ID: 959397605

View in Genome Browser
Species Human (GRCh38)
Location 3:105860637-105860659
Sequence AGGGAGAAGAAATATTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959397605_959397609 3 Left 959397605 3:105860637-105860659 CCTTCTTAATATTTCTTCTCCCT 0: 1
1: 0
2: 5
3: 57
4: 701
Right 959397609 3:105860663-105860685 ATATTTTACATTCCATCACAAGG 0: 1
1: 0
2: 0
3: 39
4: 345
959397605_959397611 29 Left 959397605 3:105860637-105860659 CCTTCTTAATATTTCTTCTCCCT 0: 1
1: 0
2: 5
3: 57
4: 701
Right 959397611 3:105860689-105860711 AATCCCTGCAGATTTTGCAAAGG 0: 1
1: 0
2: 2
3: 27
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959397605 Original CRISPR AGGGAGAAGAAATATTAAGA AGG (reversed) Intronic
900921919 1:5678165-5678187 AGTGAGAACAAATAGTGAGAAGG - Intergenic
902662448 1:17914518-17914540 AGGAAGATGAAGTATGAAGAGGG - Intergenic
902972720 1:20066412-20066434 TGGGAAAAGAAATGTTAAGTTGG - Intronic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
905035246 1:34913983-34914005 AGGGAGAAGGGAGAATAAGAAGG + Intronic
905831988 1:41076927-41076949 AGGGACAAGATATACTTAGAAGG + Intronic
906114451 1:43347111-43347133 AGGGAAGAGAAATGTTAAGTAGG - Intronic
906271606 1:44483825-44483847 AGGCAGAAAAAATCCTAAGAGGG - Intronic
906444449 1:45882716-45882738 AGGAAGTAGGAATATTAAAATGG + Intronic
906548637 1:46641742-46641764 AGGTAAAAGGAAAATTAAGATGG - Intronic
908028977 1:59979963-59979985 AGGGAGTAGGAATAATAATAGGG + Intergenic
908366698 1:63431618-63431640 TGGAAGACTAAATATTAAGACGG - Intronic
908600359 1:65732189-65732211 ACAGAGAGGAGATATTAAGATGG - Intergenic
909180198 1:72414338-72414360 GGGGAGAGGATATATAAAGAGGG - Intergenic
909643629 1:77893165-77893187 AGGGAGTAGAATTTTTAAGGAGG - Intronic
911061118 1:93748603-93748625 AGTGAGAAATAATATTGAGAGGG - Intronic
911971154 1:104439639-104439661 AAGTAGAAGTAATGTTAAGAGGG + Intergenic
912227390 1:107750307-107750329 AGAAAAAAGAAATATTAACATGG - Intronic
912892075 1:113544242-113544264 AGGTAGAAGAAGTAATAAGAGGG + Intronic
914493164 1:148166996-148167018 AAAGAGATGAAATACTAAGAAGG + Intergenic
914695774 1:150078147-150078169 AGTGAGAAGAAATAAAAAGTAGG - Intronic
915050180 1:153061205-153061227 AGTGGGCAGAAATAATAAGATGG + Intergenic
915786438 1:158618097-158618119 AGGGAGATGATATGTTAAAATGG + Intronic
915952022 1:160195808-160195830 TGGGGGAACAAATATTAGGAAGG - Intronic
916123195 1:161547485-161547507 AGGTAGGAGAAATATTTTGAAGG - Intronic
916133089 1:161628843-161628865 AGGTAGGAGAAATATTTTGAAGG - Intronic
916989447 1:170226623-170226645 AGGAAGAAGAAATGGAAAGAAGG - Intergenic
917069693 1:171136830-171136852 AGGGACAAGAAATAGAAAAAAGG - Intergenic
917288310 1:173444621-173444643 AGGGAAAAGAAAATTTAAAAGGG + Intergenic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
918876246 1:190047681-190047703 AGGGATAAAAAAGATTAAAAAGG - Intergenic
919707473 1:200691106-200691128 AGGGATAAGAATGTTTAAGAGGG - Intergenic
919719496 1:200817323-200817345 AGAAAGAAGAAACATTAACATGG + Intronic
920611278 1:207440157-207440179 AGGTAGAAGAAAGGGTAAGATGG + Intergenic
920714688 1:208328515-208328537 AGAGAGAAGAGAAATAAAGAGGG - Intergenic
920757525 1:208748549-208748571 AGGGAGAAGGAAGGTGAAGAGGG - Intergenic
920942074 1:210493080-210493102 AAGGAAAACAAATATTCAGATGG - Intronic
922405420 1:225307434-225307456 AGGAAGAAAAAGTATTAAGAAGG - Intronic
923294927 1:232584802-232584824 AGACAGAAGAAAAATTAAAAAGG + Intergenic
923455829 1:234164409-234164431 AGGGAGAGGAAAAAGAAAGAGGG - Intronic
923822745 1:237463950-237463972 AGAAATAAGAAAAATTAAGAAGG + Intronic
923902336 1:238340469-238340491 AATGAGAAGAAATTTAAAGAGGG - Intergenic
923953332 1:238986409-238986431 AGGGTGAGGAAATATTATAATGG + Intergenic
924003028 1:239574723-239574745 AGGGAAAAGAAAGAAGAAGAAGG - Intronic
924147686 1:241093902-241093924 AATTAGAAGAAATATTGAGATGG + Intronic
924313426 1:242771166-242771188 AGGGAGAAGGAATATTAGATAGG - Intergenic
1062771907 10:108046-108068 AGGGAGAAGAAACTTTGAGAGGG - Intergenic
1062973282 10:1664908-1664930 TGGCAGAAGAAATGTTGAGAAGG + Intronic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063698029 10:8356541-8356563 AGGGAGAAAATAAATTAAGAAGG - Intergenic
1064550300 10:16493728-16493750 AGGGAGAAGAGAAAGAAAGAAGG + Intronic
1064720077 10:18220075-18220097 AAGGAGAAGAGGAATTAAGATGG - Intronic
1064841685 10:19599634-19599656 AGGTTGAAAAAATATTAATAAGG + Intronic
1065061533 10:21907085-21907107 AGGAAGAAGAAACATTAACAGGG - Intronic
1065086366 10:22182542-22182564 AGGGAGAGGAAATAATATGCTGG - Intergenic
1065147630 10:22786770-22786792 AGGGAAAACAAATATCAATATGG - Intergenic
1065590589 10:27258194-27258216 AGGGAGTAGGAATATTGAGGCGG - Intergenic
1066479543 10:35782265-35782287 TGGGAGAAGAAAGATTGAGTTGG + Intergenic
1066514823 10:36146441-36146463 AGGGAGAAAAAATAAGCAGAAGG + Intergenic
1066539419 10:36429196-36429218 AGGGAGAAGAAAAAAGCAGAGGG - Intergenic
1066552142 10:36570831-36570853 AGGCAGAAGAACTAAAAAGAGGG - Intergenic
1068104012 10:52591528-52591550 AGGGAGCAGAAAGCTTAATAGGG - Intergenic
1068120255 10:52777317-52777339 ATGAAGTAGAAATATTAACATGG + Intergenic
1068637549 10:59363552-59363574 TGGGAGTAGAAAGATTAAAAAGG - Intergenic
1068645597 10:59463218-59463240 AGGAAGAAGAAATAATTAGCAGG + Intergenic
1068691725 10:59922868-59922890 AAGGAGAAGAGATAGAAAGAGGG + Intergenic
1069277611 10:66612199-66612221 AGGAATAAGAATTTTTAAGATGG - Intronic
1069647168 10:70009101-70009123 AGGGAAAAGTAATGGTAAGAGGG + Intergenic
1069734897 10:70647641-70647663 AGAGAGAAGAAAGCTTCAGATGG - Intergenic
1070011307 10:72477266-72477288 AGAGAAAAAAAATATTTAGAAGG + Intronic
1070128354 10:73639792-73639814 TGGGAGAGGGAAGATTAAGAAGG - Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1071834379 10:89405364-89405386 AGGCACAACAAATAATAAGAAGG + Intronic
1071880525 10:89892173-89892195 AGGGAGAAGGACTATTGAGAAGG - Intergenic
1072271895 10:93784666-93784688 AGGAGGAAGAAAAATTATGAAGG - Intronic
1072468796 10:95693054-95693076 AGGGAGAAGATATATTTAGAAGG + Intronic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073551053 10:104401835-104401857 ATGCAGAAAAAATATAAAGAAGG + Intronic
1073696719 10:105877443-105877465 AGGGAAAAGACATATTTAGTTGG + Intergenic
1075482739 10:122796440-122796462 AGGAAGAAGAAAGAATAAGAAGG + Intergenic
1077831808 11:5880693-5880715 TGGGAGAAGAAATATTACAGAGG + Intronic
1077981185 11:7302368-7302390 AGGGAAAAGCATTATTTAGAAGG - Intronic
1078097395 11:8308966-8308988 AGTGAGAAAAAATCCTAAGAAGG + Intergenic
1078352413 11:10605218-10605240 AGGGAGAAGAAATAGACAGATGG + Intronic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1078968259 11:16373038-16373060 AGGAAGAAAAAATAGTGAGAAGG + Intronic
1079270866 11:18984478-18984500 AGGGCTAAGAAAAATTAAGCTGG + Intergenic
1079284990 11:19120746-19120768 AGGGAAAAAAAATTTAAAGAGGG - Intronic
1079980271 11:27143796-27143818 AGAGAGTAGAAATCTAAAGAAGG + Intergenic
1079986543 11:27206177-27206199 AGGGAGAAAGAAAAGTAAGATGG - Intergenic
1080096322 11:28412085-28412107 AGGGATAAGAAATGTTAATGAGG + Intergenic
1081372101 11:42316599-42316621 AAGGAGAAGAATTTTTACGAAGG - Intergenic
1082125717 11:48429173-48429195 AGGGAAAGAAAATATCAAGAAGG - Intergenic
1083100563 11:60301305-60301327 ATTGAGAAGAAATATCAAGTGGG + Intronic
1083546825 11:63555052-63555074 AGGGAGGTGAAATATTACAAAGG + Intronic
1083925431 11:65803326-65803348 AGGAGGAAGAAATACTAACACGG + Intergenic
1084028623 11:66467686-66467708 AGGGGCAAGAAAGATTCAGATGG + Intronic
1084156369 11:67315138-67315160 AGGGGCAAAAAATAATAAGAAGG + Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1085079576 11:73623032-73623054 AAGGACAAAAAATATTATGATGG + Intergenic
1085713184 11:78848698-78848720 AGGGAGATGAAAGATTTATACGG - Intronic
1085813784 11:79713472-79713494 AGGAAGAATCAATATTAAAATGG - Intergenic
1086158685 11:83696231-83696253 AGGGAGAACTAATATTAGGAAGG + Intronic
1086518262 11:87639886-87639908 AGGGAGAAGAAACCTGCAGAGGG - Intergenic
1086875241 11:92087922-92087944 AGGGAGAGGAAAGATGGAGAGGG - Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087243022 11:95801686-95801708 AAGAATAAGAAATATTAAGAAGG + Intronic
1087435195 11:98107457-98107479 AGGAAAAAAAAATATTAAAATGG + Intergenic
1087935567 11:104030556-104030578 AGTGTGAAGAAATGTTAGGATGG + Intronic
1087993538 11:104775971-104775993 AGGAAAAAGTAATATAAAGATGG - Intergenic
1088207351 11:107408423-107408445 AGGGTTAAGAAATATTTAGCAGG + Intronic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088509256 11:110557964-110557986 AGAGAGAAGAAATTGTAAGAAGG - Intergenic
1090599195 11:128352797-128352819 AGGGAGAAGAAATAAATAGACGG + Intergenic
1090618346 11:128537886-128537908 AGGGAGAAGAAGTAATGAGATGG + Intronic
1092405012 12:8215100-8215122 GGGGAAAAGTGATATTAAGAAGG - Intergenic
1092951211 12:13505251-13505273 AGGGAGAAGATAGACTAAGTTGG + Intergenic
1093863656 12:24198749-24198771 AGGGAGAAGAAAGATTCACCAGG + Intergenic
1094050873 12:26219322-26219344 AGGGAAAAAAAATAATAAGCAGG + Intronic
1094364806 12:29668980-29669002 AGTGAGAAAAAATGGTAAGAAGG + Intronic
1094426560 12:30322464-30322486 AGGGAGAAAAGACTTTAAGAAGG + Intergenic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095279927 12:40338264-40338286 AGGGAGCAGAGATACAAAGATGG + Intronic
1095376618 12:41536775-41536797 AAGAAGAAGAAAAATCAAGAAGG - Intronic
1095709175 12:45269883-45269905 AGGGAACTGAAGTATTAAGAGGG + Intronic
1096993371 12:55822840-55822862 AGGGATATGAAATACTAAGTGGG - Intronic
1097323502 12:58250452-58250474 AGGGAGGAGAAATATGGGGAGGG + Intergenic
1097370320 12:58770855-58770877 AGGGAGAATGAATATTAAAATGG + Intronic
1097722611 12:63039644-63039666 AGGGAGAAGAGATGTTGAGTAGG + Intergenic
1097989226 12:65817677-65817699 AGAGTCAAGAAATATTTAGAAGG + Intergenic
1098165141 12:67688862-67688884 AGTTAGAAGAAATATTCAGTTGG + Intergenic
1098859731 12:75694610-75694632 AGAGAGAATATATCTTAAGAGGG + Intergenic
1099119662 12:78672445-78672467 AGGGAGAAGAAGTAAAAATATGG + Intergenic
1099213881 12:79830003-79830025 AGGGAGAGAAAATGTGAAGAAGG + Intronic
1099235852 12:80081839-80081861 AGTGAGACAAAATATTAACAAGG - Intergenic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1100324926 12:93531649-93531671 AGGGAGAAGACACATGGAGAAGG - Intergenic
1101529443 12:105560735-105560757 AGGAAGAAGGAACATTAAGCGGG - Intergenic
1101956271 12:109215115-109215137 AGGGAGAAGCAAAATTTACATGG + Intronic
1101972591 12:109326310-109326332 TGGGAGAAGAAAGACCAAGAAGG - Intergenic
1102112620 12:110376192-110376214 AGAGAACAGAAATATGAAGATGG - Exonic
1102184140 12:110934608-110934630 AGAGAGAAGAAAGACAAAGAGGG + Intergenic
1102478348 12:113203328-113203350 AGTTAGAAGAATTGTTAAGAAGG - Intronic
1102698281 12:114817049-114817071 AGGGAAAAGAAAAAGTAAAATGG - Intergenic
1102745181 12:115243802-115243824 AGGGAGGAGAAATAAGGAGAGGG + Intergenic
1102785793 12:115603712-115603734 ATGGAGAAGAAATAGCAATAGGG - Intergenic
1102815354 12:115860827-115860849 TGGGAGAAGAAACAGGAAGATGG - Intergenic
1103091757 12:118103180-118103202 AGGGAGGAGAAAAATAAAGTGGG + Intronic
1103115811 12:118330721-118330743 AGGGAAAAGAAAAAGAAAGAAGG + Intronic
1103801430 12:123540366-123540388 AGGAGGAATAAAGATTAAGAAGG + Intergenic
1103829569 12:123768086-123768108 ACGGAGAAGAAAGATACAGAGGG - Intronic
1106244315 13:27934299-27934321 AGGGAAATGACTTATTAAGAAGG - Intergenic
1106244320 13:27934543-27934565 AGGGAAATGACTTATTAAGAAGG + Intergenic
1106300247 13:28457896-28457918 AAGGAAAAGAAATCTAAAGATGG - Intronic
1106416007 13:29546447-29546469 TGGAAGAGGAAATATTTAGAAGG - Intronic
1106699374 13:32212578-32212600 AGAGAAGAGAAAGATTAAGAAGG + Intronic
1107651139 13:42546424-42546446 AGGGAGAATTAACATTAAGATGG + Intergenic
1107733723 13:43374218-43374240 AGATAAAAGAAAGATTAAGAAGG - Intronic
1108702233 13:52953470-52953492 AGAGAGAAGAAATTCTAAGAAGG + Intergenic
1108757844 13:53525593-53525615 AGGTAGAAGAAAAATAAACAGGG + Intergenic
1109247804 13:59977852-59977874 AGGGAGAAGAAAGATAAATTTGG + Intronic
1109374567 13:61474456-61474478 AGAGAGTAAAAATATTAAGCTGG + Intergenic
1109460949 13:62656919-62656941 AGGTATAAGAAATATTTACATGG + Intergenic
1110081543 13:71320204-71320226 AGGAAGAAGACAGAATAAGATGG - Intergenic
1110921533 13:81093380-81093402 AGGAACAATAAATATTAATATGG + Intergenic
1110965202 13:81685940-81685962 AGGCACAAGACATATAAAGAAGG - Intergenic
1111315615 13:86554809-86554831 AGGCACAAGAAATAATAAGAAGG + Intergenic
1111407979 13:87834914-87834936 AGGGAGAAGAAGTTTTAATTAGG + Intergenic
1111706523 13:91756399-91756421 ATGGAGAAGATATAGTAAAAAGG + Exonic
1111879931 13:93943677-93943699 AGGGTGAAGAAATTTTAAAAAGG - Intronic
1112496757 13:99911384-99911406 AGGGAGGAGAAAGAGTCAGAGGG - Intergenic
1113673397 13:112190628-112190650 AGGGAGAAGCCATGTAAAGATGG - Intergenic
1114469807 14:22952508-22952530 TGGGAGAAGAGATAAGAAGAAGG - Intronic
1114873180 14:26682761-26682783 AGGAGGAATAAATATTAAAATGG - Intergenic
1115069909 14:29308847-29308869 TGTGAGGAGAAATATCAAGATGG + Intergenic
1115370839 14:32612489-32612511 AGGAAGAACAGATGTTAAGATGG - Intronic
1115763606 14:36600455-36600477 AGAAAGAAGAAATTTTAATAGGG + Intergenic
1115828843 14:37311344-37311366 AGGGAGAAAAGATAGGAAGAGGG - Intronic
1116019846 14:39447094-39447116 AAGGAGAAAAAAAATTAAGGAGG + Intergenic
1116175549 14:41465599-41465621 AAGGACAATAAACATTAAGAAGG + Intergenic
1116784258 14:49269898-49269920 AGGGAGAAGAATGAATAAAAGGG - Intergenic
1117120539 14:52563742-52563764 AGGGAGAAAGAATATTGAGAAGG - Intronic
1117748019 14:58891342-58891364 GGAGAGAAGAAAAATAAAGATGG - Intergenic
1117794407 14:59377308-59377330 AGAGGGAAGAAATAATAAGGAGG + Intergenic
1118667560 14:68086685-68086707 AGGGAGAATTAATCTTAGGATGG + Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120509740 14:85398865-85398887 AGGAACAACAAATATGAAGATGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1121771266 14:96543184-96543206 GAGAAGAAAAAATATTAAGAAGG - Intronic
1121809657 14:96872180-96872202 AGGGAGAAGAAATAAAAAGATGG - Intronic
1121821088 14:96966717-96966739 AGTGAGGAGAAATTGTAAGAAGG - Intergenic
1122218738 14:100221852-100221874 AGGGAGAAGGAATATTGGGGAGG + Intergenic
1122240913 14:100366499-100366521 AGGTAGAAAACAAATTAAGATGG + Intronic
1122429505 14:101631007-101631029 AGGCAGAAGAAAGATTAACTTGG - Intergenic
1124409530 15:29424621-29424643 AGGGAGAAGAGGTACTGAGAGGG + Intronic
1124927377 15:34083580-34083602 AGGGAGGACAAATAATAACAGGG - Intergenic
1125033370 15:35095241-35095263 AGGGAGGAGAAAGAATACGAGGG + Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125178921 15:36859361-36859383 AGGGAGAAGAAATATTCTCTGGG - Intergenic
1125310216 15:38371161-38371183 AGGAAGTAGAAATAAGAAGATGG + Intergenic
1125431769 15:39602586-39602608 ATGGAGAAGAAATATTAAACAGG + Intronic
1125475163 15:40043047-40043069 AGGGAGAGGAAAAACTGAGAGGG - Intergenic
1125764095 15:42121566-42121588 TGGGAGCACAAACATTAAGATGG + Intergenic
1126052326 15:44697275-44697297 AGGAAGAAGAAAGAAGAAGAAGG - Intronic
1126078067 15:44932312-44932334 AGGCAGAAGCAATATAAAGTTGG + Intergenic
1126232617 15:46344577-46344599 AGGGGGAAGAAATATGTAAAAGG + Intergenic
1126519268 15:49572638-49572660 AGGTATAAGACATATAAAGAAGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127735214 15:61833053-61833075 AGGAAGAAAAAATTTAAAGATGG + Intergenic
1127989725 15:64104574-64104596 AGGGAGAAGACTTTTAAAGATGG + Intronic
1128095588 15:64951830-64951852 AAGAAGAAGAAAGAATAAGAAGG - Intronic
1128095681 15:64952916-64952938 AGGAAGAAGAACTAAGAAGAAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129243852 15:74268132-74268154 AGGGTGATGAAATATTCAAATGG + Intronic
1129964831 15:79725090-79725112 TGGGAGAAGAAAGAATAAAAAGG - Intergenic
1131530948 15:93191315-93191337 ATGGTTAAGAAATGTTAAGATGG - Intergenic
1131795278 15:96010035-96010057 AGCTAGAAAAAATATTAACATGG + Intergenic
1132060019 15:98684903-98684925 AGGAAGAAGAAATATATACATGG - Intronic
1132817683 16:1840848-1840870 ATGTATAAGAAATAATAAGAGGG - Intronic
1134167055 16:11939138-11939160 AGAGAGAAGTATTATTTAGAGGG - Intronic
1134493651 16:14714574-14714596 AGAGAGAAGTATTATTTAGAGGG + Intronic
1134499031 16:14753698-14753720 AGAGAGAAGTATTATTTAGAGGG + Intronic
1134525583 16:14940318-14940340 AGAGAGAAGTATTATTTAGAGGG + Intronic
1134546820 16:15116054-15116076 AGAGAGAAGTATTATTTAGAGGG - Intronic
1134547305 16:15120537-15120559 AGAGAGAAGTATTATTTAGAGGG - Intronic
1134581536 16:15375319-15375341 AGAGAGAAGTATTATTTAGAGGG - Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134713168 16:16338806-16338828 AGAGAGAAGTATTATTTAGAGGG + Intergenic
1134721036 16:16382164-16382186 AGAGAGAAGTATTATTTAGAGGG + Intronic
1134946390 16:18329720-18329742 AGAGAGAAGTATTATTTAGAGGG - Intronic
1134953652 16:18369864-18369886 AGAGAGAAGTATTATTTAGAGGG - Intergenic
1135067316 16:19321321-19321343 AGAGAGAAGAAAAAGAAAGAAGG - Intronic
1135312449 16:21416565-21416587 AGAGAGAAGTATTATTTAGAGGG - Intronic
1135365397 16:21849021-21849043 AGAGAGAAGTATTATTTAGAGGG - Intronic
1135446442 16:22522318-22522340 AGAGAGAAGTATTATTTAGAGGG + Intronic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136151623 16:28354543-28354565 AGAGAGAAGTATTATTTAGAGGG - Intronic
1136167856 16:28468384-28468406 AGAGAGAAGTATTATTTAGAGGG - Intronic
1136195119 16:28646630-28646652 AGAGAGAAGTATTATTTAGAGGG + Intronic
1136211457 16:28760746-28760768 AGAGAGAAGTATTATTTAGAGGG + Intronic
1136256179 16:29040697-29040719 AGAGAGAAGTATTATTTAGAGGG + Intronic
1136296343 16:29305680-29305702 GGGGAGCAGAAAGATTAAAAGGG - Intergenic
1136309147 16:29395552-29395574 AGAGAGAAGTATTATTTAGAGGG - Intronic
1136322568 16:29497087-29497109 AGAGAGAAGTATTATTTAGAGGG - Intronic
1136361281 16:29781418-29781440 TGGGGAAAGAAATTTTAAGAAGG + Exonic
1136437248 16:30237059-30237081 AGAGAGAAGTATTATTTAGAGGG - Intronic
1137968379 16:52959220-52959242 AGGAAGAAGAAATAGAAAGAAGG - Intergenic
1138011736 16:53387386-53387408 AGGGAGAAGAAATGTAAGCAAGG - Intergenic
1138188235 16:54993420-54993442 AAGGAGAATAAATCTTAAAATGG - Intergenic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138986130 16:62330873-62330895 AGGGAGAATAATTATAAAGGTGG - Intergenic
1139101987 16:63778735-63778757 TGGTAGAAGAAATATAAACAGGG - Intergenic
1139173633 16:64661998-64662020 TGGGAGAAGACATTTTTAGAGGG + Intergenic
1139810393 16:69610833-69610855 GGAGAGAAGAAATATATAGAGGG - Intronic
1140332481 16:74071232-74071254 AGTGATAAGAAATATTTATAAGG - Intergenic
1140350410 16:74257102-74257124 AGAGAGCAGAAATGTCAAGAAGG + Intergenic
1140365870 16:74380013-74380035 AGAGAGAAGTATTATTTAGAGGG + Intronic
1141099520 16:81186782-81186804 AAGGAGAATGAATATTCAGAGGG + Intergenic
1142057936 16:88011824-88011846 GGGGAGCAGAAAGATTAAAAGGG - Intronic
1144592243 17:16534490-16534512 AGGCAGAAGAAAATTTAACAGGG - Intergenic
1145028938 17:19489867-19489889 AGGGAGAACAAATCTTAGAATGG + Intergenic
1146523463 17:33545679-33545701 AAGGAGAAGAAATTTCTAGAAGG - Intronic
1149048453 17:52275635-52275657 AGAGAGAAGAGAGATCAAGAAGG - Intergenic
1149245965 17:54708137-54708159 AAAGAGAAGAATTACTAAGAAGG + Intergenic
1149338074 17:55658296-55658318 AGGGAGCAGAAATATCTAAAAGG - Intergenic
1149872311 17:60193962-60193984 AGGTAAAAGAAATTTTCAGAAGG - Intronic
1150005551 17:61466695-61466717 AGGGAGAAGAAACAGAAACATGG - Intronic
1150931949 17:69594610-69594632 AGGGAGAAAAAAGATAATGACGG - Intergenic
1150932197 17:69596938-69596960 AGGCAGAAGACAAATTGAGAAGG + Intergenic
1150986622 17:70205120-70205142 AGGGGGAAGAAATTGTAACATGG + Intergenic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1153684143 18:7528592-7528614 AGGGAGACAAAAAAATAAGAAGG - Intergenic
1153897726 18:9582177-9582199 AGGGAGAATAAAGATTAAAATGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1155472491 18:26205469-26205491 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1156093108 18:33494969-33494991 AGGAAGTAGAAATATTTAGGTGG + Intergenic
1156278541 18:35609183-35609205 AGGCAGAAGAAAAGTAAAGAGGG - Intronic
1156352391 18:36312249-36312271 AGGGAGCAGAAGGATTGAGAAGG - Intronic
1156675622 18:39524385-39524407 AAGGAGAAGAAATTTTAAAAAGG + Intergenic
1157089760 18:44623828-44623850 AGGGAAAAGAAATAGAAAAATGG + Intergenic
1157407776 18:47437894-47437916 AGGGAGATGAGATATTATGGTGG + Intergenic
1157486912 18:48094242-48094264 CCGGAGAAGAAATAATGAGAGGG - Intronic
1157812829 18:50709883-50709905 AGAGAGATGAAATGTTAATATGG - Intronic
1158031694 18:52973474-52973496 AGGGAGCAGAAATATGAGAAAGG - Intronic
1159113571 18:64088311-64088333 TGGGAGAAGAAATAAGGAGATGG - Intergenic
1159430401 18:68344874-68344896 AGAGAGAAGAGATACTATGAGGG + Intergenic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1160054934 18:75470168-75470190 AGGGAGAAGAGAAATAAAAAAGG + Intergenic
1160122294 18:76141735-76141757 AGGAAGAAGAAAGAATGAGAAGG + Intergenic
1160660606 19:296658-296680 ATGGAGAAGGAATAGTAAGAGGG - Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1160968181 19:1755713-1755735 AGGGAGAAGAGATAATGAGCAGG - Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1165971452 19:39634570-39634592 AGGAAGAATAAATATGAAAATGG - Intergenic
1166246895 19:41535328-41535350 AGGCAGAAGAAATATCAGCAGGG + Intergenic
1166332591 19:42087685-42087707 GGGGAGAAGAGAAATTCAGAGGG + Intronic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167433060 19:49464307-49464329 AGGGAGAAGGGAGATGAAGATGG - Intronic
1167724851 19:51203876-51203898 TGGTAGAATTAATATTAAGATGG + Intergenic
925652394 2:6104802-6104824 AGGAAAAAAACATATTAAGATGG - Intergenic
925883548 2:8373010-8373032 AGGCAGAAGAAATAGTATTATGG + Intergenic
926283615 2:11470088-11470110 AGGGGGAAGAAATTTTTAAAAGG - Intergenic
926439484 2:12873158-12873180 AGAGAAAAGAAATATAGAGATGG + Intergenic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
927942303 2:27112315-27112337 AGGCACAAACAATATTAAGAAGG + Intronic
928628436 2:33165228-33165250 AGGGAGAGGGACTATTGAGAAGG + Intronic
929276899 2:40035416-40035438 AAGGAGAAGAAATAGCAAAATGG - Intergenic
929315535 2:40473404-40473426 AGGGAAAAGGAATGTTGAGATGG - Intronic
929352373 2:40973120-40973142 AGGGAGAAAAAATATATAGAAGG + Intergenic
929829909 2:45338755-45338777 AGGGAGAAGAATATTTAATAAGG + Intergenic
929872141 2:45768106-45768128 ATGGAGAAGAAACTCTAAGATGG + Intronic
929930571 2:46252568-46252590 AGGGAGAAGAAATAATCTGCAGG + Intergenic
930326812 2:49930169-49930191 AGTGAGAAGAAATTTCAAGGTGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930906634 2:56576434-56576456 AGGGAGAAGAGAGACTAAAAGGG - Intergenic
930989512 2:57635400-57635422 AGAGAAAGCAAATATTAAGATGG - Intergenic
931020496 2:58039473-58039495 AGGGAGAAAAATAATTAAGAAGG - Intronic
931191456 2:60004580-60004602 AGGGAGAGAAAATATTAATAAGG - Intergenic
931946305 2:67312389-67312411 AGGTAGAAAAAATGGTAAGATGG + Intergenic
931965817 2:67533285-67533307 AGGGAAAAGAAATAGATAGATGG + Intergenic
932067596 2:68582854-68582876 AAGTAGAATGAATATTAAGAAGG + Intronic
932200544 2:69823592-69823614 AGGGAGAAAAAGTATTAAATAGG + Intronic
932999274 2:76901724-76901746 AAGGAGAAGAGATAGTAAAAGGG - Intronic
933073892 2:77897762-77897784 AGAGAGCAGAAATCTTAAGTGGG + Intergenic
933335777 2:80956890-80956912 AGGGAGAATTAATATGAAAATGG - Intergenic
933738747 2:85516348-85516370 AGGGAGAACAAATATTATTGTGG - Intergenic
933928030 2:87118949-87118971 AGTGAAAAGAAATTTTATGAAGG + Intergenic
933931988 2:87161572-87161594 AGTGAAAAGAAATTTTATGAAGG - Intergenic
934032981 2:88065022-88065044 GAGGAGAGGAAATATTAAAAAGG - Intergenic
934621777 2:95814622-95814644 AGGGAGAGGACATTTCAAGATGG - Intergenic
934811671 2:97284191-97284213 AGGGAGAGGACATTTCAAGATGG + Intergenic
934826020 2:97423749-97423771 AGGGAGAGGACATTTCAAGATGG - Intergenic
934973506 2:98783330-98783352 AGGGAGAAGGAATATGATAAAGG + Intergenic
935455517 2:103263076-103263098 ATGGTGAAGGAATATAAAGAAGG + Intergenic
936361129 2:111803862-111803884 AGTGAAAAGAAATTTTATGAAGG + Intronic
936475058 2:112832534-112832556 AGTGAAAAAAAATATTAAAAAGG - Intronic
937113270 2:119384005-119384027 AGGGAGAAGAAAGGATAAAAGGG + Intergenic
937872061 2:126793023-126793045 AGAGGGGACAAATATTAAGAAGG + Intergenic
937936739 2:127251622-127251644 AGAAAGAAGAAAAAATAAGAAGG + Intergenic
939031563 2:137081949-137081971 AGGGAGAAGAAATTAGAGGAGGG - Intronic
939113453 2:138034020-138034042 TGGGAGAAGAAACAGAAAGATGG + Intergenic
939115984 2:138061221-138061243 AGGGAGAAGAAATTAGAAAATGG - Intergenic
939276156 2:139999043-139999065 GAGGAGAAGAAATATTATGAAGG - Intergenic
939315821 2:140548442-140548464 ATGGAGATGAAATAAGAAGATGG - Intronic
939374904 2:141351841-141351863 AGCTAGAAGAAAAATGAAGATGG + Intronic
939554145 2:143654093-143654115 AGGGAGTAGAAATTTTAGAATGG + Intronic
939557907 2:143699329-143699351 AGAGAGCTGAAATATTAAGGAGG - Intronic
939669455 2:144992399-144992421 ATGGAGAACAAATTTCAAGAAGG - Intergenic
940393539 2:153161511-153161533 AGGGAGAAGAAATCTTAAATGGG + Intergenic
940436086 2:153656944-153656966 ATGGGAAAGAAAAATTAAGAAGG + Intergenic
940568051 2:155394044-155394066 AAGGAGTAGAAATACTAACAAGG - Intergenic
940600773 2:155857049-155857071 AGGTGGAAGGAATATTCAGAAGG - Intergenic
940606324 2:155927601-155927623 AGAGAAACAAAATATTAAGATGG - Intergenic
940961134 2:159787351-159787373 ATGAAAAACAAATATTAAGATGG - Intronic
941031163 2:160513075-160513097 AGAGAGAAGGAATATAAATAAGG - Intergenic
941038756 2:160597214-160597236 ATGTAGAAAAAATATAAAGAGGG + Intergenic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941591138 2:167422100-167422122 GGGGAGAAGAAAGAATAAGAAGG + Intergenic
941651090 2:168093606-168093628 AGGTAGAAGAGATATTTAGGAGG - Intronic
941827996 2:169921145-169921167 CTGGAGAAGAAATATTGAGGAGG + Intronic
942182948 2:173397601-173397623 AGTGAGAACAAACAATAAGAAGG + Intergenic
942567841 2:177284445-177284467 AAGGAAAGGAAACATTAAGATGG - Intronic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
943377021 2:187090217-187090239 AAGGAGAAAAAATATTCAGCTGG + Intergenic
943492419 2:188571576-188571598 AGTGACAAGAAAAAATAAGAAGG - Intronic
943509499 2:188806576-188806598 AGGAAGAAGAAAGATAAATATGG - Intergenic
943521667 2:188959413-188959435 AGTGAGAAGAAAAATAAAGCAGG + Intergenic
943922355 2:193725276-193725298 AGACAGAAGAGATGTTAAGAGGG - Intergenic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944300731 2:198121862-198121884 AAGGAGGAGAAAAATAAAGATGG - Intronic
945174201 2:207025294-207025316 AGGTAGAAGAGATATTCAAATGG + Intergenic
945624524 2:212185596-212185618 AGGGAGAAGAGATCTTAAGTAGG + Intronic
945631876 2:212288323-212288345 AAGGAGAGAAAATATTACGAGGG + Intronic
945671929 2:212812504-212812526 AAGAAGAAGAAATAATAATAAGG - Intergenic
945906446 2:215599037-215599059 AGAGAGAAGAATGTTTAAGAAGG - Intergenic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946516825 2:220421241-220421263 AGAGAGAAGAAAAGATAAGAAGG + Intergenic
946722512 2:222625361-222625383 AGTGATAAGAAATATTCATAAGG - Intronic
946839224 2:223803606-223803628 AGGCAGAGGAACTATAAAGATGG + Intronic
947090473 2:226504694-226504716 AAGTAGTAGAAATAATAAGATGG + Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947191067 2:227505390-227505412 AGGCAGAAAAAATATTTGGAAGG - Intronic
947218093 2:227767731-227767753 AGGTTCAAGAAATATTTAGAAGG + Intergenic
947292106 2:228587140-228587162 ATGGAGATGAAATATGGAGAAGG - Intergenic
948161958 2:235832290-235832312 AAGGAGAACAATTATTAGGAGGG - Intronic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1170071844 20:12377807-12377829 AGAGAGAACAAATATTGAGTTGG + Intergenic
1171052565 20:21873663-21873685 AGGGACAAGAAATGGTAAGAAGG - Intergenic
1171077455 20:22143038-22143060 AGGGAGAAAAAATAGAAAGAGGG - Intergenic
1173647476 20:44642464-44642486 AGGGAGAAGAAAGAAGGAGAGGG + Intronic
1173814070 20:45973749-45973771 AAGGAGAAGACCTATTAATAAGG + Intergenic
1173848510 20:46202956-46202978 AGGGAGGAGAAACAACAAGAAGG - Intronic
1174144755 20:48444218-48444240 AGACAGAATAAATATAAAGATGG + Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175608263 20:60329123-60329145 AGGGAGGAGAAAGAGTAACAAGG + Intergenic
1175885004 20:62284834-62284856 AGCGAGAAGATTTATTAAGAAGG - Intronic
1177511837 21:22097178-22097200 AAAGAGAAGGAATATCAAGAAGG + Intergenic
1177533143 21:22389193-22389215 TGGAAGAAGAAATATGAACAAGG - Intergenic
1177680172 21:24357521-24357543 AGGAAGAATTAATATTAAAATGG - Intergenic
1178216035 21:30599296-30599318 AGAGAGCAGAAATACTAAAAGGG - Intergenic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178997627 21:37419273-37419295 AGGGAAAAGGATTATTAAGCAGG + Intronic
1179344382 21:40543318-40543340 GGGGACAAGAAATGTTATGATGG + Intronic
1180132977 21:45839084-45839106 AGTGAAAAGAAATATGAACATGG - Intronic
1181901504 22:26160033-26160055 AGAGAGAAGAAAGAGAAAGAGGG + Intergenic
1182051888 22:27318765-27318787 AGGGAGAGGAAAGAGTAAGAAGG + Intergenic
1182773057 22:32809884-32809906 AGGGAGAAGAGATGCTAAGCTGG - Intronic
1182955164 22:34417589-34417611 AGGGAACACAAATATTTAGACGG + Intergenic
1182966196 22:34523454-34523476 GAGGAGATGAAATTTTAAGAAGG - Intergenic
1183009936 22:34936674-34936696 AGCTAGAAGAAATATAAAGTGGG - Intergenic
1183716965 22:39538776-39538798 AAAGAGAAGAAATTTTAAGAAGG + Intergenic
1183936671 22:41266318-41266340 CGTGAGAATAAATCTTAAGAGGG - Intronic
1184891434 22:47381793-47381815 GCAGAGAAGAAATATAAAGAGGG + Intergenic
1185145428 22:49132664-49132686 ACGAAAAAGAAATAGTAAGATGG - Intergenic
949487396 3:4553177-4553199 ACGGAGAAGGCATATTAAGCCGG + Intronic
949789632 3:7778931-7778953 ACGGTGAAGTAATATAAAGATGG + Intergenic
949915326 3:8958160-8958182 GTGGAGAAGACATAGTAAGAGGG - Intronic
950832337 3:15887193-15887215 AGAGGGAAAAAATTTTAAGATGG + Intergenic
951354342 3:21645780-21645802 AGGGAGAAAAAATATCTAGTTGG - Intronic
951863258 3:27277435-27277457 AGGTAGAAGGATTATTAAAATGG - Intronic
951911376 3:27753965-27753987 AGGGATAAGAAATATTGAGGTGG + Intergenic
952008836 3:28875725-28875747 AAGGAGAAGAAATAGTGGGAAGG - Intergenic
952073072 3:29662717-29662739 ATGGAGAAGAAATCTGTAGAAGG - Intronic
952437986 3:33291786-33291808 ATGGAAAATAAATATAAAGATGG + Intronic
952474982 3:33699290-33699312 AGGTAGAAGAAATATTTGGAGGG + Intronic
952673482 3:35999316-35999338 AGAGAGAAAAAATAATAAAAAGG - Intergenic
953609451 3:44435276-44435298 AGAGAGAAGAATTATTCACAAGG - Intergenic
953898121 3:46819670-46819692 ATAGAGAAGAAATAGCAAGATGG - Intergenic
954502761 3:51035922-51035944 GGGGAGAAAAAATACTAAAAAGG - Intronic
955097704 3:55816052-55816074 AGGGAGAAGAAAATATAAAAAGG - Intronic
955472540 3:59300905-59300927 ATGGAGAAGAACTAGTTAGAAGG + Intergenic
955595057 3:60580499-60580521 AATGAGATGAAATATTAAAATGG - Intronic
956308691 3:67854946-67854968 GGGGAAAAGAAAGATTTAGAGGG + Intergenic
956819897 3:72944661-72944683 AGAGAGAGGAAATATTAAAGAGG - Intronic
956952494 3:74298552-74298574 TATGAGAAGAAATATTAAAATGG + Intronic
957005380 3:74939610-74939632 AAGGAGAATAAATAGTAAGACGG + Intergenic
957246027 3:77717598-77717620 AGGAAGAAGAATTACCAAGAAGG - Intergenic
957733274 3:84170918-84170940 AGGAGGAAGAAATAAGAAGAAGG + Intergenic
957743019 3:84299080-84299102 AGGGAGAGGGAATACCAAGAAGG - Intergenic
957783716 3:84851957-84851979 AAGGAGAAGAAAGCATAAGAAGG - Intergenic
958112354 3:89164658-89164680 ATGGAGAAAAAAGATTAAGTAGG + Intronic
959397605 3:105860637-105860659 AGGGAGAAGAAATATTAAGAAGG - Intronic
959426588 3:106197331-106197353 ACGAAGAAGATATGTTAAGAAGG - Intergenic
959486908 3:106937066-106937088 AGAGAGAAGAAATAGAAAGTGGG - Intergenic
960399491 3:117178980-117179002 AGGGGGAAGAAATGTTAACTTGG - Intergenic
960418903 3:117419201-117419223 GGGTAAAAGAAATATTAATATGG + Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
961030577 3:123600006-123600028 AGGAAGAAGAAAAAATAAGAAGG - Intergenic
961256868 3:125562134-125562156 AGGAAGAAGACATATTGAGTCGG - Intronic
961426269 3:126851005-126851027 AGGGAGAAGAAGTAGTAACCTGG - Intronic
961517572 3:127447571-127447593 AGGGAGAAGAGATGTGATGACGG + Intergenic
962275408 3:134009845-134009867 ATAGAGAAAAAATCTTAAGACGG + Intronic
962564894 3:136647651-136647673 AGGGAAATGAAATATTGACATGG - Intronic
963517752 3:146329640-146329662 AAGGAGAAGCAATAGTATGAAGG + Intergenic
963627425 3:147690817-147690839 AGGGAGAGGAAAGATTTTGATGG - Intergenic
964516737 3:157518531-157518553 ATGGAGAACAAATACCAAGATGG - Intronic
964639432 3:158893022-158893044 AGGCAGAGGAAATATTATAAAGG - Intergenic
964741216 3:159968543-159968565 GGATAGAAAAAATATTAAGAAGG - Intergenic
964775708 3:160274345-160274367 AGGTACAAGAAATGTTCAGAAGG + Intronic
965127276 3:164647455-164647477 AGGCTGAAGACATATTATGAAGG - Intergenic
965817925 3:172655991-172656013 AGGGGGAAGAGATTTCAAGAAGG + Intronic
966054779 3:175673082-175673104 AAGGGAAATAAATATTAAGAGGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966998163 3:185305138-185305160 ATAGAAAAGAAATATTAAAATGG - Intronic
967274301 3:187758816-187758838 AGGGGGAAGAAAGAGGAAGAAGG - Intergenic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967568521 3:190999798-190999820 AGGGATAAGAAATACAAAAATGG + Intergenic
967621159 3:191635881-191635903 TGGAAGAAGTAATATTAGGAAGG - Intergenic
969042089 4:4307093-4307115 AGGGTGAAGAGTCATTAAGATGG - Intronic
970088744 4:12378811-12378833 AGAGAGGAGAAATTTTCAGAGGG - Intergenic
970342953 4:15126151-15126173 AGTGAGAAGGAATTTTTAGATGG - Intergenic
970681088 4:18509186-18509208 AGGAAGAAGATAGATTAAAATGG + Intergenic
970967468 4:21945129-21945151 AAGGACAAAAAATAGTAAGAAGG + Intronic
971550227 4:27945764-27945786 AGGCAGTAGAATTATTAAGCTGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
971847734 4:31942391-31942413 TTGGAAAAGTAATATTAAGAAGG - Intergenic
971971585 4:33627462-33627484 AGAGAGATGGAATATGAAGAGGG - Intergenic
972199980 4:36702845-36702867 AGGCAGAAGAAACACTTAGAGGG + Intergenic
972327284 4:38028674-38028696 AGAGAGAAGAAATTATAAAATGG + Intronic
972692284 4:41410999-41411021 AGGGAGAAGAAATAACCTGATGG - Intronic
974308025 4:60166947-60166969 AGGGAGAAGAAAGATTATATTGG + Intergenic
974430365 4:61789345-61789367 AGAGAGAAGAAATGTTCTGAGGG + Intronic
974691996 4:65307978-65308000 AGTGAGAGGAAATAGAAAGAAGG - Intergenic
974692483 4:65315391-65315413 ATGCAGAAAAAATATCAAGAAGG - Intergenic
974889388 4:67861560-67861582 AGTGAGAAGAACTGTAAAGAAGG + Intronic
974989370 4:69065330-69065352 AGGAAGATGTAATATAAAGAAGG + Intronic
975519904 4:75289577-75289599 TGGCATGAGAAATATTAAGATGG - Intergenic
975716750 4:77212452-77212474 GGAGGGAAAAAATATTAAGAAGG - Intronic
976156570 4:82151352-82151374 AGGGGGATGATATATTAATATGG + Intergenic
976299975 4:83508031-83508053 AGGGAGCAGAAAAATGAAGTGGG + Intronic
976879443 4:89900963-89900985 AGGAAGAAAATATTTTAAGAAGG + Intronic
977100531 4:92807690-92807712 ATGCTGAAGAAATAATAAGACGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
978095364 4:104769631-104769653 AGAAAGAAGAAATAATAGGATGG + Intergenic
978153671 4:105465851-105465873 ATGGAGAAGAAATTGTAAAAGGG - Intronic
978361343 4:107933420-107933442 AGGTAGAAGCAGTATTACGAAGG + Intronic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978508747 4:109492079-109492101 AGAGATAAGAAATAAAAAGAAGG - Intronic
979072626 4:116228631-116228653 AGGGAGAAGAGATAGAGAGAGGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979369603 4:119868448-119868470 AGGTAGAAGGAACATGAAGAAGG + Intergenic
979691888 4:123568410-123568432 ATGGAGAAGAAATGATAAAATGG - Intergenic
979796846 4:124856793-124856815 GGGAAGAAAAAATATTAAAAGGG + Intergenic
980031640 4:127838876-127838898 GGGAAGAATAAATATTAAAAAGG - Exonic
980238334 4:130137622-130137644 AGGGAGAAGAAATGTTATCCCGG + Intergenic
980636208 4:135507149-135507171 AGGGAAGAAACATATTAAGAGGG - Intergenic
980657736 4:135811741-135811763 AAGGAGAGGAAAGATTAGGAAGG + Intergenic
980709188 4:136541998-136542020 ATGAAGAAGAAATAATAAGGTGG + Intergenic
981063980 4:140461799-140461821 AGGAAGAAGAAATTATAGGAAGG + Intronic
981822825 4:148905037-148905059 AAGAAGAGGAAATAGTAAGAGGG - Intergenic
981837616 4:149073546-149073568 AGGGAGAAGAATGAGAAAGACGG - Intergenic
982059538 4:151591043-151591065 AGGGAGAAAATTAATTAAGAAGG - Intronic
982192610 4:152873648-152873670 AAGGTGAAAGAATATTAAGAAGG - Intronic
982270906 4:153587018-153587040 AGTGAGAAAAAAAATAAAGATGG - Intronic
982566458 4:156993138-156993160 AGGGAGGAGAAATATGTACATGG - Intergenic
982793501 4:159619036-159619058 ATGGAGAAGATTTATTAGGAAGG + Intergenic
983709801 4:170699805-170699827 TGACAGAAGAAAAATTAAGATGG - Intergenic
984041897 4:174745189-174745211 AAGGTGAAGAAATGTTAAAAGGG + Intronic
984070301 4:175103245-175103267 AGGGAGAAGAAAGAGAAAGAAGG + Intergenic
984071299 4:175116576-175116598 ATGGATAGGAAAAATTAAGATGG + Intergenic
984940378 4:184926476-184926498 GGATAGAACAAATATTAAGATGG - Intergenic
985053442 4:186015827-186015849 AGGGATAAGAAATAAAAAAATGG + Intergenic
985130853 4:186737376-186737398 AGGAAGAGGAAATATGAATAGGG + Intergenic
987570575 5:19653185-19653207 AGGAAGAAGTATTATTAAGTTGG - Intronic
987591205 5:19929473-19929495 ACGAAGAATAAATATTTAGATGG + Intronic
987847799 5:23309937-23309959 AAGGAAAAGAAGTATTTAGAGGG + Intergenic
989296027 5:39827774-39827796 CAGTAGAAGAAATATTAAGTGGG - Intergenic
989391802 5:40908291-40908313 AGGTAGAATAAATGTTAAGCGGG - Intergenic
990143991 5:52738025-52738047 TGGGAGAAGAAGTAAGAAGAAGG - Intergenic
990145706 5:52757849-52757871 AGTGAAAAGAAATACAAAGAAGG + Intergenic
990482558 5:56225874-56225896 AGGAAGAATAAATATGAAAATGG + Intronic
990839064 5:60055006-60055028 AAGGAGAAGAAATAAAAAAAAGG + Intronic
991259023 5:64646725-64646747 AGGGAGTAGAAATTTTAATTTGG - Intergenic
991385901 5:66089543-66089565 AGGGATAACAAATAGTAAGATGG + Intergenic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
991691926 5:69233806-69233828 AGGGACAAGAAAAAGAAAGAAGG - Intergenic
991930864 5:71751321-71751343 AGAGAGAAGAGATTTGAAGAAGG - Intergenic
992159644 5:73988552-73988574 AGGGAGAGCATATATTAAGGAGG + Intergenic
992949897 5:81848736-81848758 AAGGAGAAGATATCTTCAGATGG - Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
994650958 5:102527626-102527648 TGGGAGAAGAAATACTAGGCAGG - Intergenic
994998184 5:107092531-107092553 AGAAAGAAGAAATATAAAGAAGG + Intergenic
995935536 5:117507108-117507130 AGGAAGAACAAAAATTAAAAAGG + Intergenic
995963743 5:117878112-117878134 ATGGAGAAGAAGTTTTATGATGG + Intergenic
996602738 5:125285005-125285027 ACAGAGAAGAAATATTGAGGAGG - Intergenic
996889388 5:128400092-128400114 AGGAAGAGGAAAGATTGAGAGGG + Intronic
996929392 5:128868282-128868304 AGGGAGATGTAATATTATCATGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997810459 5:136962699-136962721 ATTGAGAAAAAATATTAACATGG + Intergenic
998531810 5:142892059-142892081 AGGGAGAAGTGAAATTGAGAGGG + Intronic
998769854 5:145530570-145530592 ATGGAGAAGAAAGAATAAGGAGG + Intronic
999496310 5:152101884-152101906 AGGGAGGAGGAATTTGAAGAGGG + Intergenic
1000126958 5:158254845-158254867 AGAGAGAAGAAAGATGGAGAAGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000459985 5:161503392-161503414 ATGGAAAAGAAATAGTAATAAGG + Intronic
1001121722 5:168986358-168986380 AGGGAAAGGAAATATTTGGACGG + Intronic
1001306580 5:170578893-170578915 AGGCAGAAGGAATAGCAAGAGGG + Intronic
1001679430 5:173545263-173545285 AAGGAGAAGTAATTTTAAAAGGG - Intergenic
1001783831 5:174394251-174394273 TGGGAGGAGAGATATGAAGAGGG + Intergenic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1003685391 6:8297340-8297362 AGGCACAAGATATATAAAGAAGG - Intergenic
1005078876 6:21936763-21936785 AAGGAGACAAAAAATTAAGACGG + Intergenic
1005089040 6:22037111-22037133 AGGAAGAAGAAAAAATCAGAGGG - Intergenic
1005449541 6:25959440-25959462 ACAGAGAAGAAATAAAAAGAAGG - Intergenic
1006176766 6:32127293-32127315 AGGGAGAAGAAACAAAAATAGGG + Intronic
1006690894 6:35884276-35884298 GGGGAAAAGAATGATTAAGAAGG - Intronic
1007335279 6:41151013-41151035 AGGGAGATGAAATAGAATGAGGG + Intronic
1007950305 6:45866290-45866312 AGAAAGAAGAAAAATAAAGAAGG - Intergenic
1008139095 6:47811151-47811173 ATGGAGAAGAAATGTTCAAAAGG + Intronic
1008144056 6:47868163-47868185 AGTGAGAAAAAATTTTAAAACGG - Intergenic
1008243629 6:49144129-49144151 TGGGAGAAGAAATACTGAAAGGG - Intergenic
1008935594 6:56988440-56988462 AAGGAGAAGAATTACAAAGAAGG + Intronic
1009670302 6:66740407-66740429 AGGGAGAATAAATCCTAAAATGG - Intergenic
1009671813 6:66763616-66763638 AGGGACATGGAATATTATGATGG + Intergenic
1010118408 6:72342604-72342626 AGGGAGTAGTAAGAGTAAGATGG + Intronic
1010311385 6:74389893-74389915 AGGAAGAAGAAACAAGAAGAAGG - Intergenic
1010465844 6:76166117-76166139 AGGGAGAGGAGAGATTAAGGAGG + Intergenic
1010838479 6:80618453-80618475 AGGAAGAGGAACTAGTAAGAGGG - Intergenic
1011205918 6:84897455-84897477 AGGGAGAAAAAATGGCAAGATGG + Intergenic
1011859851 6:91740897-91740919 AGAGAGGTGAAATATCAAGAGGG + Intergenic
1012096903 6:94973609-94973631 AGAGAGAAGAAATGTTCACAGGG + Intergenic
1012222809 6:96670631-96670653 AGAGAGAAGAAAAATTATGTAGG + Intergenic
1012378796 6:98594503-98594525 AGGGACAAAAGATATAAAGAAGG + Intergenic
1012406603 6:98907464-98907486 AGATACAAGAATTATTAAGAAGG + Intronic
1012532189 6:100251371-100251393 AGGGAGAAGAAAAGTTCAGATGG + Intergenic
1012790657 6:103690333-103690355 AGTGATAAGAAACATTAAGATGG - Intergenic
1012938244 6:105390653-105390675 AGGGTGAAGACACAATAAGATGG + Intronic
1013116665 6:107108782-107108804 AGGTAGAAAAAAAATTAAGAGGG + Intronic
1013581270 6:111536898-111536920 AGGGAGATGAAAGCCTAAGAGGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014790489 6:125666633-125666655 AGGGAGATGGAAGATAAAGAAGG - Intergenic
1014886646 6:126789755-126789777 AGGGACAAGAAACAGTAAGTTGG - Intergenic
1014997444 6:128167804-128167826 AAGTAGAAGTAATATTAAGAAGG - Intronic
1015063216 6:128993815-128993837 ATGCAGAAGAAAAATTAATAGGG + Intronic
1015336673 6:132046998-132047020 AGGGGCAAGAAATAATAGGATGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015680761 6:135805852-135805874 AGGAAGAAGAAATGATAAAAGGG + Intergenic
1015742696 6:136474126-136474148 AGTGAAAATGAATATTAAGAGGG + Intronic
1016554291 6:145318159-145318181 AGGAAGAATCAATATTAAAATGG - Intergenic
1017550807 6:155505207-155505229 TCAGAGAAGAAATATTTAGAAGG - Intergenic
1018102680 6:160455493-160455515 AGGGAGAAGAAATACAACTAGGG + Intergenic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018667096 6:166148770-166148792 AGGAAGTGGAAATATTGAGAGGG - Intergenic
1019372472 7:670261-670283 AGGGAGGAGGAATATGAAGTGGG - Intronic
1019800997 7:3088310-3088332 AGGGTGAAGGTCTATTAAGAAGG - Intergenic
1019851093 7:3558326-3558348 AGGGAGAAGAAAGTATGAGATGG - Intronic
1020527359 7:9279123-9279145 AGGTAGAAAAAATATAAAAATGG - Intergenic
1020737348 7:11967745-11967767 AGGGCAATGAAAAATTAAGAAGG + Intergenic
1020937060 7:14479590-14479612 AGGAAGTACAAATATCAAGATGG + Intronic
1021008618 7:15433638-15433660 AATGAAAACAAATATTAAGAAGG + Intronic
1021277997 7:18679570-18679592 AGAGAGAAGAAAGAGAAAGAGGG - Intronic
1021396317 7:20152937-20152959 AGGAAAAACAAATATTATGAGGG - Intronic
1021956751 7:25832962-25832984 AAAGAGAAGAGAAATTAAGAAGG - Intergenic
1022211421 7:28213839-28213861 AGAGAGAATAAAAATAAAGAAGG + Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023244717 7:38189173-38189195 AGTGAGAAGATTTATTAAGATGG + Intronic
1023622133 7:42084597-42084619 AGAGAGAAGAAATAACCAGAGGG + Intronic
1023761130 7:43466080-43466102 AGAGAGAAGAAAGAGAAAGAAGG + Intronic
1024058446 7:45681392-45681414 AGGGAGAGTGAATATTCAGAAGG - Intronic
1024336483 7:48211852-48211874 AGGGAGAAGGAATATTACAGAGG - Intronic
1024456707 7:49616285-49616307 AGGGCAAAGAAAAAGTAAGAGGG + Intergenic
1024488523 7:49948305-49948327 AGGGAGAAGGCAGAGTAAGATGG - Intronic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1025729587 7:64098193-64098215 AGGAAGAAGACATTTTAAAAAGG + Intronic
1026058095 7:67002381-67002403 AGAATGAAGAAATATTGAGATGG - Intronic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026422844 7:70258309-70258331 ATGGAGAAGGAATACTAAGTAGG + Intronic
1026508953 7:71011377-71011399 AGGCAGAAGGAATATTATTAAGG + Intergenic
1026719995 7:72822643-72822665 AGAATGAAGAAATATTGAGATGG + Intronic
1027367396 7:77472743-77472765 AAGGAGAGGAAGGATTAAGAGGG + Intergenic
1027385050 7:77651503-77651525 AGGTAGAATAATTATTAAAATGG - Intergenic
1027838869 7:83281057-83281079 GGGGAGAAGAAACATTAAGATGG + Intergenic
1027883854 7:83876948-83876970 AGGGAGAAGGAAGAGAAAGATGG + Intergenic
1028780631 7:94731729-94731751 AGGGAGAAGAAAGGGAAAGAAGG + Intergenic
1029897967 7:104006455-104006477 AGCAAGAAGAAATATTGGGATGG + Intergenic
1030940419 7:115640283-115640305 ACGGGGAAGAACTATTAAGATGG - Intergenic
1030946801 7:115733506-115733528 ATGCAGCAGAAATATTAATAAGG - Intergenic
1030956665 7:115861255-115861277 AAGGAGCACAAATTTTAAGAAGG + Intergenic
1031366385 7:120905239-120905261 AGGGAGAATCAATATGAAAATGG + Intergenic
1031666929 7:124496103-124496125 AGGGAGAATCAATATGAAAATGG - Intergenic
1031778161 7:125927403-125927425 ATGGAGTAGAAATACTAAGAGGG - Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031823383 7:126532346-126532368 ACTGAGAAGAAATAGTAAGATGG + Intronic
1031875252 7:127132364-127132386 AAGGAGAAGAAATAATTAAAAGG - Intronic
1031892921 7:127315783-127315805 AGGAAGAATCAATATTAAAATGG + Intergenic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1032528260 7:132596732-132596754 AGGGAGAAATACCATTAAGAAGG + Intronic
1032563002 7:132912040-132912062 AGGGTGAAGAATTATGAATAGGG - Intronic
1032754183 7:134872682-134872704 AGGGAGAAAAAAAATTCAGTAGG + Intronic
1034394320 7:150808977-150808999 AGTGAGAAGAAAAGTTTAGAGGG + Intergenic
1034866206 7:154644683-154644705 ATGCAGAAGAAATCTTAAAATGG + Intronic
1036679690 8:10862618-10862640 TGTGAGAAGAAATGCTAAGAAGG + Intergenic
1037271804 8:17138070-17138092 TGGAGGAAGGAATATTAAGATGG + Intergenic
1037419643 8:18688395-18688417 AAGAGCAAGAAATATTAAGAAGG - Intronic
1037608036 8:20453930-20453952 AGTGAGAAGCTATATTCAGAAGG + Intergenic
1037615781 8:20517852-20517874 AGGGAGATGAAACATGCAGAAGG + Intergenic
1037645669 8:20790623-20790645 AGGGAGAAATAATATGAAGGAGG - Intergenic
1037663890 8:20951066-20951088 AGGGAGAAGGAATAGCAAGAGGG + Intergenic
1037737613 8:21580061-21580083 AGGGAGAGGGAATCTTCAGATGG - Intergenic
1038056041 8:23858670-23858692 GGTGAGAAAATATATTAAGAGGG + Intergenic
1038067540 8:23978642-23978664 AGGAAGAAGAAAAAGAAAGAAGG + Intergenic
1038318035 8:26503924-26503946 AAGGAGAAGCAATTTCAAGAAGG + Intronic
1038365046 8:26923020-26923042 AGGAATCAGAACTATTAAGATGG + Intergenic
1038495895 8:28002274-28002296 AAGGTGAAGAAAAATTGAGAAGG + Intergenic
1038995516 8:32918682-32918704 AGGGAGAAGAATCTTTTAGAGGG - Intergenic
1040393733 8:46974711-46974733 AGGGAGAAGAAAAATAATTATGG + Intergenic
1040509243 8:48078983-48079005 TGGAAGATGTAATATTAAGATGG - Intergenic
1041589731 8:59563680-59563702 AGGAAGAAGTAATTTGAAGAGGG + Intergenic
1041620426 8:59961155-59961177 TGGGAGAAGAAAAAGTAAGCTGG - Intergenic
1041655248 8:60342958-60342980 AGGAAGAATCAATATTAACATGG + Intergenic
1041870942 8:62633808-62633830 AGGGGGAAAGAATATGAAGAAGG + Intronic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042338804 8:67657215-67657237 AGTGATAAAAAATATTAAAAAGG + Intronic
1042387431 8:68193707-68193729 AGGGAGAATAGATTTTGAGATGG + Intronic
1042455370 8:68995840-68995862 AGGGAAAAGAATTATAAATATGG - Intergenic
1042526460 8:69769523-69769545 ACATAGAAGAAATATTAAGTTGG + Intronic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042717254 8:71787625-71787647 AGAGAGAAGAAATTTAAAAAAGG + Intergenic
1043649797 8:82577240-82577262 AGGAAGAACAAATTTTAAAAAGG - Intergenic
1045009132 8:97942834-97942856 AGTGAGAAGAAACATGAAAAAGG - Intronic
1045471558 8:102517196-102517218 AGGAATAAAGAATATTAAGAGGG - Intergenic
1046064403 8:109179587-109179609 AGAGAGGAGAAAAATGAAGATGG - Intergenic
1046167658 8:110458798-110458820 AGGGGGAAAAAAAATTAACAAGG - Intergenic
1046357315 8:113105253-113105275 AGAGAGGAGAAAAACTAAGAAGG + Intronic
1047347580 8:124042995-124043017 AAGGGGAGGAAATCTTAAGAGGG + Intronic
1047553764 8:125906759-125906781 AAGAAGAAAAAATATTATGAAGG - Intergenic
1048002106 8:130387202-130387224 AGGAAGAAGAAATGTGAAAATGG + Intronic
1048519697 8:135142110-135142132 AGGGAGAAGGAATAGAAGGAAGG + Intergenic
1048561054 8:135537994-135538016 AGGGAGAGGGGATATTAAAAAGG + Intronic
1050046717 9:1553885-1553907 GGGCAGAAGAAATGTTACGAGGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050282998 9:4071784-4071806 TGGGAGAAAAATTATTAAGGTGG + Intronic
1050779707 9:9317317-9317339 AGGGAAAAGAGATATTTAGCAGG - Intronic
1050828017 9:9973962-9973984 AGGGAGAAAACATATTCTGATGG + Intronic
1050942906 9:11483319-11483341 AAGGAGACAAAATATTAACAAGG - Intergenic
1051322414 9:15921807-15921829 AGCAAGAAGAAATATGAAAAAGG - Intronic
1051914069 9:22186487-22186509 AGAGAGAAAAAATAATAAAAAGG + Intergenic
1051964329 9:22808719-22808741 AGGATGAAGATATATTTAGAAGG + Intergenic
1052067182 9:24036484-24036506 GGGGGGAAGAAATATTATCAGGG - Intergenic
1052248408 9:26367144-26367166 AGGAAGACGAAGTATTAAGGAGG - Intergenic
1052275388 9:26669900-26669922 AGGGAGAAGTAAAATCAAGGGGG - Intergenic
1052539552 9:29791414-29791436 TGGGAGAAGGAATAATAAAAAGG + Intergenic
1052678564 9:31658442-31658464 AGGAAGAATCAATATTAAAATGG - Intergenic
1052841820 9:33298147-33298169 ACTAAAAAGAAATATTAAGAAGG + Intronic
1052890925 9:33699382-33699404 AGAGAGAAGAATTGTTGAGAAGG + Intergenic
1055000990 9:71448171-71448193 AAGGTGAAGAAGGATTAAGAGGG + Intergenic
1055192224 9:73539235-73539257 AGGTAGAACAGATAGTAAGAAGG - Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1056114595 9:83429717-83429739 AGAGAGAAAAATTGTTAAGAAGG - Intronic
1056838971 9:89982356-89982378 AGGGAGAAGAAAGGTTTGGAAGG - Intergenic
1057807177 9:98227976-98227998 AGTTATAAGAAATATTCAGAAGG + Intronic
1058387524 9:104455898-104455920 AAAGAGAAGAAAAATTAAAATGG + Intergenic
1058875867 9:109244361-109244383 AGAGAGAAGAAAGAAAAAGAAGG + Intronic
1059015128 9:110506937-110506959 AGGGAAAAGAAAGAGGAAGATGG + Intronic
1059170529 9:112120374-112120396 AGGGAAAAGAAAAAAGAAGAGGG + Intronic
1059654941 9:116349066-116349088 AGGAAGAAGACAGATTAAGAAGG - Intronic
1060255702 9:122028208-122028230 ATAGAAAAGAAATAGTAAGATGG + Intronic
1060609393 9:124948993-124949015 AGGGAGAAGAATTATCTAAAAGG - Intronic
1061060741 9:128249206-128249228 AAGAAGAAGAAATATAATGAGGG + Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185849984 X:3476241-3476263 AGGAAGAAGGAAGAATAAGAAGG + Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186340922 X:8645524-8645546 AGAGTGGAGAAATATGAAGAGGG - Intronic
1186614098 X:11168696-11168718 TGGGAGAAAAAACATGAAGAAGG + Intronic
1187288559 X:17930233-17930255 AGGGAGAAGAAACAGTAGGCAGG + Intergenic
1187781510 X:22831827-22831849 AGGGGGAAGAAAAAGGAAGATGG - Intergenic
1187956210 X:24521536-24521558 AGAGAGAAAGAATATTAAGATGG - Intronic
1188061798 X:25610485-25610507 AGGAAGATGAAAAAGTAAGAGGG - Intergenic
1188061979 X:25612030-25612052 AGGAAGATGAAAAAGTAAGAAGG + Intergenic
1188134544 X:26479133-26479155 ATGGACAAAAAATATTAAAAAGG + Intergenic
1188182983 X:27078098-27078120 AGGGAGTACAAATATTATGTGGG + Intergenic
1188323860 X:28775069-28775091 AGGAAGAAAAGATATTAATAAGG - Intronic
1188518231 X:31010458-31010480 AAGGAGAAGAAAAAGTGAGATGG - Intergenic
1188606689 X:32040323-32040345 AGAGAGAAGAAAAAATATGAAGG - Intronic
1188760773 X:34026946-34026968 AGGAGGAAGAAAAAATAAGAAGG - Intergenic
1189855102 X:45215825-45215847 ATAGAGAAGAAATATTGAAAAGG + Intergenic
1190518510 X:51250700-51250722 AGAGACAAGAAGTATTAACATGG + Intergenic
1190795369 X:53736199-53736221 AGGGAGAAAACATTTCAAGAAGG - Intergenic
1191086885 X:56577825-56577847 TGGGAGAACCAATATTAAAATGG - Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191629095 X:63301622-63301644 AGGAAGAATCAATATTAAAATGG + Intergenic
1192093289 X:68183474-68183496 AGGGAGAACAAAGGTTAAAAAGG + Intronic
1192601620 X:72470402-72470424 AGGTAGAAGAAATATGATGGAGG - Intronic
1192630607 X:72775079-72775101 AAGGAGAGGGGATATTAAGATGG + Intergenic
1192651103 X:72945725-72945747 AAGGAGAGGGGATATTAAGATGG - Intergenic
1193225304 X:78975570-78975592 AGGAAGAATAAATATGAAAATGG - Intergenic
1193525572 X:82583783-82583805 AGATAGAAGAAATATTAGGTTGG - Intergenic
1193880596 X:86916486-86916508 AGAGAGAAAAAAGATTAAAAAGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1195614043 X:106898837-106898859 AGGGAGAAGGAAAAGAAAGATGG + Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197182086 X:123547627-123547649 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1197845758 X:130800578-130800600 AGGGAAGACAATTATTAAGAAGG - Intronic
1198034399 X:132786519-132786541 AGAGAGGAGAACTATTAGGATGG - Intronic
1198059393 X:133029759-133029781 AGAGAGAAGAAATATCAAGAGGG - Intronic
1198672198 X:139093052-139093074 AGGGAAAAGAATAATAAAGAAGG + Intronic
1198840347 X:140850370-140850392 AGACAGAAGAAATCTGAAGAAGG + Intergenic
1199535299 X:148895873-148895895 TGGGAGAAGAAATATTAGAGAGG - Intronic
1201063435 Y:10068630-10068652 AGGCAGAAGAAATACTGAAAAGG + Intergenic