ID: 959399470

View in Genome Browser
Species Human (GRCh38)
Location 3:105882403-105882425
Sequence CTGGAAACTCAGTTGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959399470_959399475 12 Left 959399470 3:105882403-105882425 CCCAGGCCCAACTGAGTTTCCAG No data
Right 959399475 3:105882438-105882460 CTATTATGTTGTTTCAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959399470 Original CRISPR CTGGAAACTCAGTTGGGCCT GGG (reversed) Intergenic
No off target data available for this crispr