ID: 959396618

View in Genome Browser
Species Human (GRCh38)
Location 3:105847636-105847658
Sequence CAGTGTGTAGGAGGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959396613_959396618 -8 Left 959396613 3:105847621-105847643 CCAGTGGTTGTCTAGCAGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 198
Right 959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG 0: 1
1: 0
2: 3
3: 40
4: 393
959396611_959396618 10 Left 959396611 3:105847603-105847625 CCTCAGTTGACTTTTTTTCCAGT 0: 1
1: 0
2: 0
3: 38
4: 327
Right 959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG 0: 1
1: 0
2: 3
3: 40
4: 393
959396610_959396618 13 Left 959396610 3:105847600-105847622 CCACCTCAGTTGACTTTTTTTCC 0: 1
1: 0
2: 3
3: 37
4: 362
Right 959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG 0: 1
1: 0
2: 3
3: 40
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959396618 Original CRISPR CAGTGTGTAGGAGGGGAAAA TGG Intronic
900299686 1:1970403-1970425 CAGCGTCTGGGAGGGGAGAAGGG + Intronic
901106471 1:6760177-6760199 CAGACTGTAGGAGTGGAAGAAGG + Intergenic
901879045 1:12183172-12183194 CAATCTGGAGGAGGGGAAATGGG + Intronic
903970716 1:27117175-27117197 CAGTGTGCTGGAGGGGAGACAGG + Intronic
906085895 1:43134521-43134543 AAGTGGGCAGGAGGGGAAAGGGG - Intergenic
906125949 1:43426984-43427006 TAGGGTGGAGGAGGGGAACAGGG + Intronic
906995246 1:50786441-50786463 GAGTTTGAGGGAGGGGAAAATGG + Intronic
907174388 1:52504739-52504761 AGGTTTGGAGGAGGGGAAAATGG - Intronic
908131188 1:61077088-61077110 CAGACTGGAGGAGGGGAGAAGGG + Intronic
908404954 1:63805536-63805558 CAGAGTGTAAGAGAGGAAAGAGG + Intronic
908715701 1:67067561-67067583 CAGAGCCTAGGAGGGAAAAATGG + Intergenic
909001391 1:70221563-70221585 CAGTGAGAAGGAGGGGGAAGAGG - Intronic
910122700 1:83808197-83808219 CATTGAGGAGGTGGGGAAAATGG - Intergenic
910181655 1:84490899-84490921 GAGGGTGAAGGAGGGGAATAAGG + Intronic
910632902 1:89374912-89374934 GAGGGTGTGGGAGGGGAAGAGGG - Intronic
910860940 1:91741856-91741878 CAGTGTGGAGGAGGGGTAGAAGG - Intronic
910971124 1:92856868-92856890 CAGTTTGTGAGAGTGGAAAATGG + Intronic
911056399 1:93712076-93712098 CAGTTTGTAGGAGAAGAAACTGG - Intronic
911102077 1:94103166-94103188 CAGGGTGTTGAAGGGGAAATGGG + Intronic
911377899 1:97074155-97074177 CAGTGTGTACGATGGAAAACTGG + Intergenic
911391840 1:97255316-97255338 CAGTGTTTAGGAGGGTGATATGG + Intronic
912264125 1:108138239-108138261 CAGTGTCTAGAATGGGACAATGG + Intronic
912503408 1:110137470-110137492 CAGTTTGTACATGGGGAAAAGGG - Intergenic
912777533 1:112515174-112515196 CAGTGTGTGGGAGAGGAGAGGGG - Intronic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
913402184 1:118448707-118448729 GGGGGTGTAGGAGGGGAAAATGG + Intergenic
914201011 1:145485667-145485689 CATTGTATAGGAGGGAGAAAGGG + Intergenic
914343395 1:146778435-146778457 GAGGGTGGAGGAGGGGAACACGG + Intergenic
914480122 1:148058799-148058821 CATTGTATAGGAGGGAGAAAGGG + Intergenic
917731765 1:177881662-177881684 CATTATATAGGAGGGGCAAAGGG + Intergenic
918037528 1:180889725-180889747 GAGTATTTAGGAGGGGAATAGGG + Exonic
918793791 1:188865479-188865501 GAGTGTGGAGGATGGGAGAACGG - Intergenic
919006989 1:191910424-191910446 CAGAGGTTAGGAGGGAAAAATGG - Intergenic
919733643 1:200930532-200930554 CAATCTGTAGGAGGAGAATAGGG - Intergenic
920314329 1:205066642-205066664 CTGGGTGTAGGAGGTGGAAAGGG + Intronic
920732568 1:208501477-208501499 CAGTGAGGAGGAGGGGAAACAGG + Intergenic
921672220 1:217938245-217938267 CTGTTTGGAAGAGGGGAAAAAGG - Intergenic
922228865 1:223668340-223668362 GAGCGTATAAGAGGGGAAAATGG - Intergenic
924268611 1:242308930-242308952 GAGTGTGTGGGAGGGGAGGATGG + Intronic
924532867 1:244908150-244908172 TAGGTTGCAGGAGGGGAAAACGG + Intergenic
1065644382 10:27819170-27819192 CAGTGTGTGGGAGGGAAGAGTGG + Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066716294 10:38289838-38289860 GAGTGTGTGGGAGGGGAGGATGG - Intergenic
1067743543 10:48914925-48914947 CAGTGTGAAGGATGAGAGAATGG - Intronic
1070308671 10:75256803-75256825 CAGGGTATTGGAGGGGAATAGGG + Intergenic
1070981108 10:80648664-80648686 GAGTTTGGAGGAGGGGAGAATGG - Intergenic
1071492280 10:86144018-86144040 CAGTGAGTACTAGGGGAAGAAGG - Intronic
1072413791 10:95230542-95230564 GACTGTGTAGGAGGAGAAAATGG + Intergenic
1073157032 10:101354908-101354930 CAGTCCCTGGGAGGGGAAAAGGG + Intronic
1073907596 10:108301318-108301340 CATAGTATAGGAGGGGAAACAGG - Intergenic
1074309195 10:112307820-112307842 CATTCTGCAGGAGGGGAAAGTGG - Intergenic
1075055494 10:119215430-119215452 CAGTGTGGAGGAGGGGGAGAAGG + Intronic
1075292247 10:121240544-121240566 CAGGGTCTAGGAGGGGATTAAGG - Intergenic
1076704910 10:132295996-132296018 CAGTGTGGAAAAGGGGGAAAGGG + Intronic
1076781634 10:132727855-132727877 CAGTGAGTTGGATGGGAACACGG + Intronic
1077328135 11:1972437-1972459 CAGTGTGCAGGAGGGGAACATGG - Intronic
1077934373 11:6768298-6768320 TAGTGTGTAGGAGGCCACAATGG + Exonic
1078106866 11:8363202-8363224 GAGAGTGAAGAAGGGGAAAAAGG + Intergenic
1078367089 11:10715745-10715767 CAGTGTGGAGGAGGGGGATACGG - Intergenic
1079047309 11:17117144-17117166 TAGTGGCTGGGAGGGGAAAATGG + Intronic
1080102556 11:28476207-28476229 CAGTGTGAAGAGGGGGACAATGG - Intergenic
1080224403 11:29944376-29944398 TAGTGTTTATGAGGAGAAAATGG + Intergenic
1080930248 11:36802525-36802547 CAGTGAGTCAGAGGGGAGAAGGG + Intergenic
1080939115 11:36894832-36894854 TAGTGTGTAAAGGGGGAAAAAGG + Intergenic
1081804647 11:45883879-45883901 CAGAGTGAAGAAGGAGAAAAGGG + Intergenic
1081954869 11:47082714-47082736 GAGTTTGTGGGTGGGGAAAAAGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082119236 11:48360148-48360170 TAGTGTGGATGAGGTGAAAAGGG + Intergenic
1082797312 11:57387599-57387621 CAGTGTGTGGGTGGGAAAAGAGG - Intronic
1083542974 11:63527531-63527553 AAGTGGGTTGGAGGGGAAAGAGG - Intergenic
1084024237 11:66437957-66437979 CAGTGAGATGGAGGGGCAAAGGG + Intronic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1084492233 11:69485204-69485226 CAGAGAGTAGGAGAGGCAAAGGG + Intergenic
1085937453 11:81165801-81165823 CAGTGTGTTGGAGGGAGAGATGG - Intergenic
1086509965 11:87545481-87545503 CAGTGAGGATGTGGGGAAAAAGG - Intergenic
1087675217 11:101153808-101153830 CAAGGTGAAGGAGGGGACAATGG - Intergenic
1088201985 11:107347002-107347024 AAGTTGGTAGGTGGGGAAAAAGG - Intronic
1088450307 11:109974655-109974677 CAGGGTGTAGGAGAGGAAAAGGG - Intergenic
1089069110 11:115685386-115685408 GAGGGTGGAGGATGGGAAAAGGG + Intergenic
1089498849 11:118921506-118921528 GAGTGAGGAGGAGGGGAAGACGG + Intronic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1091364249 11:135004538-135004560 CGCTGTGTAGGAGAGGAAATAGG + Intergenic
1202811114 11_KI270721v1_random:27617-27639 CAGTGTGCAGGAGGGGAACATGG - Intergenic
1091967380 12:4755972-4755994 CGGTGTGTAAGAGGGCAAATGGG + Intronic
1092038775 12:5364699-5364721 CACGGAGTAGGAGGGGAAGATGG + Intergenic
1092177125 12:6417721-6417743 CAGGGTGAAGTATGGGAAAACGG + Intergenic
1092548084 12:9468984-9469006 CAGAGTTTAGGAGGAGAGAAGGG - Intergenic
1092996521 12:13956237-13956259 CAGTGGGCAGGAGGCGACAAAGG + Intronic
1094167692 12:27459469-27459491 CAGGGTGCAGGATGGGAAGAAGG + Intergenic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1096453982 12:51770275-51770297 CAGTGAGAGGGAGGAGAAAAGGG - Intronic
1096580021 12:52579064-52579086 GAGTGTGTGTGAGGGGAAAAGGG - Intergenic
1097325560 12:58272434-58272456 CAGTAGGTGGAAGGGGAAAAGGG + Intergenic
1098531486 12:71546680-71546702 CAGTGTGTAGGAGGGCCTAGTGG - Intronic
1098731801 12:74044770-74044792 CAGTGTGGATGTGGTGAAAAGGG + Intergenic
1099366333 12:81769112-81769134 CAGAGAGTGGGAGGGGAAAGAGG + Intergenic
1100674929 12:96856201-96856223 CAGGGTCTAGGAGGGAAAAATGG - Intronic
1100936646 12:99677308-99677330 CAGTTTGGAGGAGGGGCAAGTGG - Intronic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1102061882 12:109938776-109938798 AAGGGTGAAGGAGGGGAAAAGGG + Intronic
1102603945 12:114054332-114054354 CTGTGGAAAGGAGGGGAAAAAGG - Intergenic
1103169555 12:118804416-118804438 GAGGGTGGAGGATGGGAAAAGGG - Intergenic
1103750517 12:123155912-123155934 CAGGGTGAAGGAGTGGAAAGGGG + Exonic
1104312946 12:127670841-127670863 GAGTCTGGAGGAGGGGAAAGTGG - Intergenic
1105468428 13:20669028-20669050 CTGGGAGTAGGAGAGGAAAAAGG + Intronic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1107221058 13:37980915-37980937 CACTGTGTAGAATGGGAAAATGG - Intergenic
1107229505 13:38091160-38091182 GAGGGTGGAGGAGGGGAAACTGG + Intergenic
1108572122 13:51762133-51762155 CAAAGTTTAGGAAGGGAAAATGG - Exonic
1109191948 13:59335541-59335563 CAGAGTATAGCAGGGGAAATAGG + Intergenic
1110358440 13:74596122-74596144 CAGTCTGCAGCATGGGAAAATGG + Intergenic
1110471548 13:75865661-75865683 CTTTGGGGAGGAGGGGAAAAAGG - Intergenic
1110484134 13:76018058-76018080 CAGGGTGTAGGAGGCGGCAAAGG + Intergenic
1111303619 13:86376880-86376902 TAGTGGGGAGGAGTGGAAAAGGG + Intergenic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113777086 13:112953935-112953957 GAGTGTCTAGGTTGGGAAAAGGG + Intronic
1114127475 14:19746365-19746387 GAGTGTAGAGCAGGGGAAAATGG + Intronic
1115145481 14:30221321-30221343 AAGTGTGTGGGAGGGAGAAAAGG - Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115571474 14:34670721-34670743 CAGTGTGTAGGAGAGCCACAAGG - Intergenic
1115854904 14:37621075-37621097 CAGTGTGTAGGAAGGGAATGGGG - Intronic
1118154882 14:63230083-63230105 CAGTGTGTGGGAGGGCAGAGTGG + Intronic
1118495711 14:66306335-66306357 CTCTGTGTAGGAAGGGACAAGGG + Intergenic
1119001162 14:70883336-70883358 AAGTTAGTAGGAGGTGAAAAGGG + Intergenic
1120337860 14:83180950-83180972 CACTTGGTAGGAGGGGAAAAGGG - Intergenic
1120901388 14:89578767-89578789 CAGTGTCTAGGAGAGAAGAAGGG - Intronic
1121343402 14:93117976-93117998 CAGTGTGTGGCAGAGGAAAATGG + Intergenic
1121538835 14:94710371-94710393 CTGTGTATAGGAGCGAAAAATGG - Intergenic
1121819478 14:96954584-96954606 CAGTCTGGAGGAGGTGAAAAAGG - Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1125013867 15:34910938-34910960 CAGGTTGTAGGTGGGGAAAATGG - Intronic
1125785073 15:42309280-42309302 CAGTGCTTAGCAGGGGAAGATGG - Intronic
1125826516 15:42681225-42681247 CACAGTGCAGGAGGGGAGAATGG - Intronic
1127057844 15:55150696-55150718 CAGTCTCTAGAAGGTGAAAAAGG + Intergenic
1127277806 15:57462514-57462536 CAGTATTTTGAAGGGGAAAATGG + Intronic
1128555657 15:68630022-68630044 CATTATGTTGGAAGGGAAAAGGG + Intronic
1128562567 15:68678322-68678344 CAGTGTGAGGGAGGGGAGAAAGG - Intronic
1129933313 15:79430029-79430051 CAGTAGCCAGGAGGGGAAAAGGG + Intergenic
1130311411 15:82758783-82758805 TACTGTGTAGGAGTGGAACAGGG + Exonic
1130539390 15:84811278-84811300 CTGTGTGGAGGAGAGGAAACGGG - Intergenic
1130618142 15:85433078-85433100 CAGTGTTAAAGGGGGGAAAAAGG - Intronic
1130652474 15:85769902-85769924 GAGTGGGTGGGAGGGGACAAGGG - Intronic
1130927165 15:88394332-88394354 CACTGTTTAGCAGGAGAAAATGG + Intergenic
1131577070 15:93602892-93602914 CTGCGTGAAGGAGGGGAGAAGGG - Intergenic
1131919804 15:97312645-97312667 CAGTGTCTAAGAGAGGAAACAGG + Intergenic
1133183935 16:4081689-4081711 CAGGGTGCAGGAGGGGAGGAGGG + Intronic
1133994482 16:10737903-10737925 CAGCGGGTGGGAGGGGATAAGGG - Intergenic
1134859258 16:17546399-17546421 CAGTATGTAGGAATGTAAAACGG + Intergenic
1135537261 16:23303563-23303585 GACTGTGTAGGTGGGGGAAAGGG - Intronic
1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG + Intronic
1135948627 16:26890319-26890341 TGGTGTGAATGAGGGGAAAAGGG - Intergenic
1139229429 16:65269211-65269233 AAGAGTGTGGGAGGGGATAAGGG - Intergenic
1139990595 16:70936898-70936920 GAGGGTGGAGGAGGGGAACACGG - Intronic
1140912486 16:79466899-79466921 CAGTGTGGAAGAGGGGACCACGG + Intergenic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1144034643 17:11354370-11354392 GAGTGTGTAGAAGGGAGAAAAGG - Intronic
1144540197 17:16133923-16133945 CAGTGAGGAGGCGGGGAGAACGG - Intronic
1145304324 17:21664593-21664615 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1146006381 17:29163217-29163239 CAGGGAGTAGGAGGAGTAAAAGG + Intronic
1146412329 17:32597427-32597449 CATTGTTTAGTAGGAGAAAAAGG + Intronic
1146575778 17:33989918-33989940 CAGTGGGAAGAAGGGGAAAGAGG + Intronic
1147680623 17:42242125-42242147 GAGAATGGAGGAGGGGAAAAGGG + Intronic
1148085149 17:44989492-44989514 CAGTGTGTGGGAGTGGGAAGGGG + Intergenic
1148352297 17:46949866-46949888 CAGTGTGGAGGAGGGAAGAAAGG + Intronic
1149741683 17:59052391-59052413 CATTGTGTAGCCGGGTAAAAGGG - Intronic
1150105651 17:62460715-62460737 CTTTGTGAAGGAGAGGAAAAAGG - Intronic
1150833251 17:68541999-68542021 CAGTGTGTAGGAGCGGATCCAGG + Exonic
1151844834 17:76645252-76645274 CAGTGTACAGTAGGGGATAAAGG - Intergenic
1152611787 17:81318507-81318529 CAGTGCCTGGGAGGGGAATAAGG - Intronic
1153157193 18:2163181-2163203 CAGTGTGTTGCAGCAGAAAAAGG + Intergenic
1153448192 18:5196990-5197012 AAGTGTCTAGGAGGGGAGCAGGG - Intronic
1154046956 18:10915217-10915239 CTGTGTGTAAGAGGGAAGAATGG + Intronic
1154174706 18:12077811-12077833 CTGTGTGTAAGAGGGAAGAATGG - Intergenic
1154510994 18:15101973-15101995 GTGTGTGTTGGAGGGGAAAGAGG + Intergenic
1155179812 18:23334693-23334715 TAGAGTGAAGAAGGGGAAAAGGG + Intronic
1156157301 18:34318339-34318361 GAGTGGGTTGGAGGTGAAAAGGG - Intergenic
1156210293 18:34932750-34932772 AAGTTTGTAGTAAGGGAAAAAGG + Intergenic
1157321936 18:46641336-46641358 CAGGGACTAGGAAGGGAAAAGGG + Intronic
1157615818 18:48987162-48987184 CAATGAATAGGAAGGGAAAATGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160158876 18:76455974-76455996 CAGTCTCTGGGAGGGGAACAGGG - Intronic
1161370521 19:3908602-3908624 CAGTGAGGAGGAGGGGAAGGAGG - Intronic
1162042337 19:7978374-7978396 CAGGGTGGGGGAGGGGAAAGGGG + Intronic
1163661349 19:18579640-18579662 CAGGCTGTAGGAGGGGAATTTGG + Intronic
1164457911 19:28424019-28424041 CAGTGCTTAGGAGGAGAGAAAGG - Intergenic
1165957124 19:39507926-39507948 CAGTGTGTAGCGGGGGGAAAAGG - Exonic
1166773259 19:45297460-45297482 CAGTTTGAAGGAGGGGTAATAGG + Intronic
925147551 2:1591304-1591326 CAGAGTGGAGGAGGGGACACCGG + Intergenic
925747868 2:7059443-7059465 AAGTGGGTGGGAGGGGAACACGG - Intronic
926209997 2:10862561-10862583 CTGTGTGTGGGAGGGGACAGAGG + Intergenic
926556093 2:14359845-14359867 GAGAGTGGAGGATGGGAAAAGGG + Intergenic
927116648 2:19910128-19910150 CAGAGTGGAGAAGGGGAAAAGGG - Intergenic
927268161 2:21176358-21176380 AAATGTGTTAGAGGGGAAAAGGG + Intergenic
927449576 2:23195935-23195957 CAAAGTGTAGGAAGGGTAAATGG + Intergenic
928175148 2:29028335-29028357 CAGTTTGCAGCAGGGGAGAATGG - Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
931280078 2:60783063-60783085 CAGTGAGAGGGAGGGAAAAAAGG + Intronic
932281407 2:70495836-70495858 TACTGAGCAGGAGGGGAAAATGG - Intronic
932912325 2:75818563-75818585 CAGAGCCTAGGAGGGAAAAATGG - Intergenic
933160190 2:79015324-79015346 CAGAGTGGAGGAGAGGAAGATGG - Intergenic
933386152 2:81613115-81613137 CAGTTGGTAGGAGGGGAGAATGG - Intergenic
933650689 2:84847589-84847611 CAGTGGCCAGGAGGGGAGAAAGG + Intronic
934956902 2:98630787-98630809 CAGTGGGTAGGAGAAGAAAAGGG + Intronic
937748214 2:125441004-125441026 CAGTGACTAGAAGGGGACAAAGG - Intergenic
938506206 2:131886437-131886459 GTGTGTGTTGGAGGGGAAAGAGG + Intergenic
938635768 2:133224697-133224719 CAGAGAGGAGGAGGAGAAAATGG - Intronic
939195459 2:138965648-138965670 CAGGGTGGAGGAGGGGAGGAGGG - Intergenic
939308335 2:140437806-140437828 CAGTGGGAAGAAGGGGGAAAGGG + Intronic
939629768 2:144517203-144517225 CAGGGAGAAGGAGGGGGAAAGGG - Intronic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
939857759 2:147381073-147381095 CAGTGTGAAGAAGGAGAGAAAGG + Intergenic
940597958 2:155819060-155819082 CATGGTGTTGGAGGGAAAAATGG + Intergenic
940815017 2:158288166-158288188 CAGAGTGTAGGAGGAAAACATGG - Intronic
941067861 2:160923733-160923755 CACTGTCTAGGTGGGGAAACTGG + Intergenic
942047011 2:172105498-172105520 GAGTGTGAGGGAGGGGGAAAGGG + Intergenic
942158672 2:173159042-173159064 CATTTTGTAGGAAGGAAAAAAGG + Intronic
942946589 2:181680647-181680669 AAGTGGGGAGGAGGGGAGAACGG - Exonic
943528919 2:189054015-189054037 CACTGTGTAGGAGGAGATAGTGG + Intronic
944904526 2:204249629-204249651 CAGGGTGTGGGAGGAGAAAAAGG - Intergenic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945697361 2:213124391-213124413 CATTGTGCAGAAGGGGGAAAGGG + Intronic
946051242 2:216864233-216864255 CAGGCTGGAGGAGGGGAAAGTGG + Intergenic
947093668 2:226542287-226542309 CATTGGTGAGGAGGGGAAAATGG + Intergenic
947131476 2:226930997-226931019 TAGTGTGAATGTGGGGAAAAGGG + Intronic
947784888 2:232808016-232808038 GAGTGTGTAGGTGAGGAAAGTGG + Intronic
947864415 2:233386399-233386421 CAGTGTGAAGGACTGGGAAATGG - Intronic
947880110 2:233501277-233501299 CAGTGAGTAAGAGGGGGAAATGG + Intronic
948166481 2:235866545-235866567 CAGTGTGCTGGAGGGGGAAGGGG + Intronic
1168848664 20:961792-961814 GAGTGTGTAGGTGGGTAAATAGG - Intronic
1169026582 20:2376521-2376543 CAGTTTTTAGGACGGGAAAAAGG + Intergenic
1169448067 20:5688764-5688786 CCGTGGGGAGGACGGGAAAAGGG - Intergenic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1171521851 20:25782132-25782154 CACTCTGTGGGAAGGGAAAAGGG + Intronic
1171554974 20:26073751-26073773 CACTCTGTGGGAAGGGAAAAGGG - Intergenic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1173870565 20:46339379-46339401 TAGTGGGTAGGAGGGGAAGCAGG + Intergenic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1175598973 20:60257383-60257405 CAGTTTGGAGGAGGGGAAGATGG - Intergenic
1175682453 20:60999940-60999962 CAGTGCAAAGGAGGAGAAAAAGG - Intergenic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176245413 20:64094606-64094628 CAGTGTGTGGGGGGGGACAGTGG + Intronic
1176655651 21:9587068-9587090 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1177570610 21:22881407-22881429 CAGTTTGTACTGGGGGAAAAAGG - Intergenic
1177986025 21:27975942-27975964 GTGTGTGTTGGAGGGGAAAGAGG - Intergenic
1179894752 21:44355203-44355225 CTGTGGGGAGGAGGGGCAAAGGG - Intronic
1180749262 22:18113156-18113178 CAGTGGGTAGCTGGGGAGAAGGG - Intronic
1181116647 22:20635841-20635863 CAGTGAGTATGAGGGGTCAAGGG - Intergenic
1181360283 22:22328933-22328955 CAGGATGTAGGAGGGGGAAGTGG - Intergenic
1182899508 22:33886218-33886240 CCAAGTGTAGGAGAGGAAAATGG - Intronic
1183174843 22:36215607-36215629 CAGTGGGCAGGAGGAGAAAGAGG - Intergenic
1184281668 22:43440933-43440955 CAGTGGGCAGGAGGGGAATGAGG - Intronic
949146053 3:701261-701283 CACTGTGGAGGATGGGAGAATGG + Intergenic
950213408 3:11140484-11140506 CAGGGTGTACGAGGGCAAAGAGG - Intronic
951355242 3:21659055-21659077 TAGTGAGGAGGAGGAGAAAAAGG - Intronic
951662014 3:25077359-25077381 CAGTCTGTAGGGGAGGAGAACGG - Intergenic
952215206 3:31271468-31271490 CAATGTGTGGGAGGGGACTAAGG + Intergenic
953571604 3:44076018-44076040 CAGGGTGAAGGAGGGGATAAGGG + Intergenic
954601677 3:51875265-51875287 CAGAGTGTATGGGGGGAAATAGG + Intronic
954795055 3:53157129-53157151 ATGTGTGTAGGTGGGGAGAAGGG - Intronic
956185361 3:66557233-66557255 GAGTGGGTAGATGGGGAAAAGGG + Intergenic
956371097 3:68562702-68562724 CAGTATGTTGGAAGGGAATATGG + Intergenic
957606514 3:82406559-82406581 CAGAATAGAGGAGGGGAAAATGG + Intergenic
958821766 3:98982671-98982693 CAGTATGTAGAAGGAGAAGAAGG + Intergenic
959353299 3:105295667-105295689 CAGAGGGTAGGAGGAGAAAGAGG + Intergenic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
960069847 3:113417438-113417460 AAATGTGTAGGAAGGGTAAATGG + Intronic
960319594 3:116218468-116218490 CAGGTTGTGGGAGGGGAAAATGG - Intronic
962129044 3:132652814-132652836 CAGTGTGTAGGTGGGGGTAAAGG + Intronic
962468882 3:135687445-135687467 GTGTGTGTTGGAGGGGCAAAGGG + Intergenic
963005503 3:140723200-140723222 CAGTGTGGAGGGGTGGAACATGG - Intergenic
963347463 3:144112503-144112525 CAGTATGGAAGACGGGAAAAGGG + Intergenic
964342283 3:155720352-155720374 CAGTGTGGATGTGGTGAAAAGGG - Intronic
965417676 3:168417258-168417280 CACAGTGTGGGAGGGTAAAAGGG + Intergenic
965964132 3:174466487-174466509 TACTGTGAAGCAGGGGAAAATGG + Intronic
966220627 3:177547683-177547705 AAGGGAGTTGGAGGGGAAAAGGG - Intergenic
966266391 3:178049638-178049660 CAGTGTGTGAGAAGTGAAAATGG - Intergenic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
967493258 3:190117280-190117302 TGGTGTGTTGGAGGGGAAGAAGG - Intronic
969280395 4:6166915-6166937 CAGGGTGGAGGAGGGGAAGTTGG - Intronic
969709005 4:8831997-8832019 AAGGGTGCAGGAAGGGAAAACGG + Intergenic
969836706 4:9848268-9848290 GGCTGTGTAGAAGGGGAAAAAGG - Intronic
969861195 4:10036671-10036693 CTGTGTGTAGTATTGGAAAAAGG - Intronic
970115430 4:12689489-12689511 CAGTTTGTGGTAGGGGAATATGG - Intergenic
970298752 4:14659719-14659741 CAGTGAGTAGGGGGCGAAAGTGG - Intergenic
970638493 4:18036954-18036976 AAGAGAGGAGGAGGGGAAAATGG - Intergenic
971383792 4:26125043-26125065 CAGCCAGTAGGAAGGGAAAAAGG + Intergenic
972919684 4:43922820-43922842 GATTGAGTAGGAGGGGAAAGGGG + Intergenic
973279633 4:48345264-48345286 CAGTGTGTGGCAGGGAGAAAGGG - Intronic
974989974 4:69075420-69075442 AAGTGTGTAGAGGGAGAAAAAGG - Intronic
975448913 4:74501307-74501329 CTATGTGTGTGAGGGGAAAAGGG + Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
976098193 4:81531702-81531724 CAGTATTTTGGAGTGGAAAATGG + Intronic
976490991 4:85670118-85670140 CAGTTTATTGGAGAGGAAAATGG - Intronic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
978367037 4:107993173-107993195 GAGTGGATATGAGGGGAAAAGGG - Intronic
978664001 4:111161739-111161761 CAGAGTGTAGGGAGGGTAAATGG + Intergenic
978996806 4:115166882-115166904 GAGTGTGTAGGAGTTTAAAAAGG - Intergenic
979469840 4:121082427-121082449 CATTGAGTAAGAGGAGAAAAAGG + Intergenic
980142689 4:128939499-128939521 CAGAATGTTGGATGGGAAAAGGG + Intronic
980660541 4:135852971-135852993 CATTATGTAGGAAGAGAAAATGG - Intergenic
980932676 4:139196493-139196515 AAGTGAGCAGGAGGGGAAGAAGG + Intergenic
981827300 4:148958103-148958125 AAATGTGTAAGAGGGAAAAAAGG - Intergenic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
983578948 4:169288375-169288397 CAGTGTGGGGGCGGGGAAGAAGG + Intergenic
984507380 4:180636770-180636792 CAGTGTGGAGGAAGGGGAAAGGG - Intergenic
984630373 4:182054211-182054233 CAGTGGGCAGGAGGAGAGAAGGG - Intergenic
986090070 5:4495588-4495610 CTGTCTGTGGGAGGGTAAAATGG - Intergenic
988300499 5:29419245-29419267 CAGTGTTTTGGAGGCAAAAATGG - Intergenic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989246011 5:39255580-39255602 CAGTATCTAGGTGTGGAAAATGG - Intronic
990049646 5:51482023-51482045 CTTTGTGAAGGAGGGGACAAAGG - Intergenic
990320473 5:54625145-54625167 TAGTGTGTATGAGGGGAAGGGGG + Intergenic
990886991 5:60606078-60606100 TAGTGTATGGGAGGAGAAAATGG - Intronic
991987067 5:72299805-72299827 GAGTGAGGAGAAGGGGAAAAAGG - Intronic
992746652 5:79827252-79827274 GAGAGAGTAGGAGGGGAAGAAGG - Intergenic
993679005 5:90851899-90851921 CAAAGGGTGGGAGGGGAAAAGGG + Intronic
993973378 5:94446976-94446998 TGGTGTGTAGGAGAGCAAAAAGG + Intronic
994000816 5:94776808-94776830 CAGTGTGTCTGAGTGGAAGAAGG - Intronic
994153637 5:96477817-96477839 CAGAGAGTAGGAGGGTAAACAGG + Intergenic
995613820 5:113939517-113939539 AAGTCTGTGGGTGGGGAAAAAGG - Intergenic
996421974 5:123272185-123272207 CAGAGTGTTGGAGGTCAAAATGG + Intergenic
996603768 5:125296726-125296748 CAGTGTGGAGGAGGGGATGGAGG + Intergenic
996868022 5:128151870-128151892 TACTGTGTAGCAGGGGAAATTGG + Intronic
997627351 5:135339979-135340001 CAATGCTTAGGAGGGGAAAGAGG + Intronic
997728214 5:136140437-136140459 CACAGTGTACGAGGGGGAAAAGG - Intronic
997965163 5:138351223-138351245 TAGTTGGTAGGAGGGGAACAAGG - Intergenic
998059533 5:139108852-139108874 GGATGTGAAGGAGGGGAAAAGGG + Intronic
998817234 5:146026910-146026932 CAGGGTTTAGGAGTGGTAAATGG + Intronic
998923265 5:147094638-147094660 GAGGGTGGAGGATGGGAAAAGGG + Intergenic
999234779 5:150083902-150083924 AAGTGGGCTGGAGGGGAAAAGGG - Intronic
999621922 5:153482494-153482516 CAGTGTGTAGGCATGGCAAAAGG - Intergenic
1000719859 5:164693236-164693258 CAGTCATTAGCAGGGGAAAATGG - Intergenic
1001319138 5:170666019-170666041 CAGTGTGTAAGAGGGGAGGGAGG - Intronic
1001841838 5:174883016-174883038 CAGTGTGTGGGAGTGGCAATAGG - Intergenic
1002948423 6:1784703-1784725 CACTGTGAAGCATGGGAAAATGG - Intronic
1003237974 6:4315816-4315838 CAGTGTGTTGGTGTGGAAGATGG - Intergenic
1004190413 6:13458607-13458629 CATTTTGTAGAAGAGGAAAATGG - Intronic
1006019605 6:31110325-31110347 CAGCTTGTGGGAGGGGAGAAAGG - Intergenic
1006339068 6:33436233-33436255 CAGTGTGTTGAAAGGGAACATGG - Intronic
1006783684 6:36650342-36650364 CAGTGTGTTGTAGGGGAAGAAGG - Intergenic
1007630296 6:43269710-43269732 CAGCGTGGAGGAGGAGAACACGG - Intronic
1007787491 6:44289574-44289596 CAGTGGGAAGGAGGAGAGAAGGG - Intronic
1008124011 6:47648651-47648673 CTGAATGGAGGAGGGGAAAAGGG - Intergenic
1009213935 6:60896775-60896797 GGGTTTGGAGGAGGGGAAAACGG - Intergenic
1010638659 6:78293387-78293409 CAGTGTCTAGGAGTAAAAAATGG + Intergenic
1010713850 6:79206311-79206333 CAGAGTTTAGGAGGAAAAAATGG + Intronic
1010732165 6:79402847-79402869 CAGTGTGTCTGAGTGGAAGAAGG - Intergenic
1011543581 6:88460150-88460172 CATTGTGTGTTAGGGGAAAATGG + Intergenic
1011682155 6:89793712-89793734 CAGTGTTTAGTAGGGGGAAGGGG + Intronic
1012545448 6:100413884-100413906 CAGTGTGCAGAAGGGTAAAGAGG - Intronic
1013961721 6:115908958-115908980 CAGTGGGGAGGAGGGGTACATGG - Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014248895 6:119096120-119096142 CATTGGGTACCAGGGGAAAAAGG + Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1020517231 7:9138347-9138369 CAGTTTGTAGGTAGAGAAAACGG + Intergenic
1020666016 7:11045055-11045077 CAGAATGTAGGATGGGGAAAAGG - Intronic
1020918722 7:14233668-14233690 CTGCGTGGAGGAGGGGAGAAAGG + Intronic
1023560457 7:41467979-41468001 GAGTGTGCAGGATGGGAAAGGGG + Intergenic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1025282338 7:57637207-57637229 CACTCTGTGGGAAGGGAAAATGG + Intergenic
1025302392 7:57828312-57828334 CACTCTGTGGGAAGGGAAAATGG - Intergenic
1025999236 7:66548495-66548517 AGGTGAGAAGGAGGGGAAAACGG + Intergenic
1026879944 7:73901803-73901825 CAGTGAGGAGGAGGAGTAAAGGG - Intergenic
1028023517 7:85807635-85807657 TAGTTTGTAGGTGGGGAAAGAGG - Intergenic
1028514268 7:91659173-91659195 CAGTATGTAGGAAGGAAAATAGG - Intergenic
1029647652 7:101868494-101868516 CAGTGTGTAAGATGAGCAAAGGG - Intronic
1030067849 7:105674140-105674162 CAGTGGGTAGGAGGTGAAGAGGG - Intronic
1030469928 7:109951224-109951246 GAGTGGGTTGGAGGGGAAAGAGG - Intergenic
1030616524 7:111743480-111743502 CAGTGTGTATGAGGCATAAAGGG + Intronic
1030740386 7:113102426-113102448 AAGTGGGGAGCAGGGGAAAATGG - Intergenic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031125215 7:117765680-117765702 CAGGGTGGAGGAGAGGGAAATGG - Intronic
1032034809 7:128513915-128513937 CTTTGTGAAGGAGAGGAAAAAGG - Intergenic
1032396915 7:131597127-131597149 CACTGAGTAAGAGGGGAGAATGG - Intergenic
1033357725 7:140614010-140614032 CAGTGAGCAGGAGGGGAAGGAGG - Intronic
1033781412 7:144674045-144674067 CACAGTGCAGGAAGGGAAAAGGG + Intronic
1033813477 7:145045301-145045323 CATTGTGGAGGAGGAGGAAATGG - Intergenic
1034337701 7:150334002-150334024 CTGTGTGTTGGAGGGCAACAGGG + Intronic
1034569669 7:151945077-151945099 AAGTGGGGAGGAGGGAAAAAAGG - Intergenic
1035383047 7:158452559-158452581 CTGTGAGTGGGAGGGGAAATCGG - Intronic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1036389485 8:8312082-8312104 CAGGGGAAAGGAGGGGAAAATGG + Intergenic
1036397546 8:8381919-8381941 CAGGGAGAAGGAGGAGAAAAAGG + Intronic
1036747466 8:11420083-11420105 AAGTGGGGAGGAGGGGCAAAGGG - Intronic
1037384817 8:18327042-18327064 CAGGGTGTAGGAGGTGGAGAGGG - Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038183053 8:25246825-25246847 CAGAGTGTGGGAGGGAAGAATGG + Intronic
1038427589 8:27474278-27474300 CAGAGTGTTTTAGGGGAAAAGGG + Intronic
1039110181 8:34033246-34033268 CATTGTGTAGGAGGGGGGAATGG + Intergenic
1039239375 8:35538543-35538565 CAGTGTGTAGGAGGGATTAAAGG + Intronic
1039712255 8:40067580-40067602 CAGTGTGTATGATAAGAAAATGG + Intergenic
1039739028 8:40362940-40362962 TAGTGTCTGGGAGGGGCAAATGG - Intergenic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG + Intergenic
1043012034 8:74893144-74893166 CATGGTGTAGGAAAGGAAAAGGG - Intergenic
1043162626 8:76864556-76864578 CAGTGTGTAGGAGTGAAGACAGG + Exonic
1044558444 8:93589570-93589592 CAATTTGTGGGAGGGTAAAAAGG - Intergenic
1045262121 8:100585371-100585393 CACTGTGTTGGAGGGGAGGATGG + Intronic
1045277285 8:100720150-100720172 CAGCCTGTAGGGGGGGAAAAAGG + Intronic
1046037925 8:108866331-108866353 CATTGTGTAGGAAGCCAAAATGG - Intergenic
1046276039 8:111961277-111961299 GAGTTGGTGGGAGGGGAAAATGG + Intergenic
1046917363 8:119691917-119691939 CAGAGCCTAGGAGGGAAAAATGG + Intergenic
1048771861 8:137903708-137903730 CACTTTGAAGGAGGGGAAAGGGG + Intergenic
1050607272 9:7314835-7314857 CAGTGTGTAGAGTGGGGAAAGGG + Intergenic
1051046982 9:12887484-12887506 AAGAAAGTAGGAGGGGAAAATGG - Intergenic
1051343943 9:16135829-16135851 CAGTATGGAGGAGGGAAAAAAGG + Intergenic
1051400910 9:16681320-16681342 CATTTTATCGGAGGGGAAAAAGG + Intronic
1052556724 9:30028014-30028036 CTGTGCATAGGAGAGGAAAAAGG + Intergenic
1055746379 9:79450021-79450043 CAGTATGGAAGTGGGGAAAAAGG - Intergenic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1057344983 9:94242029-94242051 GAGGGTGGAGGATGGGAAAAGGG - Intergenic
1058322836 9:103656335-103656357 TAGCTTGTAGGATGGGAAAATGG + Intergenic
1059614650 9:115935844-115935866 CTGTGTGGGGGTGGGGAAAATGG - Intergenic
1061237559 9:129351559-129351581 AAGAGGGTAGGAGGGGAGAAGGG + Intergenic
1061239039 9:129358610-129358632 CAGGGTGTGGGAGGGGAAAGAGG - Intergenic
1061682524 9:132250095-132250117 CTGTGGGCAGGAGGGGAAAGGGG - Intergenic
1062085030 9:134643922-134643944 CAGTGTGGAGGTGGGGAGATGGG - Intronic
1203633364 Un_KI270750v1:90483-90505 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1186809916 X:13178192-13178214 GAGAGTGTAGAAGGGGAAAACGG - Intergenic
1186916025 X:14222006-14222028 CAGTATGTGGGAGGTGAATAAGG + Intergenic
1188505971 X:30885512-30885534 CACTATGAAGGAGGGCAAAAAGG + Intronic
1188983886 X:36752478-36752500 GAGTTGGTAGGAGGGGAAAGGGG + Intergenic
1189234260 X:39475637-39475659 CTGTGTGTAGGAGGGATCAAAGG + Intergenic
1190988954 X:55526072-55526094 GACTATGTGGGAGGGGAAAAGGG + Intergenic
1192450888 X:71244241-71244263 CAGGGAGGAGGAGGGGAAAGGGG - Intronic
1192568219 X:72181261-72181283 CTGTGTGTAGGAGGAGACAGCGG + Intergenic
1193676369 X:84457913-84457935 CAGTGTGGGGGAGGGGAAATTGG + Intronic
1193810571 X:86046335-86046357 CATTTTGTAGAAGAGGAAAAGGG - Intronic
1194205858 X:91010333-91010355 CAGTTGTTAGTAGGGGAAAATGG - Intergenic
1195216455 X:102708992-102709014 CAGTGAGTAAGAGGGACAAAAGG + Intergenic
1195328426 X:103776742-103776764 CCCTGAGTAGGTGGGGAAAAGGG + Intronic
1199411756 X:147532220-147532242 CAGTGTAGAGGAAGGGAGAATGG - Intergenic
1200397055 X:155997328-155997350 CAAAGTGTAGAAGGGGACAAGGG + Intergenic
1200551614 Y:4585144-4585166 CAGTTGTTAGTAGGGGAAAATGG - Intergenic