAAGTTCAGGGG + Intronic
1108599586 13:51980750-51980772 GTATCCTATTTAAGGTTGATGGG - Intronic
1108851311 13:54734013-54734035 GTTTCTTAATTTAAAATTATAGG - Intergenic
1109698985 13:66000751-66000773 GTTTCTGAATTTAATTTTATGGG - Intergenic
1109763938 13:66867889-66867911 TGTTCTTTTTGTAAGTTGATGGG + Intronic
1110316114 13:74109059-74109081 GTTTCTTTTTTTGAAGTGATTGG - Intronic
1110444378 13:75561567-75561589 TTTGCTTATTTTAAGTTGGTAGG + Intronic
1110519071 13:76453572-76453594 GTTTCATAATTTCAGTTGTTAGG - Intergenic
1110522517 13:76497398-76497420 TTTTCTTATTGTAAGTTGACAGG + Intergenic
1110581321 13:77132500-77132522 ACTTCTTATTTTAGGCTGATGGG - Intronic
1110904696 13:80871909-80871931 GTTTCATGTTTAAAGTAGATAGG + Intergenic
1111706031 13:91750501-91750523 GATTCTAAATTTAAGTTGCTGGG - Intronic
1111815259 13:93145188-93145210 ATTCCTTAGTCTAAGTTGATGGG - Intergenic
1111830338 13:93321632-93321654 ATTTTTTATTTGAACTTGATGGG - Intronic
1112959327 13:105103475-105103497 GTTTCCTATTTTAAGTTCCAGGG - Intergenic
1113220498 13:108096118-108096140 ATTTTTTATTTTTAGTGGATGGG + Intergenic
1113340845 13:109424115-109424137 GTCTCTAATTTGAGGTTGATCGG + Intergenic
1115481097 14:33862037-33862059 GGTTCATATTTTATGTTTATTGG + Intergenic
1115715720 14:36100816-36100838 GTTTGTTATTTTAAATTGGTGGG - Intergenic
1115931269 14:38498204-38498226 GTCTCTAATTTTAATCTGATGGG + Intergenic
1115958378 14:38808184-38808206 ATTTTTTATTTTAAGTTCAGAGG - Intergenic
1116027371 14:39531502-39531524 ATTTATCATTTTAAGTTGAATGG + Intergenic
1116115631 14:40646113-40646135 GTTTTTTTTTTTATCTTGATAGG - Intergenic
1116278290 14:42866401-42866423 GTTTTTTATTTTTAGTTAATGGG + Intergenic
1116429509 14:44829596-44829618 ATTTTTTATTTTAAGTTGCAGGG - Intergenic
1116689929 14:48092648-48092670 GTTTCTTAATTTAAATTAAGTGG - Intergenic
1117998082 14:61496770-61496792 TTTTTTTATTTTAAGATGACAGG + Intronic
1118343824 14:64918825-64918847 GTTTGTTTTTTTAAGTAGACAGG - Intronic
1119389018 14:74277560-74277582 GTTTTGTATTTTTAGTAGATGGG + Intergenic
1120021347 14:79534373-79534395 TTTTAATATATTAAGTTGATGGG - Intronic
1120333898 14:83128844-83128866 GTTTTTTTTTTTAAATTTATGGG + Intergenic
1120566016 14:86058139-86058161 TTTTCGTATTTTAAGTAGAGAGG + Intergenic
1121480794 14:94270746-94270768 TTTTTGTATTTTTAGTTGATAGG - Intronic
1123464339 15:20503982-20504004 TTTTGTCATTTTAAGTGGATGGG - Intergenic
1123653724 15:22496455-22496477 TTTTGTCATTTTAAGTGGATGGG + Intergenic
1124275068 15:28319957-28319979 TTTTGTCATTTTAAGTGGATGGG - Intronic
1124307631 15:28591644-28591666 TTTTGTCATTTTAAGTGGATGGG + Intergenic
1124938041 15:34191585-34191607 GTTAATTATTTTTAGTTGAATGG + Intronic
1126065941 15:44826464-44826486 GTTTGTTTTTTTCATTTGATTGG + Intergenic
1126093894 15:45074102-45074124 GTTTGTTTTTTTCATTTGATTGG - Exonic
1126253818 15:46600701-46600723 GTTTATTCTTTTAAGTAAATAGG + Intergenic
1126801928 15:52305897-52305919 GTTTCTTTTTCTAAATTAATTGG - Intergenic
1126868679 15:52963983-52964005 GTTTCAAAGTTTAAGTTTATTGG - Intergenic
1129416410 15:75384669-75384691 GGTTCTTATTTTAAATAGATAGG - Intronic
1130040387 15:80401422-80401444 TTTTTTTTTTTTAACTTGATGGG - Intronic
1130246360 15:82253349-82253371 TTTTTTTTTTTTAAGATGATGGG + Intronic
1130384866 15:83402378-83402400 GTTTTCTCTTTTAAGTTGTTAGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131677173 15:94682400-94682422 GTCTCTCATTCTAAGCTGATTGG - Intergenic
1131723133 15:95193234-95193256 TCTTCTTATTTTAAGTTGACTGG - Intergenic
1131883989 15:96889675-96889697 GTTTCTTCTTTTAATAAGATTGG - Intergenic
1132160796 15:99539937-99539959 TTTTCGTATTTTTAGTAGATGGG - Intergenic
1132283155 15:100638001-100638023 TTTTCTTATTTTAAGTGAATTGG + Intronic
1133446294 16:5863691-5863713 GTTTCATATATTTAGCTGATTGG + Intergenic
1133506822 16:6420636-6420658 GTTTCTCATTTTTAGTGTATTGG + Intronic
1133512006 16:6468792-6468814 GTCTTTTATTTTAAGTTCAGTGG + Intronic
1133663835 16:7945836-7945858 CTTTCTTTTTTTAATTTCATAGG + Intergenic
1133848294 16:9477762-9477784 GTTGATTATTTTTGGTTGATAGG - Intergenic
1134287946 16:12878939-12878961 GTGTCTAATTTTAAGGTGGTAGG - Intergenic
1135348844 16:21711851-21711873 GTTTGTTATTATTATTTGATTGG - Intronic
1135944125 16:26850086-26850108 AATTCTTATTTTAAGTTCAGGGG - Intergenic
1135962273 16:27006065-27006087 TTTTTTTTTTTTAAGTTTATTGG - Intergenic
1136238107 16:28927038-28927060 GTTTCTCATATTTTGTTGATGGG + Intronic
1137328543 16:47466660-47466682 TTTTGTTAATTTAATTTGATGGG + Intronic
1137647168 16:50085857-50085879 GTTTTTTATTTTTTGTAGATAGG - Intronic
1138051087 16:53779243-53779265 GTTTCTTTTTTTAACTTCTTGGG + Intronic
1138089278 16:54161018-54161040 GTGTGTTGTTTTAAGTTGCTAGG + Intergenic
1139622334 16:68156009-68156031 GTTTTTTATTTTAAGTCAAATGG + Intronic
1139799933 16:69514277-69514299 ATTTCTTATTTTCATCTGATGGG + Intergenic
1140451005 16:75070746-75070768 GTTTTGTATCTTAAGTAGATCGG + Intronic
1140704351 16:77612459-77612481 ATTTCTTATTTTTATTTTATTGG + Intergenic
1141457502 16:84153381-84153403 AAGTTTTATTTTAAGTTGATGGG - Intronic
1141732939 16:85834448-85834470 TTTTCTTGTTTTAATATGATGGG - Intergenic
1142821161 17:2468577-2468599 GTTTATTGTTTAAAGTTGCTAGG + Intronic
1143209676 17:5175870-5175892 GTTCCGTATTTTAACTTTATAGG - Intergenic
1143745341 17:8989881-8989903 GCATCTTTTTATAAGTTGATTGG - Intergenic
1144380671 17:14694627-14694649 CTTTCCTATTTTAATTTTATAGG - Intergenic
1144394451 17:14830409-14830431 ATTACTTATTTTAATTTGCTAGG + Intergenic
1144614981 17:16761152-16761174 ATTTTTTATTTTTAGTAGATGGG - Intronic
1144669075 17:17121665-17121687 TTTTCTTTTTTTAAGTTCAGGGG + Intronic
1144897724 17:18554521-18554543 ATTTTTTATTTTTAGTAGATGGG + Intergenic
1145134648 17:20391197-20391219 ATTTTTTATTTTTAGTAGATGGG - Intergenic
1146494085 17:33304987-33305009 GTGTTTTATTTTCAGTTGAGCGG + Intronic
1146977353 17:37125643-37125665 CTTTCTTATTTTTAGTTGGGAGG + Intronic
1147396586 17:40148023-40148045 TTTTCTTATTATAACTTTATGGG + Intronic
1149475433 17:56957095-56957117 GTTTTTTATTTTTAGTAGAGAGG - Intronic
1151132959 17:71917048-71917070 GTGTCCAATTTTAAGTTCATTGG + Intergenic
1151948425 17:77331902-77331924 TTTTCCTATTTTTGGTTGATAGG + Intronic
1153358995 18:4172578-4172600 CTATTTTATTTTAATTTGATGGG - Intronic
1153531738 18:6053785-6053807 TGTTGTTATTTTAAGTTGATGGG + Intronic
1154220676 18:12450911-12450933 GTTTCTGACTATAAGTTGAAAGG + Intronic
1155049473 18:22134000-22134022 GTTTAAGATTTTAAGTTGTTTGG - Intergenic
1155252650 18:23966847-23966869 GTTTATCATTTTAGGTAGATGGG + Intergenic
1155414948 18:25587809-25587831 GTTTCTTGTTTTAAGAAGCTTGG + Intergenic
1155458809 18:26052790-26052812 GTTTGTCATATTGAGTTGATTGG + Exonic
1155657236 18:28206478-28206500 TTATCTTATTTTAAGTTCGTAGG + Intergenic
1156377767 18:36530212-36530234 GCTTCTTATTTTAAGCTGAGTGG - Intronic
1156936004 18:42708169-42708191 GTTTTTGATTTTAAGTAGAATGG + Intergenic
1158044056 18:53133760-53133782 GTTTCCTATTTGAAGATGTTGGG - Intronic
1158258660 18:55584448-55584470 TTTTCTTATTTGAAATTCATTGG + Intronic
1158362004 18:56685310-56685332 GTTTGTTATCTAAAGTTCATTGG + Intronic
1159362161 18:67419191-67419213 GTTACTAAAATTAAGTTGATTGG - Intergenic
1160132813 18:76244728-76244750 GTTTCTTGTTTTGATGTGATGGG + Intergenic
1162626783 19:11890768-11890790 GATTTTTATTTTTAGTTTATAGG + Intronic
1163410376 19:17150236-17150258 TTTTGTTATTTTTAGTAGATGGG - Intronic
1165005206 19:32799533-32799555 TTTTCTTATTTTCTGTTGGTAGG + Intronic
1166059793 19:40319098-40319120 TTTTCATATTTTTAGTAGATGGG - Intergenic
1166687747 19:44806181-44806203 TTTTTTTATTTTAAGTAGAGAGG + Intergenic
1167065682 19:47184162-47184184 TTGTATTATTTTAAATTGATGGG + Intronic
925029547 2:638838-638860 GTTTTTTTTTTTAAGTAGAAGGG + Intergenic
925326370 2:3024956-3024978 ATTTCATATATTAAGTAGATGGG - Intergenic
925833664 2:7921540-7921562 GTTTCTTCTTATATGTTCATTGG - Intergenic
926493577 2:13555982-13556004 TTTATTTATTTTAAGTTGACAGG - Intergenic
929357607 2:41044792-41044814 ATTTTTTATTTTAAGTTTAGGGG - Intergenic
929404016 2:41620264-41620286 ATTTCTTACTTTAAGTGGTTGGG + Intergenic
929708882 2:44245968-44245990 TTTGATTATTTTAGGTTGATAGG + Intergenic
930291827 2:49503849-49503871 GACTCTTCTTTTAATTTGATGGG + Intergenic
930319281 2:49833846-49833868 GCTTTTTATTTTAAGTTCATTGG - Intergenic
930648028 2:53933005-53933027 GTTTGTTATCCTAAGTTGACAGG - Intronic
931075578 2:58707789-58707811 CTTTTTTATTTTAATTTGACAGG + Intergenic
931531952 2:63225290-63225312 GTTTCTTTTTATATGTTTATTGG - Intronic
931647226 2:64435458-64435480 GTTGATTTTTTTAAGATGATAGG + Intergenic
931701834 2:64915419-64915441 GTTTGATATTTTAAGCTGCTGGG + Intergenic
931806687 2:65814150-65814172 GTTTTGCATTTTAAGCTGATGGG + Intergenic
931811735 2:65860904-65860926 GTTTTTGATTTTAAGTTCTTTGG + Intergenic
932060489 2:68493507-68493529 GTTTCTTATTTTTATTTCATTGG - Intronic
932464123 2:71902989-71903011 GTTTGTTATTTTTAGTGTATAGG + Intergenic
933372918 2:81440255-81440277 ATTTTTTATTTTAAGTTCACGGG - Intergenic
933860519 2:86462201-86462223 GTTTTTTTTTTTAACTTGAGCGG + Intronic
935558279 2:104534524-104534546 TTTTCTAATTTTATTTTGATGGG - Intergenic
936660636 2:114539393-114539415 GTCTTTTATCTTAAGATGATAGG - Intronic
936810973 2:116401554-116401576 GTTTCTTCTTTTCAATTGTTTGG - Intergenic
936815388 2:116454791-116454813 TTTTCTTATTTTCATCTGATTGG + Intergenic
937477545 2:122228680-122228702 GTTTGGTAATTTAAGTTGATGGG - Intergenic
937783400 2:125866563-125866585 GTTCCTTATTTTAATTCCATTGG + Intergenic
938911712 2:135891365-135891387 TATTTTTATTTTAAGGTGATAGG - Intergenic
939228725 2:139398481-139398503 GTCCCTTATTTTCAGTTGTTTGG - Intergenic
939255381 2:139737342-139737364 GTTTTTTTTTTTAAGTTGTATGG - Intergenic
939364306 2:141212723-141212745 GTTTGGTATTTTCAGTTGAGGGG - Intronic
940192460 2:151056342-151056364 GTTTCTTATTTTCAATAGTTGGG - Intergenic
941411783 2:165166474-165166496 TTTTCATATTTTAAGTATATTGG + Intronic
941552119 2:166929473-166929495 GTTTCTCCTTTTAGGTTGACAGG + Intronic
942009815 2:171750035-171750057 ATTTCTTATTTTTCGTTGTTTGG + Intergenic
943046790 2:182869564-182869586 GTTCCATATTTTTGGTTGATGGG + Intergenic
943086168 2:183314037-183314059 ATTTCTTATTTTAATTTCTTTGG + Intergenic
943419309 2:187650533-187650555 GTTTTTTATTTTAATTCAATGGG + Intergenic
944165166 2:196710866-196710888 GTTTTTTTTTTTAAGTTCAGTGG + Intronic
944167294 2:196736507-196736529 TTCTCTTATTTTAAGTTCAGGGG + Intronic
944177094 2:196842825-196842847 GTTTCTTTTTTTAATATTATAGG - Exonic
944334642 2:198517449-198517471 TTTTTTTTTTTTTAGTTGATAGG + Intronic
944513381 2:200486279-200486301 ATTTCATATTTCAATTTGATTGG - Intergenic
945510545 2:210696618-210696640 GTTGCTTGTTTTTAGTTTATTGG + Intergenic
945729156 2:213511842-213511864 GTATTTTATTTTTAGTAGATTGG - Intronic
945740869 2:213659322-213659344 TTTTTTTTTTTTAAGATGATTGG - Intronic
946258548 2:218465725-218465747 GTTTTATATTTTTAGTAGATGGG + Intronic
947150562 2:227110849-227110871 ATTTCGTATTTTTAGTAGATAGG + Intronic
947271388 2:228339809-228339831 GTTGCTTGCTTTAAGTTGAATGG + Intergenic
1168987063 20:2058465-2058487 AATTCTTATTTTAAGTTCAGGGG - Intergenic
1169536633 20:6550929-6550951 TTTTCTTTTTTTAAGCAGATTGG - Intergenic
1169552101 20:6711728-6711750 TTTTCTTATTGTCAGTTAATTGG - Intergenic
1169806268 20:9562649-9562671 GTTGCTTATTTTAAATCAATGGG + Intronic
1169806938 20:9569108-9569130 GTTTGTTATTTAAAGTTTAGGGG + Intronic
1170073563 20:12395070-12395092 GTTTGTTGTTTTAAGCTGCTAGG + Intergenic
1170183382 20:13559114-13559136 GTTTTTTATTTTTATTTTATAGG - Exonic
1170293238 20:14794519-14794541 ATCTCTTATTTTAAATTTATTGG - Intronic
1170336008 20:15271005-15271027 GTTTCTTCTTTTCAGTAAATTGG + Intronic
1170894917 20:20404216-20404238 GTTACTTATTTCAAATGGATGGG + Intronic
1174831565 20:53817893-53817915 TTTTTTTTTTTTTAGTTGATAGG + Intergenic
1175512430 20:59539980-59540002 GTTTCTTATTTTATTTAGTTGGG + Intergenic
1176726225 21:10435819-10435841 TTTTCTTGTTTTAACATGATAGG - Intergenic
1177491906 21:21837133-21837155 GTTAATTAGGTTAAGTTGATTGG + Intergenic
1177898436 21:26883446-26883468 GTTTCTTAATTGAAGCTGAATGG - Intergenic
1178763375 21:35425426-35425448 ATACCTTATTTTAAATTGATTGG - Intronic
1179051110 21:37889315-37889337 GTTTCTTATCATAAAATGATAGG - Intronic
1180288148 22:10771292-10771314 TTTTCTTGTTTTAACATGATAGG + Intergenic
1180754538 22:18151881-18151903 ATTTTTTATTTTTAGTAGATGGG - Intronic
1181492959 22:23272256-23272278 ACTTCTTATTTTCAGTTGTTAGG + Intronic
1182923564 22:34102363-34102385 GTTTAATATTTTCAGTTGACTGG + Intergenic
1183019112 22:35013010-35013032 GTTTCGTATTTTTAGTAGAGAGG - Intergenic
1183149375 22:36026093-36026115 TTTTCTTATTTTTAGTAGAGAGG - Intronic
1183552281 22:38496826-38496848 GTTTCATAATTTAATTTGAATGG - Intronic
1184080890 22:42219408-42219430 GATGCTTTTTTTAAGATGATGGG - Intronic
949156601 3:834340-834362 AATTCTTATTTTAAGTTCAGGGG - Intergenic
949228252 3:1719703-1719725 GTTTCTTATTTAAAGTTCTAAGG - Intergenic
949971812 3:9413693-9413715 ATTTATTTTTTTAAGTTAATTGG + Intronic
950306534 3:11919100-11919122 GTTTGTTTTTTTAAGTTGGGAGG - Intergenic
951613080 3:24513168-24513190 ATTTCAGATGTTAAGTTGATTGG - Intergenic
952007626 3:28860356-28860378 GTTCCTTATCTTATGGTGATTGG + Intergenic
952292239 3:32028703-32028725 GTTTTATATTTTAACTTGTTTGG + Intronic
952616910 3:35284388-35284410 AATTCTTATTTTAAGTTCAGCGG - Intergenic
952950428 3:38519936-38519958 GTTTCTTTCTTTCACTTGATCGG + Intronic
953507820 3:43503617-43503639 GTTTTTTATGTTATGGTGATAGG - Intronic
955665218 3:61343056-61343078 GTTTGTTGTTTTAAGCTGCTAGG + Intergenic
957011385 3:75009620-75009642 ATTTATTTTTTTAAGTTGAAAGG + Intergenic
957181628 3:76886387-76886409 GTTTTTTTTTTTAAGTTAAAAGG - Intronic
957243079 3:77684239-77684261 AATTCTTATTTTACATTGATGGG - Intergenic
957563808 3:81859611-81859633 GTTTTCCATTTTATGTTGATTGG + Intergenic
957833940 3:85561298-85561320 TATTCTTATTTAAAGTTTATTGG - Intronic
957992442 3:87644422-87644444 GTTTCTTCTTCCAAGTTGTTAGG + Intergenic
958452501 3:94291411-94291433 TTTTCGTATTTTAAGATTATAGG - Intergenic
958984904 3:100768972-100768994 GCTTCTTTCTTTGAGTTGATGGG - Intronic
959281948 3:104353486-104353508 CATTTTTATTTTCAGTTGATTGG - Intergenic
959385118 3:105694628-105694650 GTTTCTTATTTTAAGTTGATAGG - Intronic
959536542 3:107492821-107492843 GTTTCTTATTTTAAAAATATAGG + Intergenic
959661595 3:108874652-108874674 ATTTCTAATTTTCAGTTAATTGG + Intergenic
959908906 3:111740889-111740911 TTTTTTTTTTTTAACTTGATGGG - Intronic
961409226 3:126706194-126706216 GTGCCTTCTTTCAAGTTGATTGG + Intronic
961916042 3:130376215-130376237 GCTTGTTATTTTATTTTGATAGG + Exonic
962617307 3:137139632-137139654 GTTTTTTTTTTTAAGTTGAGAGG - Intergenic
963609395 3:147446540-147446562 GTTTCCAGTTTTAAGTTGTTAGG + Intronic
963956943 3:151264546-151264568 TTTTCTCATTTATAGTTGATGGG + Intronic
964220316 3:154336894-154336916 GTTTTTTTTTTTAACTTGAGTGG - Intergenic
964780957 3:160337450-160337472 TTTTCGTATTTTTAGTAGATGGG - Intronic
965097606 3:164254129-164254151 GTATTTTATTTTTAGTTTATAGG - Intergenic
965272308 3:166634211-166634233 ATTTTCTATTCTAAGTTGATTGG + Intergenic
965280493 3:166745853-166745875 GTTTATTTTTTTAAGGTAATTGG - Intergenic
966682554 3:182658220-182658242 GTTTCTTGTTTTCGGTAGATCGG - Intergenic
968215811 3:196889183-196889205 GTTTTTTTTTTTAATTTGCTAGG - Intronic
968226643 3:196976579-196976601 GTTTCTCATTTTAAGTTTTGTGG - Intergenic
969999210 4:11346976-11346998 GTTTCTTATCCAAAGTTGTTCGG + Intergenic
970633979 4:17986679-17986701 GATTCTTAGTTTCTGTTGATTGG + Intronic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
971678695 4:29668551-29668573 GTTTCATATTTTAATCTGAGTGG + Intergenic
971919269 4:32915359-32915381 ATCTTTTATTTTAAGTTCATGGG - Intergenic
972553503 4:40157206-40157228 GTTTTTTTTTTTACGTTTATTGG + Exonic
972755887 4:42045575-42045597 TTTTTTTTTTTTTAGTTGATAGG - Intronic
973752399 4:54034589-54034611 ATTTTTTATTTTTTGTTGATAGG + Intronic
973892365 4:55380104-55380126 GATTTTTTTTTTAAGTTTATAGG - Intergenic
974299416 4:60043972-60043994 GTTTATTATTTTAAAATGACTGG - Intergenic
975022681 4:69508837-69508859 GCTTTTTATTTTAAGTTCAGGGG - Intronic
975708897 4:77139278-77139300 GTTTCTTATTACCAGTTGAATGG - Intergenic
975896792 4:79102507-79102529 TTTTTTTTTTTTAAGTTGGTGGG + Intergenic
976033084 4:80781700-80781722 GTTTCCTAGTTTAAGTAGATTGG + Intronic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
976286912 4:83379644-83379666 TTTTCTTATTTCATCTTGATTGG - Intergenic
976416537 4:84782781-84782803 GGTTATTATTTTAAATTGACTGG + Intronic
977026656 4:91827401-91827423 GTTTCTTCTTTTTAATTTATTGG + Intergenic
977060066 4:92247064-92247086 ATTTCTTATTGTAATGTGATTGG + Intergenic
977147432 4:93461880-93461902 GTCTCTTATGTTTAGTTTATTGG + Intronic
977541885 4:98328117-98328139 TTTTCTTATTTTATGTATATGGG + Intronic
977599115 4:98916831-98916853 GTTTCTTATCTCACGTTGGTGGG - Intronic
977700884 4:100021523-100021545 GTTTTTTATTTTATGTAGATCGG + Intergenic
978482469 4:109209879-109209901 TTTTTCTATTTTTAGTTGATGGG - Intronic
979417177 4:120457335-120457357 GTTACTGATTTTAAATTTATTGG + Intergenic
979590019 4:122467825-122467847 GATTCTTATTATAAGTAGAAAGG - Intergenic
980921035 4:139085760-139085782 GATGCTTACTTTAAATTGATTGG - Intronic
981230243 4:142344850-142344872 AATTCTTATTTTAAGTTCAGAGG - Intronic
981468988 4:145108051-145108073 GTTTCTTTTTCCAAGTTGCTTGG - Exonic
983466061 4:168092244-168092266 GTTTCCTATCTTAAATTGCTAGG - Intergenic
983916205 4:173294276-173294298 TTTTTTTTTTTTAAGTTGAAGGG + Intronic
984264761 4:177484776-177484798 GTTTGTTGTTTTAAGCTGCTAGG - Intergenic
984378064 4:178956995-178957017 TTTTCATATTTTTAGTAGATAGG + Intergenic
984780155 4:183518317-183518339 TTTACTTTTTTCAAGTTGATGGG - Intergenic
985522590 5:384591-384613 CTTTCATATTTTTAGTAGATGGG + Intronic
985752732 5:1690921-1690943 GTTTGTTATTTTAAATTTGTAGG + Intergenic
985907227 5:2849258-2849280 GTTTTATATTTTAAATTTATGGG - Intergenic
986583187 5:9286816-9286838 GTTTCTTATTCTCTGCTGATGGG - Intronic
986783476 5:11088454-11088476 GTTTCTTGTTCTAAGTTAATAGG + Intronic
987376745 5:17242633-17242655 GCTTCTTATTTTAATTTAAGGGG + Intronic
988149593 5:27360882-27360904 GTTGCTTATTTTAAGTTTTCAGG - Intergenic
988560915 5:32280269-32280291 GTTTTTGATTTAAAGCTGATAGG - Intronic
988824425 5:34920832-34920854 TTTTTTTTTTTTAAGTTGTTAGG + Intronic
988899490 5:35717441-35717463 ATTTATTATTTTAAGTGGCTTGG - Intronic
989291063 5:39766700-39766722 ATTTTTTATTTAAAGTTAATGGG + Intergenic
989509809 5:42272378-42272400 GTTTTTCATTTTAATTTGCTAGG - Intergenic
989814234 5:45716761-45716783 GCTTCTAATTTTATGTTGACTGG + Intergenic
989845841 5:46139835-46139857 CTTTCTTTTTTTAAGTAGTTTGG + Intergenic
989961200 5:50417555-50417577 ATTTCACATTTTAAGTTTATGGG - Intronic
990787294 5:59436313-59436335 ATTCCTTATTTTAAGTAGTTGGG - Intronic
992356426 5:75989147-75989169 CTTTTTTATTTTAAGTTCATGGG + Intergenic
993199274 5:84791664-84791686 GTTTCTTATTTTAACATTATTGG - Intergenic
993797619 5:92286821-92286843 CATTTTTATTTTAAGTTCATGGG - Intergenic
993815787 5:92543282-92543304 TTTTCTGATTTTAATTTGCTTGG + Intergenic
993983315 5:94568653-94568675 GTTTTTTATTTTGAGTTTGTTGG - Intronic
994279815 5:97888076-97888098 CTTTCTTGTTTTCACTTGATTGG - Intergenic
994363443 5:98882775-98882797 CTTGCTTATTTTAACTTGAAAGG - Intronic
994993385 5:107027750-107027772 GCTTCTTCTTTTTTGTTGATGGG - Intergenic
996153297 5:120066396-120066418 GTTTCTTATCTTAATATAATAGG - Intergenic
996160043 5:120149902-120149924 GTTTTTTTTTTTAAGTTCAGGGG - Intergenic
996687759 5:126302645-126302667 TTTAATTTTTTTAAGTTGATTGG + Intergenic
997731161 5:136177914-136177936 CTTTTTTTTTTTAAGTTGGTGGG - Exonic
997963008 5:138337078-138337100 ATTTCTTTTTTTTAATTGATTGG - Intronic
998759537 5:145417356-145417378 GTTCCTTCTTTTCAGTTGTTTGG - Intergenic
999254322 5:150201364-150201386 TTTTCTATTTTTAAATTGATAGG + Intronic
1000567787 5:162871910-162871932 ATTTCTTCTTTTGTGTTGATAGG - Intergenic
1000608245 5:163347504-163347526 TTTTCTTTTTTTAAGCTGAAAGG - Intergenic
1000785372 5:165536460-165536482 TTATCTTATTTTAAGCTAATGGG + Intergenic
1001090728 5:168738629-168738651 GTTGCTTTTTTTAAAGTGATGGG - Intronic
1001504623 5:172268170-172268192 GTTTTTTTTTTTAAGTAGAGTGG + Intronic
1002496314 5:179614337-179614359 TTTTTTTTTTTTAAGTTAATGGG - Exonic
1002919060 6:1553207-1553229 GTGTCTTATTTTAAAATGTTAGG + Intergenic
1003229769 6:4241520-4241542 TTTTCTTATTTTAAGTTTCAGGG + Intergenic
1003470422 6:6424844-6424866 GTTTCCTGTTTGAAGTTTATTGG - Intergenic
1004752390 6:18576130-18576152 GTTTTTTATTTTTAATTCATGGG - Intergenic
1005463420 6:26089968-26089990 GTTCTTTATTTTAATTTTATTGG + Intronic
1008049525 6:46885927-46885949 GTTTGTTATTTTATGATGCTAGG + Intronic
1008761207 6:54852944-54852966 TTTTCTTTTTTTAAGCTCATTGG + Intronic
1010579015 6:77570951-77570973 GTTTGTTTTTTTAACTTGGTAGG - Intergenic
1010964494 6:82188304-82188326 CTTTCTTTTTTTTGGTTGATTGG + Intronic
1011732701 6:90282162-90282184 GTTTTTTCTTTTAAGTTCAGGGG + Intronic
1011814688 6:91174984-91175006 GTTACTTATTTTAATTGCATGGG + Intergenic
1012068943 6:94587029-94587051 GTTTCTTAATTTAAAATAATTGG - Intergenic
1014257972 6:119183292-119183314 GCATCTGTTTTTAAGTTGATCGG - Intronic
1014647513 6:123992553-123992575 ATTTGTTATTCTAATTTGATTGG - Intronic
1014807111 6:125842035-125842057 GTTTATTTTTTAAAGTTGAGAGG + Intronic
1015428833 6:133105797-133105819 GTTTTTTATTTTTAATTGTTTGG + Intergenic
1016223252 6:141702690-141702712 GTTACTTTTTTTAATTAGATGGG + Intergenic
1016248428 6:142015506-142015528 GTATTTCATTTTAAATTGATGGG - Intergenic
1016836825 6:148485854-148485876 ATTTCTGTTTTTAAGTTGCTTGG + Intronic
1017052268 6:150404376-150404398 GTTTGTGATTTGAAGTTGAAAGG + Exonic
1018014799 6:159702464-159702486 TTTTTGTATTTTAAGTAGATGGG + Intronic
1018224461 6:161614930-161614952 GTTTCTTATTTTTAGTTTTCTGG + Intronic
1018287056 6:162252056-162252078 TTTTCTTACTTTAAACTGATAGG - Intronic
1018296993 6:162358888-162358910 TTTTTTTATTTTTAGTAGATAGG - Intronic
1018461321 6:164002015-164002037 GTTACTTATTTTAAAATGCTTGG + Intergenic
1019038333 6:169082095-169082117 GTGTCTTATTTTTGGTTGGTTGG - Intergenic
1019065189 6:169290469-169290491 TTTTGTTTTTTTAAGTTGAGGGG - Intergenic
1020873426 7:13663614-13663636 GTTTCTTATTTTACCATGACAGG + Intergenic
1021325783 7:19266026-19266048 GTATCTAATTTTAGGATGATGGG + Intergenic
1021559426 7:21955145-21955167 GTTTCTTATTTTATCTTCTTTGG + Intergenic
1021727530 7:23564013-23564035 GTTTCTTTTTCCAAGTTGCTTGG + Intergenic
1022987472 7:35671762-35671784 AGTTTTTATTTTAAGTTGTTTGG + Intronic
1023425995 7:40036693-40036715 GTTTTTTTTTTTAAGTTGACAGG - Intronic
1023885645 7:44352628-44352650 ATTTCTAATTTTGAGATGATAGG + Intergenic
1024013378 7:45289940-45289962 TTTTTTTAATTTAAGTTGTTTGG - Intergenic
1024039419 7:45539790-45539812 GTTTCTCTTTTTAAGGTGTTAGG - Intergenic
1024156796 7:46634325-46634347 TTTTTTTATTTTAAATTGATTGG + Intergenic
1024740302 7:52346634-52346656 ATTTCATATGTTAATTTGATGGG + Intergenic
1024788711 7:52938012-52938034 ATTTCTTAAATTAAGTTTATTGG + Intergenic
1024859855 7:53825992-53826014 GTTTCTCCTTTTAATTTGTTTGG - Intergenic
1025621908 7:63180784-63180806 GATTTTTATTTTAATTTGGTGGG - Intergenic
1025820421 7:64957518-64957540 TTTTGTTATTTTTAGTAGATAGG + Intergenic
1026397693 7:69974095-69974117 TTTTCTTAATTTAAGTTATTGGG + Intronic
1027158846 7:75787695-75787717 ATTTTTTTTTTTAAGTTGAGAGG - Intronic
1027746124 7:82076463-82076485 GTATCATTTTTTAAGTTGAATGG - Intronic
1028911892 7:96216883-96216905 CTTTTTTATTTTAAGTTCAGGGG - Intronic
1030771500 7:113480944-113480966 GTTTGTTATTCTAAATTGAAAGG + Intergenic
1030951117 7:115791436-115791458 GTTCCTTATTTTATCTTGTTTGG - Intergenic
1031537454 7:122952857-122952879 TCTTCTTATTTTAATGTGATAGG + Intergenic
1031540288 7:122987394-122987416 GTTTCTTAATTTATGTTCTTTGG + Intergenic
1033396748 7:140981773-140981795 TTTGCTTTCTTTAAGTTGATTGG - Intergenic
1033873737 7:145788861-145788883 CCTTGTTATTTTAATTTGATTGG + Intergenic
1034603880 7:152292249-152292271 TTTTCTTGTTTTAACATGATAGG + Intronic
1034693493 7:153033382-153033404 GTTTTTTTTTTTAAGTTCAGGGG + Intergenic
1035752229 8:2003755-2003777 CTTTCATATTTTCAGTTGAAAGG + Exonic
1036418701 8:8575468-8575490 GTTTGTTATTTCAAGTTCCTAGG - Intergenic
1037083222 8:14813641-14813663 TATTATTATTTTAAGTTTATAGG - Intronic
1037185380 8:16056789-16056811 TTTTCCTATTTTAAGTAGTTAGG - Intergenic
1037240440 8:16771372-16771394 GTTTCTTATTTTTATTTTTTGGG - Intergenic
1037472878 8:19228257-19228279 TTTTCTTATTTTAAGTTCTAGGG + Intergenic
1038528670 8:28298545-28298567 TTTTTTTTTTTCAAGTTGATGGG + Intergenic
1038723334 8:30057742-30057764 ATTTATTATATTAAGCTGATTGG - Intergenic
1039671126 8:39600366-39600388 GATTTATATTTTAATTTGATTGG + Intronic
1041164812 8:55080750-55080772 CTTTCTTATTTTATTTGGATTGG - Intergenic
1041992248 8:64007192-64007214 GTCTATTATATTAATTTGATTGG - Intergenic
1042156589 8:65850882-65850904 TTTTTTTTTTTTAAGTTGAGAGG - Intergenic
1042274373 8:66987597-66987619 TGTTCTTATTTGAAGTTAATAGG + Intronic
1042884953 8:73538732-73538754 GTTTCTTGGTTTAAGTTTCTTGG - Intronic
1043111283 8:76186107-76186129 ATTTCTTTTTTCAAGTTAATTGG - Intergenic
1043524435 8:81081202-81081224 GTTTTTTTTTTTAATTTGTTTGG - Intronic
1043560028 8:81482122-81482144 GTTTCTTGTTTTTAGATGATAGG - Intronic
1043887680 8:85620894-85620916 TTTTCATATTTTAATTTTATTGG - Intergenic
1044025621 8:87168279-87168301 GTTTTTTATTTTTATTTTATGGG + Intronic
1044126043 8:88458592-88458614 GTTTCTTATTTTCCTTGGATTGG - Intergenic
1044649994 8:94484073-94484095 TTTTATTATTTTAAATTCATAGG - Intergenic
1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG + Intronic
1045894950 8:107203653-107203675 ATTTATTATTTTTAATTGATTGG + Intergenic
1046241637 8:111503072-111503094 TTTTTTTTTTTTAATTTGATAGG - Intergenic
1047345479 8:124023823-124023845 GTTTCTTTTTTTAATCTAATGGG + Intronic
1050250306 9:3736425-3736447 GCTTCTTATATTTAGATGATTGG + Intergenic
1050488435 9:6161231-6161253 GTTTCTTCTTATAAGTTAATGGG - Intergenic
1050996572 9:12227336-12227358 TTTTCTTTATTTAAGTTAATGGG + Intergenic
1051479754 9:17546585-17546607 GTCCCTCCTTTTAAGTTGATTGG - Intergenic
1052359896 9:27542353-27542375 GTTTGTCATTGTAAATTGATAGG - Intergenic
1052401596 9:28007175-28007197 GTTTCTTATATTAAGGAGTTGGG - Intronic
1052471559 9:28902959-28902981 GTTTCTTTTTTCAAGTTCCTTGG - Intergenic
1052908380 9:33857485-33857507 GTTTTATATTTTTAGTTGATGGG + Intronic
1053289469 9:36870607-36870629 GTTTCCTATTTTAATTTTAGAGG + Intronic
1055178399 9:73350611-73350633 GTTTCTTATCATATCTTGATTGG + Intergenic
1055289191 9:74765006-74765028 TTTTCTTTTTTTAATTTGCTAGG - Intronic
1055326244 9:75133072-75133094 GTTTCTAATGATAAGTTAATGGG - Intronic
1057867701 9:98694171-98694193 ATTTCATATTTTAAGCTGGTGGG + Intronic
1058641565 9:107091306-107091328 TTTTCTTGTTTGAAGGTGATAGG - Intergenic
1059010217 9:110449856-110449878 GTTGCCTATTTTAAAATGATAGG + Intronic
1059359230 9:113727056-113727078 GTTTCTTCTTTTAACTTTAAAGG - Intergenic
1059590849 9:115659918-115659940 GGTTCTTATTTTATGGTGAAGGG - Intergenic
1059765232 9:117377809-117377831 GTTTTTTACTTTAAAATGATTGG - Intronic
1062090549 9:134676276-134676298 TTTACTTATTTTAAGATGAAAGG + Intronic
1187035383 X:15533197-15533219 AGCTTTTATTTTAAGTTGATTGG + Intronic
1188226913 X:27611269-27611291 GTTTCTTCTTTTATTTTGAAAGG - Intronic
1188369637 X:29352817-29352839 GTTCCTTATTTTCAGTGGAAAGG + Intronic
1188572060 X:31599934-31599956 ATTTCTTATTTTTTTTTGATAGG + Intronic
1189031550 X:37457162-37457184 ATTTCTCATTTTAAGATGCTTGG + Exonic
1189039922 X:37531497-37531519 GTTTCTGATTTTAAGGCCATGGG + Intronic
1189063551 X:37781742-37781764 CTTTCTCATTTTAAGTGGAGTGG + Intronic
1189207172 X:39251658-39251680 TTTTTTTTTTTTAAGGTGATTGG + Intergenic
1190934388 X:54983166-54983188 ATTTTTTATTTTAAGTTCAGAGG + Intronic
1191918991 X:66233914-66233936 ATTTTTTATTTTAAGTTCAGGGG + Intronic
1192507229 X:71695359-71695381 GTTTTTAATTTTAAGTTTAATGG - Intergenic
1192519468 X:71786193-71786215 GTTTTTAATTTTAAGTTTAATGG + Intergenic
1192981391 X:76347681-76347703 AATTTTTATTTTAAGTTCATGGG + Intergenic
1193497786 X:82236041-82236063 GATTCTTATTTTCCTTTGATTGG + Intergenic
1193554769 X:82940130-82940152 TTTTCTTCTTTTAAGTTCAGGGG + Intergenic
1194030522 X:88807714-88807736 GACTTTTATTTTAAGTTGAGGGG - Intergenic
1194093488 X:89605471-89605493 GCTTCTTATTTTAAGTCCAAAGG - Intergenic
1194369072 X:93048083-93048105 ATTTCTTATTTTAAGTTTAGGGG - Intergenic
1194740621 X:97569081-97569103 GTATTTTAATTTAGGTTGATTGG - Intronic
1194862488 X:99018664-99018686 GCTTTTTATTTTTATTTGATTGG + Intergenic
1195768805 X:108326497-108326519 TTTTCTTTTTCTAAGTTGTTTGG - Intronic
1197445587 X:126549683-126549705 ATTTATTATATTAAGTTGTTCGG + Exonic
1197796290 X:130302026-130302048 AGTTTTTATTTTAAGTTCATGGG - Intergenic
1197894254 X:131294027-131294049 CTTTCTTATTTCAAGATGAGAGG - Intronic
1198551615 X:137751253-137751275 GTTTTTTCTTTCAAGTTTATGGG + Intergenic
1198867212 X:141136844-141136866 ATTTTTTATTTTCATTTGATAGG - Intergenic
1198914253 X:141649972-141649994 GTTTCTTCTTTTTATTGGATTGG + Intronic
1199907400 X:152247399-152247421 ATTTGTTATTTAAAATTGATAGG + Intronic
1199975213 X:152891016-152891038 TTTTTTTTTTTTATGTTGATGGG + Intergenic
1200364877 X:155651699-155651721 ATTTTTTATTTTAATTTTATGGG + Intronic
1200446117 Y:3261574-3261596 GCTTCTTATTTTAAGTCCAAAGG - Intergenic
1200677277 Y:6164417-6164439 AATTCTTATTTTAAGTTTAGGGG - Intergenic
1201739624 Y:17310019-17310041 TTTTCTTATTTTAAAATTATGGG - Intergenic