ID: 959388443

View in Genome Browser
Species Human (GRCh38)
Location 3:105742179-105742201
Sequence TATAGCCAACAGATTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959388443_959388444 8 Left 959388443 3:105742179-105742201 CCAACTTAAATCTGTTGGCTATA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 959388444 3:105742210-105742232 TTCGAGCTGCTGTATGTATGTGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959388443 Original CRISPR TATAGCCAACAGATTTAAGT TGG (reversed) Intronic
903573114 1:24321104-24321126 TTTAGCCAGCAAATTTAAGTGGG - Intronic
906832080 1:49043678-49043700 TATAGGCAACAGATACAAATGGG + Intronic
908481590 1:64545966-64545988 TATAGTGAACAGATTAAAATAGG - Intronic
908617413 1:65937593-65937615 TGTAGCCAAAAGATTCCAGTGGG - Intronic
911345572 1:96692791-96692813 TATATCCATCATATTCAAGTTGG - Intergenic
911508270 1:98781236-98781258 TATTGAGAACAGCTTTAAGTTGG + Intergenic
911924237 1:103807878-103807900 TATACCCAGCAGATATAGGTGGG + Intergenic
919431919 1:197504541-197504563 TATAGTCAACGGATTTTATTAGG - Intergenic
919581371 1:199378706-199378728 TACAGTCAACAAATTTAATTGGG + Intergenic
921431387 1:215070112-215070134 TATAGGAAACAGGTTTAGGTTGG + Intronic
922310391 1:224383600-224383622 TATAGCAAGCTCATTTAAGTAGG + Intergenic
923969149 1:239180243-239180265 GATAGCCAAGACATTTTAGTTGG + Intergenic
1069322677 10:67192212-67192234 AAAAGCAAAAAGATTTAAGTGGG + Intronic
1075481726 10:122788080-122788102 TAAAGCCAACTGATTTAATCAGG - Intergenic
1077951611 11:6964120-6964142 AATAGCCAAAAGATTTAAGAAGG - Intronic
1084222503 11:67692471-67692493 TATAGCTAACAAATTTAAAGAGG + Intergenic
1084424215 11:69075852-69075874 TATAGACAACAGAGGGAAGTGGG + Intronic
1084929036 11:72539066-72539088 TGCAGCCACCAGATTTATGTAGG - Intergenic
1091772679 12:3163264-3163286 TATAGACAAGACATTTAAGCTGG - Intronic
1092933752 12:13340887-13340909 CATGGCCGACAGATTTCAGTTGG - Intergenic
1093382839 12:18515881-18515903 TATATCCCACAGATTCTAGTAGG + Intronic
1096817038 12:54208360-54208382 CGCAGCCAACAGATTCAAGTGGG + Intergenic
1097520862 12:60669186-60669208 TGTATCCAACACAATTAAGTTGG - Intergenic
1100333099 12:93603942-93603964 TGAAGTCAATAGATTTAAGTCGG - Intergenic
1109587859 13:64432716-64432738 TACAGCCAACAGGTTTGTGTAGG - Intergenic
1110072380 13:71193062-71193084 TATAGCCACCAATTCTAAGTGGG + Intergenic
1110085775 13:71377393-71377415 TGTAGCAAATATATTTAAGTAGG - Intergenic
1111735343 13:92131925-92131947 TATACCCAACAGATATAACTGGG + Intronic
1120225601 14:81787752-81787774 TAGAGCCAGCAGAATGAAGTGGG - Intergenic
1120259922 14:82169753-82169775 TATAGCAGTCAGAATTAAGTAGG + Intergenic
1124326794 15:28772621-28772643 TATACCCAACAGATATGACTGGG + Intergenic
1125139909 15:36393378-36393400 TATAGTAAACATGTTTAAGTGGG - Intergenic
1126285006 15:47000325-47000347 AAAATCCAACAGATGTAAGTAGG + Intergenic
1127199952 15:56634590-56634612 TATAGCATACAGATATAAATGGG + Intronic
1130103227 15:80909674-80909696 TCTACCCAACAGATTTGAGATGG + Exonic
1131356792 15:91752269-91752291 TATAGCCAACAGAATTCAAAAGG - Intergenic
1131923143 15:97352458-97352480 TATAGCCATAAGATTTTAGGGGG + Intergenic
1135393578 16:22114092-22114114 TCTAGCCAATAGATTTAAGCTGG - Intronic
1135833499 16:25800310-25800332 AATAGACAAGATATTTAAGTGGG - Intronic
1137683855 16:50372594-50372616 TATAGCCAACAAATGAAAGAGGG + Intergenic
1138157949 16:54723170-54723192 AATAGCCAAAAGATTTGAGCTGG - Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1143236126 17:5402550-5402572 TATAGGCAAAACATTTAAGGGGG - Intronic
1144513349 17:15896688-15896710 AAAAGCCAACAGATTAAAGATGG - Intergenic
1144616907 17:16784653-16784675 TATAGCCAAATAATTTAAGATGG + Intronic
1144895785 17:18531021-18531043 TATAGCCAAATAATTTAAGATGG - Intergenic
1145136433 17:20413212-20413234 TATAGCCAAATAATTTAAGATGG + Intergenic
1146800534 17:35816214-35816236 TATTGCCACCAAATATAAGTGGG - Intronic
1153791351 18:8582573-8582595 TAGGGCCACCAGTTTTAAGTGGG - Intergenic
1154075247 18:11194332-11194354 TATAACCTACAGATTCAAATAGG - Intergenic
1155562552 18:27094163-27094185 TATAGACAACAGAATGAACTGGG + Intronic
1156371598 18:36476360-36476382 TGTAGCCAAGGGATGTAAGTTGG - Intronic
1156929879 18:42628815-42628837 CATAGCAAACAGATTGAAGATGG + Intergenic
929181704 2:39047572-39047594 AATAGGCAAAAGACTTAAGTAGG - Intronic
929206439 2:39300408-39300430 TATAACCCACAGCATTAAGTCGG - Intronic
930142789 2:47970029-47970051 AATAGCCAAAAGAATGAAGTTGG - Intergenic
933402431 2:81815907-81815929 TATAACCAAAAGATTTAAGAAGG - Intergenic
934546526 2:95221826-95221848 CATAGCAAACACCTTTAAGTGGG - Intronic
935457742 2:103289582-103289604 TATTGCCATCCGGTTTAAGTGGG - Intergenic
935585632 2:104797597-104797619 TATAGCCAAGATATATAAGAAGG + Intergenic
937698157 2:124832783-124832805 AATAGACAACAGATTCAAGTAGG + Intronic
940688483 2:156884195-156884217 TATAGAAAACTGATTGAAGTGGG - Intergenic
943613101 2:190058036-190058058 TTTAGCCAACATATTTAATCAGG - Intronic
944327514 2:198423960-198423982 TTTAGCAAACAGATTCTAGTGGG + Intronic
947231385 2:227891196-227891218 TATAACTAACAAATTTAATTTGG + Intronic
1169792173 20:9422884-9422906 TATAGCCTTCAGATGTAAATAGG + Intronic
1171223143 20:23419927-23419949 TATAGCCAAAAGAATGAAGTTGG + Intronic
1173470278 20:43318361-43318383 TATGGCCATCAGATTTTTGTTGG - Intergenic
1179352633 21:40627248-40627270 AATTGATAACAGATTTAAGTTGG + Intronic
950408974 3:12822201-12822223 TATAGCCCACGGAATGAAGTGGG - Intronic
951444186 3:22758049-22758071 TGTTGCCAAAAGATTTAAGGTGG + Intergenic
952023167 3:29047677-29047699 TATAGCCAACAGAACTATATAGG - Intergenic
954358333 3:50102124-50102146 ACTATCAAACAGATTTAAGTAGG - Intronic
954780626 3:53056795-53056817 TATAGTCTACATATTTAGGTTGG + Intronic
954830962 3:53420971-53420993 TATAGTCAACATTTTCAAGTGGG + Intergenic
955469980 3:59276509-59276531 TATAGTCAACAGTTTTGTGTGGG - Intergenic
958495006 3:94833757-94833779 TATATGCTAAAGATTTAAGTTGG + Intergenic
959247028 3:103884285-103884307 TAAAGCCAACAGATTGAAAGTGG - Intergenic
959388443 3:105742179-105742201 TATAGCCAACAGATTTAAGTTGG - Intronic
962491099 3:135894798-135894820 AATACCCAACAGCTTTAATTTGG - Intergenic
963634118 3:147772282-147772304 TATAGCCAACACAGTTATTTGGG - Intergenic
965581462 3:170272499-170272521 TATTTCCAACATATTTATGTAGG + Intronic
966286686 3:178304842-178304864 TCTAACCAACACAGTTAAGTAGG - Intergenic
966666162 3:182473306-182473328 TACAGCCAAGAAATTGAAGTTGG - Intergenic
968918242 4:3507258-3507280 AATAGGCAAAAGAATTAAGTAGG + Exonic
970176070 4:13340716-13340738 TCTAGCAAACAGATTTCTGTGGG - Intergenic
972215762 4:36895423-36895445 CATGGGCAACACATTTAAGTGGG + Intergenic
972807831 4:42548286-42548308 TAGAGGCATCAGATTTATGTGGG - Intronic
972923100 4:43968064-43968086 AATATGCAACAGATATAAGTGGG - Intergenic
974450130 4:62044162-62044184 TATATTCAACATATTTAAATTGG + Intronic
974720909 4:65736991-65737013 TAAAGCCACCAATTTTAAGTGGG - Intergenic
975962386 4:79928279-79928301 TTTAGGCAACACATATAAGTGGG - Intronic
977427050 4:96880074-96880096 CATAGCCAATAAATTTAAGATGG - Intergenic
977952374 4:102987497-102987519 TAGATCCATCAGATCTAAGTTGG + Intronic
980655403 4:135776498-135776520 TGTAGCCAACAGATATATGAAGG + Intergenic
981779862 4:148416313-148416335 TATAGCAAATACATTTATGTAGG + Intronic
981915177 4:150025255-150025277 TATAGCCTAGAGATTCAAATAGG + Intergenic
984262747 4:177461607-177461629 TATAACCAACAGATAAAAGAGGG - Intergenic
984644343 4:182203562-182203584 TTAAGCCAACAGACTTGAGTTGG + Intronic
987588957 5:19897466-19897488 CATTGCCCACACATTTAAGTTGG + Intronic
989394748 5:40942178-40942200 TATAGTCAACTCATTTAAGGTGG + Intronic
993584519 5:89707716-89707738 GATAGCAAAAAGATTTGAGTAGG - Intergenic
994324180 5:98429627-98429649 TGTACCCAACAGTTTTAGGTTGG + Intergenic
996842029 5:127857473-127857495 TGTAGACAATAAATTTAAGTAGG - Intergenic
999641498 5:153677687-153677709 TATAGCCAATTGATTGGAGTTGG - Intronic
1008458801 6:51743484-51743506 TATAGCCAACTGACTTTACTTGG - Intronic
1008500312 6:52174450-52174472 TTTGGCAAACAGATTTAATTAGG - Intergenic
1009442490 6:63697457-63697479 TATAACCACAAGTTTTAAGTAGG - Intronic
1010348636 6:74844258-74844280 TATAGTCAAGACAATTAAGTAGG - Intergenic
1013347588 6:109277104-109277126 TATATAAAACAGATGTAAGTGGG + Intergenic
1018551046 6:164999362-164999384 TATAGCCCTCAGGTTTAAGTGGG + Intergenic
1021507186 7:21398738-21398760 TCTAGTCTACAGTTTTAAGTTGG - Intergenic
1022714494 7:32886644-32886666 TCTATGCAACAAATTTAAGTTGG + Intronic
1027676699 7:81168050-81168072 TTCAGCCAATAGATTTAAATTGG + Intergenic
1027891339 7:83979832-83979854 TGTAATCAAGAGATTTAAGTAGG + Intronic
1035983006 8:4393902-4393924 TCTAGCTAACGGATTTAAGATGG - Intronic
1039136354 8:34327624-34327646 TGTAGGCAACATATTTGAGTCGG + Intergenic
1042257572 8:66821237-66821259 TATATCAAACACATTAAAGTGGG - Intronic
1042952400 8:74214670-74214692 AATAGGCAACAGATTTGAATAGG - Intergenic
1045128411 8:99120517-99120539 TATAGCCAAGAAATTTTATTTGG - Intronic
1047155993 8:122319302-122319324 TATAGCCAATGGATTAGAGTTGG - Intergenic
1050226711 9:3465977-3465999 TAGAGACAACATATTTGAGTTGG + Intronic
1050569358 9:6921488-6921510 TAGAGCCAACAGAATTGATTGGG - Intronic
1053524989 9:38819604-38819626 TATAGGCAAAGGATTTAAATAGG - Intergenic
1054197220 9:62044019-62044041 TATAGGCAAAGGATTTAAATAGG - Intergenic
1054641188 9:67544675-67544697 TATAGGCAAAAGATTTAAATAGG + Intergenic
1058354862 9:104072607-104072629 TAAAGCCAAAACCTTTAAGTAGG + Intergenic
1060121399 9:120993855-120993877 TACAGCAAACACATTTGAGTGGG + Intronic
1060448318 9:123712850-123712872 TATTTCCAACAGATTTAATCTGG + Intronic
1188911369 X:35851815-35851837 TATAAACTACAGATTTAAGGGGG - Intergenic
1194292218 X:92088108-92088130 TATATCCAGTAGAATTAAGTAGG + Intronic
1194640078 X:96393208-96393230 GAAAGCAAGCAGATTTAAGTCGG - Intergenic
1197450254 X:126604677-126604699 CACATGCAACAGATTTAAGTTGG + Intergenic
1197569029 X:128126886-128126908 TATAGCCAAAAGAATTCAGCGGG + Intergenic
1198697511 X:139358155-139358177 CATAGCAAACAGATTCAAGATGG - Intergenic
1200387211 X:155905600-155905622 CATATTCAACAGAATTAAGTTGG - Intronic
1200609723 Y:5312733-5312755 TATATCCAGTAGAATTAAGTAGG + Intronic