ID: 959385525

View in Genome Browser
Species Human (GRCh38)
Location 3:105701028-105701050
Sequence CTCCATCAGCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 1, 2: 11, 3: 42, 4: 514}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959385525 Original CRISPR CTCCATCAGCAGAGGGAAGA TGG Intronic
900325949 1:2108736-2108758 CTCCATCTGCCCAGGCAAGACGG - Intronic
900640280 1:3685129-3685151 CTCCCCCTGCAGAGGGCAGAAGG + Intronic
902398864 1:16146612-16146634 CTCGCTCAGCAGAGGGGAGCTGG + Intronic
902604258 1:17560087-17560109 GGCCATCAGCTGGGGGAAGAGGG - Intronic
902703241 1:18187326-18187348 CTTTATCAGCAGAGTGAAAACGG - Intronic
902723802 1:18322357-18322379 CTCCACCAGAAGAGGGAAGACGG - Intronic
903001845 1:20271989-20272011 TCCCATCAGCAAAGGGCAGATGG + Intergenic
903161288 1:21490990-21491012 CTCCACCAGCAGAGGGCAGAGGG - Intergenic
904010480 1:27387037-27387059 CTAAATCAGCAAAGGGGAGAGGG - Intergenic
904757402 1:32775715-32775737 CTCCAGCTGCCAAGGGAAGAAGG + Exonic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
906044439 1:42817120-42817142 TTCCTCCAGGAGAGGGAAGAGGG - Exonic
906316029 1:44786875-44786897 TTCCTTCAGCAGAGGGAAAGTGG + Intronic
906732164 1:48092112-48092134 CGCCAGCAACAGAGGGAAGCAGG + Intergenic
907129384 1:52081948-52081970 CTCCATGGACAGTGGGAAGAGGG - Intronic
908632276 1:66122599-66122621 CTCAATCAGCAAATAGAAGAAGG - Intronic
908953291 1:69588943-69588965 CACCAACTGCATAGGGAAGAAGG - Intronic
909239156 1:73190772-73190794 CTTTATCAGCAGTGGGAAAATGG - Intergenic
911164721 1:94714365-94714387 CTCCCTCAGCAGAGGGAGACTGG - Intergenic
913195792 1:116454959-116454981 CTCATTCAGCACAGGGAGGAAGG - Intergenic
914349807 1:146831276-146831298 CTCCAGGAGGAGAGGAAAGAGGG + Intergenic
915035733 1:152922465-152922487 CACCTCCTGCAGAGGGAAGATGG - Intergenic
915366357 1:155318947-155318969 CCCCATCAGCAGAGCAGAGAGGG - Intronic
915585845 1:156843533-156843555 CAACATCAGAAGAAGGAAGAAGG + Intronic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
915775506 1:158480620-158480642 TTCCCTCAGCTGAGGGCAGACGG + Exonic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916184771 1:162120442-162120464 CTTTATCAGCAGAGTGAAAATGG - Intronic
916683185 1:167122458-167122480 TTCCATCAGCAGTGGCAAGTGGG + Intronic
917371849 1:174301480-174301502 CTCTGCCAGCAGAGGGCAGAGGG + Intronic
917917567 1:179718871-179718893 CTCCAAAAGGGGAGGGAAGAGGG - Intergenic
919582301 1:199391795-199391817 CCCCATCAGCAAAGGCTAGACGG + Intergenic
919853219 1:201687855-201687877 CTCCCTCAGATGGGGGAAGATGG + Intronic
920197840 1:204241411-204241433 CCCCATCAGCAGTGGTAAGAAGG - Exonic
920255402 1:204651069-204651091 CTCCAGCAGCAGGCAGAAGAGGG + Intronic
920627119 1:207613045-207613067 CTCCCACAGCAGAGGGCGGAGGG + Intronic
921332099 1:214049776-214049798 CTCCAACAGCCGAGGCAAGCTGG - Intergenic
921386597 1:214576339-214576361 CTTCATCAGCAGTGTGAAAATGG + Intergenic
921398483 1:214694176-214694198 CTCCTTCAGAATTGGGAAGAAGG + Intergenic
921743689 1:218713969-218713991 GGCCATCAGCAGACGGGAGAGGG - Intergenic
921862715 1:220056012-220056034 CTCCATTCGTAGAGGGAAGCAGG + Intergenic
922715640 1:227869752-227869774 CTCCATCAGCAAAGGGAAGTGGG + Intergenic
923413906 1:233735755-233735777 CTCCATCAGAAGAGGGGAAGGGG + Intergenic
924498812 1:244616540-244616562 CTGCATCATCAGATGGCAGAAGG + Intronic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1064098156 10:12439759-12439781 CTTCATCAGCAGCGTGAAAACGG - Intronic
1065785781 10:29213223-29213245 CCCAATCAGCAGTGGGAAGTGGG - Intergenic
1066600036 10:37094393-37094415 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1067272464 10:44804231-44804253 CTTCACCAGCAGTGGGGAGAGGG + Intergenic
1067285017 10:44901649-44901671 CTTCATCAGCAGTGTGAAAATGG - Intergenic
1067419387 10:46133541-46133563 CTCCCTCAAGAGTGGGAAGAAGG + Intergenic
1067504738 10:46840138-46840160 CTCCCTCAAGAGTGGGAAGAAGG + Intergenic
1068049185 10:51927445-51927467 CTTTATCAGCAGAGTGAAAATGG + Intronic
1068681540 10:59825477-59825499 CTTCATCAGCAGCGTGAAAAAGG + Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1071018795 10:81028564-81028586 CTCCATCAGCAGCATGAAAATGG - Intergenic
1071159192 10:82726647-82726669 CTTTATCAGCAGAGTGAAAATGG + Intronic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1072551030 10:96477878-96477900 CAACATCAGCAGAGAGGAGATGG - Intronic
1072596376 10:96876204-96876226 CTCCATCATTAGAGGCAAAAAGG - Intronic
1072963563 10:99952249-99952271 CTTCATCAGCAGTGTGAAAATGG + Intronic
1073942283 10:108712707-108712729 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1074114283 10:110443952-110443974 CTCCAGCTTCAGAGGGAAAATGG - Intergenic
1074237836 10:111603819-111603841 CTTCATCAGCAGTGTGAAAACGG + Intergenic
1075499227 10:122956912-122956934 CTTTATCAGCAGCGTGAAGATGG + Intronic
1075549268 10:123380041-123380063 CTCCATCACAGGAGGAAAGAAGG - Intergenic
1075634480 10:124021001-124021023 CTCCCTCAGCAGGAGGATGAGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076168529 10:128301627-128301649 CTTCATCAGCAGTGTGAAAATGG - Intergenic
1076223650 10:128756108-128756130 CTCCAGCACCAGAGGAAGGAAGG + Intergenic
1076242176 10:128916828-128916850 CTCCACTGGCAGAGGGAAAAGGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076429895 10:130394486-130394508 TTCCACCAGCAAAGGGAAGAAGG + Intergenic
1076841806 10:133049588-133049610 CACCATCAGTCAAGGGAAGAAGG - Intergenic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1077747193 11:4919756-4919778 CTCCATCACCAAGGGGAGGAAGG + Intronic
1078045637 11:7912121-7912143 CTCCATCAAGAAAGGCAAGAGGG + Intergenic
1078841090 11:15076011-15076033 CTCCATTAGGAGAGGTGAGAGGG - Intronic
1079427384 11:20356563-20356585 AGCCATCAGAAGTGGGAAGAGGG + Intergenic
1079657068 11:22997499-22997521 TTCCATTAGCAGAGGGTAGCTGG - Intergenic
1079657687 11:23002902-23002924 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1079879927 11:25914051-25914073 CTTCAACAGAAGAGGTAAGATGG - Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1081775285 11:45671969-45671991 CTCCTCCCGCAGAGGGAGGAGGG - Intergenic
1083134288 11:60657080-60657102 CTCCATGAGGGGAGGGATGAGGG - Intergenic
1083698451 11:64457949-64457971 GTCCATCAGCAGCTGCAAGAGGG + Intergenic
1083744940 11:64730166-64730188 CTGCATCAGCAGGGAGGAGATGG - Exonic
1084095679 11:66909591-66909613 CTCCATCAGCACTGGGGAGCCGG + Intronic
1084529102 11:69716737-69716759 CTCCTTCAGTAGAGGGGAGAAGG + Intergenic
1084664578 11:70569532-70569554 CGGCACCAGCAGAGGTAAGATGG - Intronic
1084783953 11:71430774-71430796 CTCATTCAGTAGAGGGGAGACGG - Intronic
1085027265 11:73243512-73243534 ATCCAGAAGCAGAGGTAAGATGG + Intergenic
1086154431 11:83649874-83649896 CTCCATTAGCATAGGTATGAAGG + Intronic
1086306818 11:85488531-85488553 CTTCATCAGCAGTGTGAAAACGG + Intronic
1086449091 11:86898704-86898726 CTCCATCAGCAGAGGGTGATGGG + Intronic
1087091173 11:94274624-94274646 CTCCAGCAGCAGAAGGAAACAGG - Intergenic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1088022620 11:105138088-105138110 CTCCCTCCACAGAGAGAAGATGG - Exonic
1088816159 11:113422473-113422495 CTCCTTTGGAAGAGGGAAGAAGG + Intronic
1088869454 11:113878598-113878620 CTTCATCAGCAGCGTGAAAACGG - Intergenic
1088899797 11:114106773-114106795 TTCCATCAGAAAAGAGAAGATGG - Intronic
1089059818 11:115617280-115617302 CTCCAGCTGCAGACAGAAGAAGG - Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1089970054 11:122686058-122686080 TTCCATGAGCAGAGGGAGAAGGG - Intronic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1090601286 11:128374767-128374789 CTTCATCAGCAGTGTGAAAACGG - Intergenic
1090645629 11:128764842-128764864 CTCCCTGAGCAGTGGGAGGAGGG + Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1093756927 12:22863061-22863083 CTCCAACAGAAGAGGGAGGCTGG + Intergenic
1093863244 12:24193981-24194003 ATCAATCAGTAGAGGGATGAGGG - Intergenic
1096194656 12:49642221-49642243 CTCCAGCAGCTGAGGAAAGAAGG - Exonic
1096524752 12:52203806-52203828 CTCCATTCGCAGAGGTGAGACGG - Intergenic
1097102952 12:56602101-56602123 CTCCATCTTCATAGAGAAGAGGG + Exonic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1098005417 12:65992132-65992154 CTCCATCAGACTATGGAAGAAGG + Intergenic
1099503539 12:83445435-83445457 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1099752345 12:86791935-86791957 CCTCAGCAGCAGAGGGGAGACGG + Intronic
1100179789 12:92072954-92072976 CTTCATCAGCAGTGTGAAAACGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1102758928 12:115368095-115368117 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1103016527 12:117498931-117498953 CTTCATCAGCAGTGTGAAAATGG + Intronic
1103881279 12:124167735-124167757 CTCTATCAGCAGTGTGAAAACGG - Intronic
1103920986 12:124399113-124399135 TTCCAGCAGAAGAGGGGAGACGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104128915 12:125873900-125873922 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1104301528 12:127569318-127569340 CTCCTTCAGCACAGGGGTGAGGG + Intergenic
1104338156 12:127920259-127920281 TTCCATAAGGAGAGAGAAGAAGG + Intergenic
1104381679 12:128312996-128313018 TTCCATGAGGAGAGGGAGGATGG - Intronic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1105977270 13:25482937-25482959 CTTCATCAGCAGCGTGAAAACGG + Intronic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108732338 13:53247878-53247900 CTTCATCAGCAGCGTGAAAATGG + Intergenic
1109199305 13:59412842-59412864 ATCCATCATCTGAGGGATGATGG - Intergenic
1109406190 13:61903334-61903356 CTCCACTGGCAGAGGGCAGAGGG - Intergenic
1110084616 13:71363038-71363060 CTCCATCATAACATGGAAGAAGG + Intergenic
1110591813 13:77271805-77271827 CTCTATCAGCAGCGTGAAAACGG + Intronic
1111015433 13:82373849-82373871 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1111825466 13:93262264-93262286 TCCCCTCAGCAGAGGAAAGAAGG + Intronic
1112145908 13:96700109-96700131 CTTCATCAGCAGTGTGAAAATGG - Intronic
1112190431 13:97172047-97172069 CTTTATCAGCAGAGTGAAAACGG + Intergenic
1112756962 13:102646691-102646713 CACCATCACCAGAAGGCAGATGG - Intronic
1113151041 13:107263767-107263789 CTTCATCAGCAGTGTGAAAATGG + Intronic
1113345625 13:109475238-109475260 ATTCCTCAGCATAGGGAAGATGG + Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1113626851 13:111854113-111854135 TTCCATTAGCAGAGAGCAGATGG + Intergenic
1113675690 13:112205535-112205557 GTGCACCCGCAGAGGGAAGAGGG + Intergenic
1114216556 14:20661601-20661623 TTCCATCAGCAGTGGGAAGCAGG + Intergenic
1114989916 14:28273550-28273572 CTTCATCAGCAGTGTGAAAATGG - Intergenic
1115067753 14:29285568-29285590 CTCCATCAACAAATGGGAGAAGG + Intergenic
1115116055 14:29881445-29881467 CTCTATCAGCAGCGTGAAAATGG + Intronic
1117738956 14:58796035-58796057 ATCCATCAGAAGGGGAAAGAAGG - Intergenic
1118456375 14:65948668-65948690 CTCTATCCGCAGAGGGCAGAGGG + Intergenic
1119137257 14:72232304-72232326 GTCCTCCAGGAGAGGGAAGATGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1120375883 14:83706686-83706708 CTGCATCAACAGATGGCAGACGG - Intergenic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1122138120 14:99646112-99646134 CTCCACCCTCAGAGGGAAGATGG - Intronic
1122572642 14:102717655-102717677 CTCACTCAGCAGAGGGAGAAAGG - Intronic
1124173097 15:27395055-27395077 CTCCAGAAGGAGAGGGCAGAGGG - Intronic
1125233282 15:37482982-37483004 CTTCATCAGCAGTGTGAAAATGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1125726874 15:41872615-41872637 CTCCATCAGTAATGGGTAGATGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128042690 15:64589085-64589107 CTCCATCAGAAGAGCTAAAATGG - Intronic
1128177202 15:65566336-65566358 CTTTATCAGCAGTGGGAAAACGG - Intronic
1128718472 15:69927838-69927860 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1128926288 15:71659256-71659278 TTCCATGAGCAGATGGAAGTGGG - Intronic
1129267019 15:74398931-74398953 CTCATTCAGCAGTGAGAAGATGG + Intergenic
1130056234 15:80528288-80528310 CTCCATTGGCAGAGTGAAGGAGG - Intronic
1130737599 15:86566473-86566495 CTCCATCAGCAGGGTGAATAAGG + Intronic
1130915062 15:88298587-88298609 CTCCATCAGCAGACAGCAGTGGG - Intergenic
1131115228 15:89791233-89791255 TTCCATCTATAGAGGGAAGAAGG - Intronic
1131650746 15:94396260-94396282 CTCCGTCAGCAAAGGCAAAAAGG - Intronic
1131883192 15:96880643-96880665 CTCCATTGGCAGAAAGAAGATGG + Intergenic
1131915499 15:97260868-97260890 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1132710653 16:1265652-1265674 CTCCATCTGAAGATGCAAGAAGG + Intergenic
1134183305 16:12064434-12064456 TCCCATCAGCAGTGAGAAGATGG - Intronic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137480812 16:48850427-48850449 CTCAATCAGCACTGGGAAGGTGG - Intergenic
1137760666 16:50937581-50937603 CTTCATCAGCAGCAGGAAAACGG + Intergenic
1137949094 16:52765132-52765154 TTCCAACAGCAGGGAGAAGAGGG + Intergenic
1137957124 16:52842922-52842944 CACCAACAGCAGAAGCAAGAGGG - Intergenic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1139311871 16:66034332-66034354 CTCCATCCACAGAATGAAGAAGG - Intergenic
1139984229 16:70884255-70884277 CTCCAGGAGGAGAGGAAAGAGGG - Intronic
1140027117 16:71300859-71300881 CTCCATGAGAAGAGGGAGAAAGG - Intergenic
1141116578 16:81314859-81314881 CTCCAGCAGCGGAGGCGAGAAGG + Intergenic
1141198157 16:81877085-81877107 CTCCATGAGCTGGGGCAAGACGG - Intronic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1141868898 16:86770952-86770974 CTGCAACAGGAAAGGGAAGAAGG - Intergenic
1141906671 16:87031326-87031348 CTCCATCCGCAGAGCCAAGAGGG + Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1143003097 17:3808056-3808078 CTCCATGAGCATAGACAAGAGGG + Intergenic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143373482 17:6454517-6454539 CTCCAATAACAGAAGGAAGACGG + Exonic
1144996015 17:19269293-19269315 CTCCAGCAGAGGAGGAAAGAGGG + Intronic
1146682867 17:34821123-34821145 CTCCATGAGCAGAGACAACAAGG + Intergenic
1146736406 17:35242633-35242655 CTCCGTCAGCTGCTGGAAGAGGG - Intergenic
1147479583 17:40746728-40746750 CTTCATCAGCAGCGTGAAAATGG - Intergenic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1148485734 17:47989781-47989803 CTCCATCTACAGAGAGAAAAAGG - Intergenic
1149126928 17:53245870-53245892 CTTCATCATCAGAGGGATGTGGG - Intergenic
1149370798 17:55992015-55992037 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1149550120 17:57533681-57533703 CTTGATCAGGAGAGGGCAGAGGG + Intronic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1150843779 17:68634327-68634349 CTTTATCAGCAGCGTGAAGATGG + Intergenic
1150844116 17:68637882-68637904 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151700479 17:75740190-75740212 CACCATCAGCACAGGGCAAAAGG - Intronic
1152063896 17:78099341-78099363 CTTCATCAGCAGTGTGAAAATGG - Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1153455117 18:5272118-5272140 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1153538896 18:6133983-6134005 CTTTATCAGCAGAGTGAAAATGG - Intronic
1156618593 18:38820826-38820848 GTCTATCAGCAGTGGGAAAAGGG - Intergenic
1156717054 18:40024149-40024171 CTCCAACAGCTGCTGGAAGATGG + Intergenic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1156965462 18:43086037-43086059 CTTTATCAGCAGTGTGAAGATGG + Intronic
1157045706 18:44099876-44099898 CTCCAGCAGCAGCGTGAAAATGG + Intergenic
1157221144 18:45829170-45829192 CTCCATCAGCTCAGGTAAGCAGG + Intronic
1158350022 18:56555396-56555418 CTTCATCAGCAGTGTGAAAACGG - Intergenic
1158677789 18:59537635-59537657 CTTCATCAGCAGTGTGAAAATGG + Intronic
1159022134 18:63151938-63151960 CTCCTTCATGGGAGGGAAGAAGG + Intronic
1159092085 18:63860908-63860930 CTCCTCAAGCAGAGGGAAGGAGG + Intergenic
1159556021 18:69945728-69945750 CTTCATCAGCAGGGTGAAAACGG - Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160382772 18:78473358-78473380 CTCTATCAGCAGTGTGAAAATGG + Intergenic
1161237347 19:3204537-3204559 CGCCATTAGCAGAGGGCAGGCGG - Intronic
1162642139 19:12019446-12019468 CACCATCAACAAAGGGAAAAGGG + Intronic
1163291744 19:16383814-16383836 CTCCACCAGCTGAGTGAACACGG + Intronic
1163702350 19:18792388-18792410 CTCCACCAGCCGAGGGACCATGG - Intergenic
1163943702 19:20517188-20517210 CTCCACCTGCTGAGGGAAGCCGG - Intergenic
1166454395 19:42928698-42928720 CTCCCTCTGCAGAGGGCAGGTGG + Intronic
1166831389 19:45641822-45641844 CTCCAGCAGCAGAGGGTGCAGGG - Intronic
1167426868 19:49434079-49434101 CTCCTTGATCTGAGGGAAGATGG - Intronic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
925036942 2:694712-694734 CTCCAGCAGGAAATGGAAGATGG - Intergenic
925302243 2:2825696-2825718 CTCCATCAGCCAAGGGCAGGAGG + Intergenic
925817142 2:7764567-7764589 CTTTATCAGCAGTGTGAAGATGG - Intergenic
925829956 2:7884137-7884159 CTTTATCAGCAGAGTGAAAATGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926500880 2:13650765-13650787 CTCCTCCAGCAGAGGGCAGAGGG + Intergenic
926638383 2:15208084-15208106 CTTTATCAGCAGAGTGAAAATGG - Intronic
926858627 2:17284356-17284378 CACCATCACCTGTGGGAAGACGG + Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927185398 2:20478659-20478681 CTTCATCAGCAGCGTGAAAATGG + Intergenic
927236829 2:20882412-20882434 CTGCACCAACAGAGGGAATAGGG - Intergenic
927240361 2:20915465-20915487 CCCCAGCAGCAGAGGAAAGATGG - Intergenic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928413502 2:31072141-31072163 ACCCCACAGCAGAGGGAAGATGG - Intronic
929121840 2:38489957-38489979 GTCCAGCAGCTGTGGGAAGATGG - Intergenic
929587488 2:43125623-43125645 GCCCATCAGCAGAGGGAAAAAGG + Intergenic
930191975 2:48468895-48468917 CTTTATCAGCAGCGTGAAGACGG - Intronic
930317948 2:49820432-49820454 CTTTATCAGCAGTGTGAAGATGG - Intergenic
930319015 2:49831016-49831038 CTCCTTTAGCAGGGGGAAGCTGG + Intergenic
930444454 2:51452202-51452224 CTTCATCAGCAGTGTGAAAATGG + Intergenic
930774323 2:55157630-55157652 AGCCATCAGCAGAGGGATCAGGG + Intergenic
930818421 2:55621714-55621736 CTCCACCAGCAGAGGGCAAAGGG - Intergenic
931294232 2:60905933-60905955 CTTTATCAGCAGAGTGAAAACGG - Intronic
931445916 2:62327181-62327203 CTCTATCAGCAGCGTGAAAATGG - Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933397998 2:81755726-81755748 CTCTATCAGCAGCGTGAAAATGG - Intergenic
933401086 2:81796634-81796656 CTCTATCAGCAGTGTGAAAATGG + Intergenic
935514075 2:104013177-104013199 CTTCATCAGCAGTGTGAAAACGG - Intergenic
936624574 2:114134971-114134993 AACCATAAGCAGAGGTAAGACGG + Intergenic
936646494 2:114378131-114378153 CTCAATCATCAAAGGCAAGATGG - Intergenic
936969525 2:118163897-118163919 CTTTATCAGCAGCGTGAAGACGG + Intergenic
937132952 2:119526888-119526910 CTCCATCAGCACAGCTAATAAGG + Intergenic
937799476 2:126064957-126064979 CTTCATCAGCAGTGTGAAAACGG + Intergenic
938241600 2:129746636-129746658 CTCTATCAGCAGTGTGAAAATGG - Intergenic
938742283 2:134244363-134244385 ATCAATGAGCACAGGGAAGAAGG - Intronic
939506574 2:143053785-143053807 CTTTATCAGCAGTGGGAAAACGG + Exonic
940165420 2:150765154-150765176 CTCCAGCAGCAGAGAGAACGGGG - Intergenic
940542840 2:155044780-155044802 CTTCATCAGCAGTGTGAAAATGG - Intergenic
941075894 2:161006471-161006493 CTCCATAAGCAAAAGCAAGATGG - Intergenic
941165101 2:162075455-162075477 CTTCCTCAGCAGTTGGAAGAGGG - Intergenic
942981991 2:182094017-182094039 CTTCATCAGCAGTGTGAAAATGG - Intronic
943257397 2:185613287-185613309 CTTCATCAGCAGTGTGAAAATGG - Intergenic
943641211 2:190360182-190360204 TTCGATCAGCAGCTGGAAGAGGG - Exonic
943959323 2:194241352-194241374 CTTTATCAGCAGAGTGAAAACGG - Intergenic
944157563 2:196623321-196623343 CAACACCAGCAGAGAGAAGAGGG - Intergenic
945052678 2:205839747-205839769 CTCTATCAGCAGTGTGAAAATGG - Intergenic
945843215 2:214913375-214913397 CTTTATCAGCAGTGGGAAAATGG - Intergenic
946023447 2:216657447-216657469 GTCCATCTGAAGAGGGAAGGGGG + Intronic
947564978 2:231187968-231187990 AGCCATCAGGAGAGGGAGGAGGG + Intergenic
948174277 2:235930910-235930932 GGCCATCAGCAGTGGTAAGAGGG + Exonic
948599257 2:239099155-239099177 CTCCACCAGCAGAAGGATGAAGG - Intronic
948672814 2:239579350-239579372 CGCCCTCTGCAGAGGGACGAGGG + Intronic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169151307 20:3291744-3291766 CCACATCAGCACAGAGAAGACGG + Intronic
1169292892 20:4367886-4367908 CTCCAGCAGCACAGGGCACAGGG - Intergenic
1169337981 20:4773075-4773097 CTTCATCAGCAGCGTGAAAATGG - Intergenic
1169424512 20:5485611-5485633 CTCCATCAGCTAAGGGGGGATGG + Intergenic
1169432281 20:5548353-5548375 ACCCATCAGCAGAGAAAAGATGG + Intronic
1172026955 20:31955063-31955085 ATCCATGAGCAGAGAGAAGCAGG - Intergenic
1173609565 20:44356478-44356500 GTCCCTCAGCAGAGGGAAGACGG + Intronic
1174159754 20:48542466-48542488 CTTTATCAGCAGAGCGAAAACGG - Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176369175 21:6052265-6052287 CTGCAGCAGCAGAGGGCAGCTGG + Intergenic
1177484909 21:21745125-21745147 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1177880707 21:26690532-26690554 CTTTATCAGCAGCGTGAAGACGG - Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179754344 21:43486276-43486298 CTGCAGCAGCAGAGGGCAGCTGG - Intergenic
1179792175 21:43762105-43762127 CTCCCTCAGCAGGGGGACCACGG - Exonic
1179936846 21:44611525-44611547 CTCTATCAGCAGTGTGAAAATGG + Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181546373 22:23604766-23604788 CTCCATCAGCTCAGGGGACAGGG + Intergenic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1182174695 22:28272079-28272101 CTTCATCAGCAGTGTGAAAATGG + Intronic
1182535037 22:30994698-30994720 CTCCAGCACCAGAGAGATGAAGG + Intergenic
1183234168 22:36604633-36604655 CTCCATCAGCAAAAAGATGATGG + Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1184312095 22:43652449-43652471 CTTCATCAGCAGCGTGAAAACGG + Intronic
1184578768 22:45397983-45398005 CTCTGCCAGCAGAGGGCAGAGGG - Intronic
1185074977 22:48678175-48678197 AGCCCTCAGCAGAGGGAACATGG - Intronic
1185263556 22:49885108-49885130 TGCCATCAGCCGGGGGAAGAAGG + Exonic
949948893 3:9212986-9213008 CTGCATCAGCAGGGGGAAATGGG - Intronic
949966420 3:9360517-9360539 CTCTATCAGCAGTGTGAAAATGG - Intronic
950256155 3:11507997-11508019 TTCCATCAGTAAAAGGAAGAAGG + Intronic
951076763 3:18402836-18402858 CTCCATCAGCAGAGAGGGCAAGG + Intronic
952186661 3:30976941-30976963 CACAATCAGCAGAAGGAAAAGGG - Intergenic
952273685 3:31857115-31857137 CTCCATCTGCAGAGGGCAGGGGG - Intronic
952927241 3:38329097-38329119 CTCCAGCTGCAGAGGGCAGGTGG + Intergenic
953030392 3:39176101-39176123 TTTCATCAGGAGAGGGAAGCTGG - Intergenic
954541672 3:51397114-51397136 CTCCCTTAACAGAGAGAAGAGGG - Exonic
954845498 3:53552052-53552074 ATCCACCCCCAGAGGGAAGAGGG - Intronic
955638061 3:61051937-61051959 CACCATCAGAAGATAGAAGATGG + Intronic
956750919 3:72343213-72343235 CTCCACCAGGAGAAGGCAGAGGG - Intergenic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
957144889 3:76411969-76411991 CTTCATCAGCAGCGTGAAAATGG - Intronic
958831963 3:99100126-99100148 CTTTATCAGCAGAGTGAAAACGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
960148750 3:114230892-114230914 CTCCCTCAGCTGAGGGAAGAGGG - Intergenic
961222440 3:125211821-125211843 CGCCCTGAGCAGAGGGGAGAGGG + Intronic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962033659 3:131628227-131628249 CTTCATCAGCAGTGTGAATATGG - Intronic
962355071 3:134686619-134686641 CCACATCAGCAGTGGTAAGAAGG + Intronic
962925170 3:139986515-139986537 CTCCACAAGAAGAGGGCAGAAGG - Intronic
963285994 3:143435045-143435067 ATCCATCAGCTGGGGGAAAATGG + Intronic
963357218 3:144223972-144223994 CTCTATCAGCAGTGTGAAAACGG + Intergenic
963634529 3:147777370-147777392 CTTTATCAGCAGCGGGAAAATGG + Intergenic
964459593 3:156909233-156909255 CTTTATCAGCAGAGTGAAAATGG + Intronic
964614392 3:158646801-158646823 CTCCAACAGCACAGAGAACAAGG - Exonic
964987813 3:162766157-162766179 CTCCACAGGCAGAGGGCAGAGGG + Intergenic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
966317101 3:178659936-178659958 TTCCATCAGCAAATGGAAAATGG + Intronic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
968425584 4:520830-520852 CTGCATCGCCAGAGGGCAGATGG + Intronic
968777722 4:2554019-2554041 CTTCATCAGCAGTGTGAAAATGG + Intronic
970579101 4:17458033-17458055 CTCAGACAGCAGAGGGCAGAAGG - Intergenic
970868003 4:20781423-20781445 CTTTATCAGCAGCGGGAAAATGG - Intronic
971875230 4:32300166-32300188 CTTTATCAGCAGAGTGAAAATGG + Intergenic
972302004 4:37793244-37793266 CTTCATCAGCAGTGTGAAAATGG + Intergenic
972456634 4:39262082-39262104 CCCCATCAGTAAAGTGAAGAAGG - Intronic
972580834 4:40394411-40394433 ATACATCAGCAGAGGAAAGCAGG + Intergenic
972850011 4:43036579-43036601 CTTTATCAGCAGGGGGAAAATGG + Intergenic
972855836 4:43105519-43105541 CTTTATCAGCAGTGGGAAAACGG + Intergenic
973154880 4:46938405-46938427 CTACATCAGCAAAGGCAACAGGG + Intronic
973785252 4:54326617-54326639 GGCCCTCAGCCGAGGGAAGAAGG - Intergenic
974877610 4:67717385-67717407 CGCCATCAGGACAGTGAAGATGG - Intergenic
975204167 4:71624957-71624979 CTTCATCAGCAGCAGGAAAATGG - Intergenic
975543480 4:75537621-75537643 CTCTATCAGCAGTGTGAAAATGG + Intronic
976368477 4:84259023-84259045 CTCAATCAGCACAGGAAATAAGG - Intergenic
976503247 4:85815812-85815834 CTTTATCAGCAGCGGGAAAATGG - Intronic
977053843 4:92164174-92164196 CTTTATCAGCAGTGTGAAGATGG - Intergenic
978546435 4:109876191-109876213 CTGCATCGGCAGAGGGGATATGG - Intergenic
978678834 4:111353259-111353281 CACCATCAGGAGAAGGAAAATGG + Intergenic
979464752 4:121023183-121023205 CTTCATCAGCAGTGTGAAAATGG - Intergenic
979754296 4:124321554-124321576 CTCCATAGGCAGTGGGAAGAAGG - Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
980867860 4:138574627-138574649 CTTCATGAGAAGAGGGAATAGGG - Intergenic
981152731 4:141397924-141397946 CTCCAACAGCAGAGGGAGAAGGG - Intergenic
981862788 4:149378196-149378218 CTTCATCAGCAGCGTGAAAATGG + Intergenic
981915349 4:150026987-150027009 CTGCATCAGCAGTGGCAAAAGGG + Intergenic
982832776 4:160085301-160085323 CTTTATCAGCAGAGTGAAAACGG - Intergenic
983372999 4:166887487-166887509 CTCCATCAGAAGTGGGAATGAGG + Intronic
985472788 5:55988-56010 TTCCACCAACAGAGGGAAGTAGG - Intergenic
985861179 5:2471709-2471731 CCACATCAGCAGAGGAGAGAAGG + Intergenic
986553165 5:8981447-8981469 CTCCATCAGCAGGTGGGAGCAGG - Intergenic
987025798 5:13925423-13925445 CTCCATCAGCAGCATGAAAATGG - Intronic
987090859 5:14506896-14506918 CTCCATCTTAAGAGGGAAGCCGG - Intronic
988131676 5:27114363-27114385 CTCCATCGAAAGAGGAAAGAAGG + Intronic
988354998 5:30162269-30162291 CTCTATCAGCAGCGTGAAAACGG - Intergenic
989403643 5:41036472-41036494 CTTTATCAGCAGAGTGAAAATGG + Intronic
990117007 5:52401742-52401764 AGCCATCAGAAAAGGGAAGAGGG + Intergenic
990264464 5:54060636-54060658 CTTTATCAGCAGAGTGAAAATGG + Intronic
990429033 5:55716782-55716804 CTTTATCAGCAGCGGGAAAATGG + Intronic
990644701 5:57831051-57831073 CTTTATCAGCAGCGGGAAAACGG + Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
991126487 5:63075513-63075535 CTGCAGCAGCATATGGAAGATGG - Intergenic
992342186 5:75836018-75836040 CTCCATCAGTAGAGTGAAAAAGG - Intergenic
992598663 5:78373096-78373118 TTCCACTAGCAGAGGGGAGAAGG - Intronic
993225806 5:85166349-85166371 CTTCATCAGCAGTGTGAAAATGG + Intergenic
993761640 5:91802930-91802952 CTTCACCAGCAGAGGGCAAAGGG - Intergenic
994265671 5:97713516-97713538 CTTTATCAGCAGAGTGAAAATGG - Intergenic
995022966 5:107386348-107386370 CTCCATAAGCAGTTGGTAGAGGG + Intronic
995320742 5:110830852-110830874 CTCCATCAGCAGAGAGAAGAGGG - Intergenic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
996872372 5:128205976-128205998 CTTCATCAGCAGCGTGAAAACGG - Intergenic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
997955209 5:138274055-138274077 CTACCTCAAAAGAGGGAAGAGGG + Intronic
999100292 5:149018355-149018377 CTTTATCAGCAGTGGGAAAATGG - Intronic
999404343 5:151293811-151293833 CACCATCAGCAATGGGAAGGAGG - Intronic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001973706 5:175979206-175979228 CTCAGTCAGTAGAGGGGAGATGG + Intronic
1002243726 5:177864573-177864595 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1002782000 6:374122-374144 CTCCTTCTGCTGAGGGATGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1006414272 6:33894079-33894101 ATCTGTCAGCAAAGGGAAGAGGG + Intergenic
1006645752 6:35512941-35512963 CTCCTTGAGCAGGGGGAAGGGGG - Intergenic
1006721180 6:36152600-36152622 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1006747475 6:36353974-36353996 CTTCATCAGCAGTGTGAAAACGG + Intergenic
1006788344 6:36682768-36682790 CCCCTTCAGGAGAGGGAAAACGG - Intronic
1007453835 6:41960978-41961000 TCCCCTCAGCAGAGGGAAGCTGG + Intronic
1007630043 6:43268417-43268439 CTCCAGCAGAGTAGGGAAGAGGG - Intronic
1008246356 6:49178739-49178761 CTCCTTCAGCAGAAGAAAGATGG - Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009535431 6:64877000-64877022 TAACATCAGAAGAGGGAAGATGG + Intronic
1010602428 6:77846674-77846696 CTCCAGCAGAGGAGTGAAGATGG - Intronic
1011353762 6:86452770-86452792 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1011833679 6:91404231-91404253 CTCCACAGGCAGGGGGAAGAAGG + Intergenic
1011834955 6:91420613-91420635 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1012225897 6:96703074-96703096 CTCAATCACCAAAGGCAAGATGG + Intergenic
1012437798 6:99233644-99233666 ATCCATCAGCAGGTGGAGGAAGG + Intergenic
1013987130 6:116208275-116208297 CTCCTTCAGAAGAGAGAAGCTGG - Intronic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014547262 6:122747894-122747916 CTCCACCCGCAGAGGGAAGTCGG - Intergenic
1014962309 6:127702658-127702680 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1015298985 6:131631587-131631609 GTCCAACAGCAAAAGGAAGAAGG - Intronic
1015676933 6:135761312-135761334 CTTTATCAGCAGTGGGAAAAAGG - Intergenic
1015908706 6:138145059-138145081 CTTTATCAGCAGCGTGAAGATGG + Intergenic
1017451993 6:154562933-154562955 CTCAACCACCAGAGGCAAGATGG + Intergenic
1017764282 6:157593847-157593869 CTCCAGCCACAGAGAGAAGAGGG - Intronic
1018497992 6:164369668-164369690 CCCCAACAGCAGCTGGAAGATGG + Intergenic
1018622368 6:165742793-165742815 CTCCCTCAGCAGTGGGACGTAGG - Intronic
1018862145 6:167718924-167718946 CTTTATCAGCAGAGTGAAAACGG + Intergenic
1020933294 7:14427541-14427563 CTCTATCAGCAGCGTGAAAATGG - Intronic
1021860037 7:24897038-24897060 CTCCAGCATGAGAGGGAAGGAGG + Intronic
1023044551 7:36199624-36199646 CTCAGTCAGAAGAGGGAAAAGGG - Intronic
1023140174 7:37094266-37094288 CTCCATCAGAAGGTGGGAGATGG + Intronic
1024328181 7:48129928-48129950 CTCTATCAGCAGTGTGAAAATGG - Intergenic
1026740150 7:72974114-72974136 CTGAATCAGCAGAGGAGAGAAGG + Intergenic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1027103583 7:75390956-75390978 CTGAATCAGCAGAGGAGAGAAGG - Intergenic
1027951192 7:84818699-84818721 TTCCATCAGAAGAGGGATGTTGG + Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1030703361 7:112666258-112666280 CTCTATCAGCAGTGTGAAAATGG - Intergenic
1030787881 7:113684792-113684814 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1030868662 7:114730632-114730654 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1032308054 7:130755206-130755228 ATCCATGAGCAGAGGAAAGTTGG - Intergenic
1032454201 7:132059456-132059478 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1033933007 7:146547494-146547516 TTCCAGGAGCTGAGGGAAGAGGG - Intronic
1034062748 7:148108080-148108102 CTCCCTCCCCAGAGGGGAGATGG - Intronic
1034386577 7:150745510-150745532 CTCAAGCAGCAAAGAGAAGAAGG - Intronic
1034948251 7:155278233-155278255 CGCAAACAGCAGTGGGAAGAAGG - Intergenic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1035549246 8:507570-507592 CTCCATCATCCCAGGTAAGAGGG + Intronic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1035923032 8:3699145-3699167 CTCCTTCAGCAGTGGGATGGAGG + Intronic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1037536853 8:19832696-19832718 CTCCACCAGCAGAGAGAGGAGGG - Intronic
1038285206 8:26200294-26200316 CTTCATAAGCAGAGGGAATTTGG + Intergenic
1038355840 8:26828534-26828556 CTCTATCAGCTGGGGAAAGAAGG + Intronic
1038428672 8:27482387-27482409 CTCCTTCAGCAGACAGATGATGG + Intergenic
1038512052 8:28147274-28147296 CTCCACAGGCAGTGGGAAGAGGG - Intronic
1038612193 8:29067927-29067949 GTCCAGCAGCAGAGGGGACAGGG - Exonic
1038738105 8:30190856-30190878 CTTCATCAGCAGTGTGAAAACGG - Intergenic
1039188763 8:34947991-34948013 CTCAATCAGCGGGAGGAAGAAGG + Intergenic
1039574009 8:38609143-38609165 CTTCATCAGCAGTGTGAAAATGG - Intergenic
1039877859 8:41602887-41602909 CTCCTGCGGCAGAGGGATGAGGG + Intronic
1040579674 8:48687511-48687533 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1040981935 8:53252726-53252748 CTCCATCAGCGGAGGGCAGAAGG + Intergenic
1041378068 8:57222487-57222509 CTCCATTACCAAAAGGAAGAGGG - Intergenic
1041606062 8:59783618-59783640 CTCCATCAGCAGAGAGAAGTAGG - Intergenic
1041812669 8:61928696-61928718 GTCCAACAGCAGAGGGAAGAAGG + Intergenic
1043223918 8:77699902-77699924 CTCCCTCAGCTGAGGGGAGGGGG + Intergenic
1043505401 8:80897300-80897322 CTTTATCAGCAGCGTGAAGACGG - Intergenic
1043781027 8:84335284-84335306 AAACATCAGCAGAGAGAAGATGG - Intronic
1044199166 8:89413563-89413585 CTCCGCCAGCAGAGGGCAAAGGG + Intergenic
1044740202 8:95318555-95318577 AACCAGCAGCAGAGGGAATAGGG - Intergenic
1046003434 8:108448697-108448719 CTTTATCAGCAGTGGGAAAACGG + Intronic
1046746485 8:117881757-117881779 AACCTTCAGAAGAGGGAAGAAGG - Intronic
1046860741 8:119088598-119088620 GTCCATCAGCAGATGAAAGGAGG - Intronic
1047199079 8:122748726-122748748 CTTCATCAGCAGAATGAAAATGG - Intergenic
1047453652 8:124989466-124989488 CTCCATCATCAAATGGAAGTAGG + Intergenic
1048158688 8:131990998-131991020 CTCTATCAGCAGTGTGAAAATGG - Intronic
1048429457 8:134356191-134356213 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1048661050 8:136601074-136601096 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050156154 9:2668022-2668044 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1051328514 9:15998870-15998892 CTCTATCAGAACAGGAAAGATGG + Intronic
1053071492 9:35104706-35104728 TTCCCTCAGCTGAGGGAAGAGGG - Exonic
1053423386 9:37995416-37995438 CCCCATCAGCAGTGGGCAGGTGG - Intronic
1053423758 9:37997778-37997800 CTCCATCACCCCAGGGCAGATGG + Intronic
1053565663 9:39248149-39248171 CTTCATCAGCAGTGTGAAAATGG - Intronic
1053831428 9:42086003-42086025 CTTCATCAGCAGTGTGAAGATGG - Intronic
1054131485 9:61370887-61370909 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1054599119 9:67101435-67101457 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1056425044 9:86467322-86467344 GTCCATCAGGATGGGGAAGAGGG + Intergenic
1057809710 9:98248439-98248461 CCCCACCACCAGTGGGAAGAAGG + Intronic
1057857645 9:98614121-98614143 CCACATCAGCAGAGGAAAAAGGG + Intronic
1058401428 9:104624410-104624432 CTTTATCAGCAGGGGGAAAACGG + Intergenic
1058764652 9:108169584-108169606 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061701950 9:132422777-132422799 CACCTTCAGTAGAGGGAAGGAGG - Intronic
1061711860 9:132493493-132493515 CTCCATCAGCAGAGAGTTGGGGG + Intronic
1061764878 9:132875356-132875378 CCCCATGAGCAGAGGCATGAGGG + Intronic
1062299338 9:135856142-135856164 CTTTATCAGCAGTGTGAAGATGG - Intronic
1062722293 9:138050750-138050772 CTCCGCCAGCTGAGGGAAGAGGG - Intronic
1185452736 X:291441-291463 CTCCAACACCACAGGGAAGGCGG - Intronic
1185530827 X:817013-817035 CTTCATCGCCAGAGGGATGAGGG + Intergenic
1187332291 X:18352012-18352034 CACCAACAGCAAAGGGAACAGGG + Intronic
1187614191 X:20975344-20975366 ATCCATCAGAAAAGGAAAGAAGG + Intergenic
1187701852 X:21970425-21970447 CACCAGCAGCAGAGAGGAGAGGG - Intronic
1187852528 X:23605331-23605353 CTTTATCAGCAGTGGGAAAATGG + Intergenic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1187895514 X:23976479-23976501 CTTCATCAGCAGTGTGAAAACGG - Intergenic
1189132761 X:38517586-38517608 CTTTATCAGCAGCGGGAAAATGG - Intronic
1189619326 X:42818732-42818754 CTCCACCAGCAGAGGGCAGAGGG + Intergenic
1189799051 X:44675260-44675282 CTCAATCAGCAAAGGGAGAAAGG - Intergenic
1189803540 X:44713960-44713982 CTCCATGAGCAGAAGATAGATGG + Intergenic
1189845815 X:45135676-45135698 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1192680344 X:73247324-73247346 CTGCATCAGCAGTGTGAAAATGG + Intergenic
1193069683 X:77294908-77294930 CTCCACCTGCAAAGGGAAGTCGG + Intergenic
1195258485 X:103110953-103110975 TTCCATCAGAAAAGGGAAAAAGG + Intergenic
1195303576 X:103556475-103556497 CTCCTTCAGCAGATAGCAGATGG - Intergenic
1196048392 X:111279976-111279998 CTGCATCATAACAGGGAAGAAGG + Intergenic
1196316842 X:114236869-114236891 CTTCAACAGCAGAGGTAAGTAGG - Intergenic
1196845925 X:119896606-119896628 CTCCAACAGGAGAGGGAAGATGG - Intronic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1198044391 X:132886319-132886341 CCCCATCAGCAGATTCAAGATGG + Intronic
1198060633 X:133042424-133042446 CTCCCTCAGCCAAGGGAAGGCGG - Intronic
1198778448 X:140206917-140206939 CTCCATCATCAAGGTGAAGATGG + Intergenic
1199293452 X:146131012-146131034 CTGCATCATCACAGGGTAGAAGG + Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic
1200214288 X:154360579-154360601 CGCCTTCACCTGAGGGAAGAAGG + Exonic
1200676440 Y:6152010-6152032 CTCCGTCAGCCTAGGGAAGGAGG + Intergenic
1200942927 Y:8804351-8804373 CTCCACCCACAGAGGGAAGTCGG + Intergenic
1200963819 Y:9018640-9018662 CTCCATCAGCAGAGGAAACTGGG + Intergenic
1201608172 Y:15810761-15810783 CTTCATCAGCAGTGTGAAAATGG + Intergenic
1201693684 Y:16799292-16799314 CTTTATCAGCAGGGTGAAGATGG - Intergenic