ID: 959409428

View in Genome Browser
Species Human (GRCh38)
Location 3:106001819-106001841
Sequence CTGTTAATACAGATCAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959409428_959409432 17 Left 959409428 3:106001819-106001841 CCCTACTTGATCTGTATTAACAG No data
Right 959409432 3:106001859-106001881 CTATGTTAGAAAGGTCAAAGTGG No data
959409428_959409431 8 Left 959409428 3:106001819-106001841 CCCTACTTGATCTGTATTAACAG No data
Right 959409431 3:106001850-106001872 AAAATTTATCTATGTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959409428 Original CRISPR CTGTTAATACAGATCAAGTA GGG (reversed) Intergenic
No off target data available for this crispr