ID: 959409144

View in Genome Browser
Species Human (GRCh38)
Location 3:105998318-105998340
Sequence CAGCTGACACCCACCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959409144_959409148 11 Left 959409144 3:105998318-105998340 CCTCCATGGGTGGGTGTCAGCTG No data
Right 959409148 3:105998352-105998374 GTTTTGCTTTCTGCTGTGACAGG 0: 26
1: 99
2: 205
3: 366
4: 809
959409144_959409149 12 Left 959409144 3:105998318-105998340 CCTCCATGGGTGGGTGTCAGCTG No data
Right 959409149 3:105998353-105998375 TTTTGCTTTCTGCTGTGACAGGG 0: 29
1: 130
2: 194
3: 309
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959409144 Original CRISPR CAGCTGACACCCACCCATGG AGG (reversed) Intergenic
No off target data available for this crispr