ID: 959419581

View in Genome Browser
Species Human (GRCh38)
Location 3:106112612-106112634
Sequence CAAGGAGCAGCCGCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 68, 1: 10, 2: 0, 3: 31, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419581_959419585 -6 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419585 3:106112629-106112651 TCCTTGCCCTCGGGCCCCGCGGG 0: 65
1: 9
2: 1
3: 20
4: 153
959419581_959419587 -5 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419587 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 65
1: 8
2: 3
3: 14
4: 148
959419581_959419596 27 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027
959419581_959419598 30 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419581_959419584 -7 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419584 3:106112628-106112650 CTCCTTGCCCTCGGGCCCCGCGG 0: 68
1: 6
2: 4
3: 29
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419581 Original CRISPR CAAGGAGCAGCCGCCTGCCT TGG (reversed) Intergenic
900230108 1:1552398-1552420 CAGGGAGCAGGAACCTGCCTGGG + Intronic
900323482 1:2096088-2096110 CAGGGAGCAGGCAGCTGCCTAGG + Intronic
900353922 1:2250828-2250850 CAACGCGCAGCCAGCTGCCTAGG - Intronic
900503745 1:3019021-3019043 CAAGGCGCAGCAGCCAGCCAGGG + Intergenic
901211212 1:7527050-7527072 AGAGGAGCAGCCGCTGGCCTGGG - Intronic
901332993 1:8424668-8424690 CAAGGAGCTGCAGTCTGCCCAGG + Intronic
901977543 1:13007098-13007120 CAAGGTGCGGCCCCCTGCCTTGG + Intronic
902004540 1:13221837-13221859 CAAGGTGCGGCCCCCTGCCTTGG - Intergenic
902023757 1:13367569-13367591 CAAGGTGAGGCCCCCTGCCTTGG - Intergenic
902821502 1:18946099-18946121 CAAGGAGCTTCAGCCTGCATGGG + Intronic
902917078 1:19645389-19645411 AAGGGGGCAGCCGCCTGCCTTGG + Intronic
903137876 1:21321213-21321235 CCAGGAGCAGGGGCCAGCCTGGG - Intronic
903526484 1:23994945-23994967 CAAGGAGCAGCCGCCGGCCTTGG - Intergenic
903539005 1:24086282-24086304 CAAGGAGCAGGGGGCTGCTTGGG + Intronic
903594007 1:24480108-24480130 CATGGAGCTGCTGGCTGCCTTGG - Intergenic
903923434 1:26817467-26817489 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
904479540 1:30785368-30785390 GGAGGAGCAGCCGCCTTGCTGGG - Intergenic
904794835 1:33051337-33051359 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
906486665 1:46240498-46240520 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
907430276 1:54407053-54407075 AAAGGAGCAGCCGCGCGCCTCGG - Intronic
907453907 1:54563045-54563067 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
911104660 1:94120317-94120339 CAATGAGCAGACACCAGCCTGGG - Intronic
912825469 1:112899295-112899317 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
912844675 1:113068810-113068832 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
915071434 1:153272338-153272360 CAAGGACCAGCCTCGAGCCTGGG + Intergenic
915084914 1:153379787-153379809 CAAGGAGCCGCCGCCACCCTAGG - Intergenic
915084922 1:153379816-153379838 CAAGGAGCCGCCGCCACCCTAGG - Intergenic
918408787 1:184236861-184236883 CCAGGATGATCCGCCTGCCTCGG + Intergenic
921414431 1:214870401-214870423 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
921944945 1:220879931-220879953 GAAGGAGCAGCCGCCTGGGCCGG - Exonic
922067297 1:222156773-222156795 CAGGCAGCAGCCACCAGCCTGGG - Intergenic
1062849166 10:729682-729704 CAAGGAGCTTCCACCTGTCTGGG + Intergenic
1063628020 10:7708817-7708839 CAATGAGCAGAAGTCTGCCTTGG - Intronic
1065335707 10:24655571-24655593 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1065818157 10:29500523-29500545 CTAGCAGCAGCAGCCTTCCTCGG - Intronic
1065843126 10:29722002-29722024 CAAAGGTCATCCGCCTGCCTCGG - Intronic
1066325266 10:34352702-34352724 CACCTCGCAGCCGCCTGCCTTGG + Intronic
1067065470 10:43101844-43101866 TGAGGAGCAGCCGCCCACCTAGG + Intronic
1070318240 10:75334176-75334198 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1070665715 10:78342056-78342078 CAAGGGGCTGCTGCCTGGCTGGG + Intergenic
1070682727 10:78460320-78460342 CAGAGAGCAGCTGCCTCCCTGGG + Intergenic
1071490897 10:86135636-86135658 CAAGGTGCTGGGGCCTGCCTGGG - Intronic
1071524390 10:86349725-86349747 CAAGGAGCAGCAGCATGCAGAGG + Intronic
1072150158 10:92675964-92675986 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1072770667 10:98134840-98134862 CGAGGGGCCGCCCCCTGCCTGGG + Intronic
1072950111 10:99840104-99840126 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1075219884 10:120575759-120575781 CAAGCAGCAGCTGCAAGCCTGGG + Intronic
1075659246 10:124182043-124182065 TAAGGAGCACCAGCCTGTCTTGG + Intergenic
1076515714 10:131043400-131043422 CAAGGAGCAGCCGGCTGCCTGGG - Intergenic
1076770211 10:132658845-132658867 CCGGGAGCAGCCGGCGGCCTTGG - Intronic
1076923161 10:133466011-133466033 CAAGGGACAGCCCCCTTCCTTGG - Intergenic
1077219738 11:1410693-1410715 TCAGGAGCCCCCGCCTGCCTAGG + Intronic
1077407933 11:2390995-2391017 CAAGGTGCAGCTGCCTGCAGGGG - Intronic
1077455253 11:2674358-2674380 CAAAGAGCAGCTTCCTGCTTAGG + Intronic
1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG + Intergenic
1080755437 11:35192724-35192746 CAGGAAGCAGACTCCTGCCTTGG + Intronic
1081784940 11:45739153-45739175 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1081910571 11:46697352-46697374 CATGGAGCAGCCTCTTCCCTGGG - Intronic
1087183037 11:95158276-95158298 CAAGGTGCAGCTGACTGCTTAGG + Intergenic
1088841285 11:113629655-113629677 CCAGGAACCGCCTCCTGCCTTGG - Intergenic
1089609643 11:119662354-119662376 CACCGAGCAGCTGCCAGCCTGGG - Exonic
1091762430 12:3095974-3095996 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1092684871 12:11031553-11031575 CCAGCAGCAGCAACCTGCCTGGG - Intronic
1095439358 12:42227196-42227218 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1096022471 12:48333742-48333764 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1097334138 12:58363384-58363406 CAAGGAGCAGCTGCAGGCATGGG + Intergenic
1101603835 12:106233109-106233131 CTCGGAGCAGCCGGCGGCCTGGG + Intergenic
1102578403 12:113871882-113871904 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1102787807 12:115618760-115618782 TGAGGAGCAGCCACCTGCCTTGG - Intergenic
1103602535 12:122063419-122063441 CAAGGAGCAGTCTCATGCCCAGG + Intergenic
1104568275 12:129903874-129903896 CGAGGCGCAGCGGCCGGCCTGGG - Intergenic
1106422462 13:29595376-29595398 CAAGGAGCTGCCCCCTGCGTTGG + Intronic
1108068212 13:46600959-46600981 CAAGGAGCAGCTGCCTGTAAAGG - Intronic
1110269191 13:73574301-73574323 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1113438071 13:110308060-110308082 CCAGCAGCAGCCACCTGCATGGG - Exonic
1113441744 13:110334418-110334440 CACAGAGCAGCCGTCTGCCTGGG + Intronic
1113665115 13:112136131-112136153 CAGGGCACAGCCTCCTGCCTAGG + Intergenic
1114651064 14:24284805-24284827 CTGGGCCCAGCCGCCTGCCTGGG + Intergenic
1115609562 14:35038567-35038589 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1116871653 14:50073982-50074004 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1119601510 14:75979992-75980014 CAAGAAGCTGTCTCCTGCCTGGG + Intronic
1120038585 14:79726931-79726953 CAAGGAGAAGCCACGTGCTTTGG + Intronic
1121201766 14:92123335-92123357 CCAGGATTATCCGCCTGCCTCGG + Intronic
1121349282 14:93160703-93160725 GAAGGAGCAGCCAGCTACCTGGG - Intergenic
1122037004 14:98956273-98956295 CAAGGAGCAGCAGGCTGGCAGGG + Intergenic
1122270553 14:100566981-100567003 CAAGGAGCAGAGCCCAGCCTGGG - Intronic
1122753587 14:103958661-103958683 CATGGAGAAGCTGCCTGCATTGG - Intronic
1122964009 14:105112674-105112696 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1123036449 14:105473873-105473895 CCAGGACCAGCTGCGTGCCTGGG - Intronic
1123156470 14:106232038-106232060 CAAGGAGCAGCCCCCAGGCTTGG - Intergenic
1123676110 15:22711371-22711393 AAAGTAGCAGCCTCCTGTCTGGG - Intergenic
1123734676 15:23174546-23174568 AAAGTAGCAGCCTCCTGTCTGGG + Intergenic
1123752844 15:23372180-23372202 AAAGTAGCAGCCTCCTGTCTGGG + Intergenic
1123876403 15:24627961-24627983 CAGGGAGCAGCATCCTGACTTGG + Intergenic
1124024021 15:25948279-25948301 GAAGTAGCAGCCTCCTGTCTGGG + Intergenic
1124285179 15:28395848-28395870 AAAGTAGCAGCCTCCTGTCTGGG + Intergenic
1124297517 15:28515766-28515788 AAAGTAGCAGCCTCCTGTCTGGG - Intergenic
1124328308 15:28785289-28785311 AAAGTAGCAGCCTCCTGTCTGGG - Intergenic
1124407359 15:29404523-29404545 GAAGGAACACCCTCCTGCCTTGG + Intronic
1124441435 15:29688900-29688922 CATGGAGCAGCCGCGTGGCATGG - Intergenic
1124653352 15:31488524-31488546 CAAGCAGCAGCCTCCTCCATGGG + Intronic
1125079052 15:35655586-35655608 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1125659018 15:41381955-41381977 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1129428286 15:75480828-75480850 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1132403473 15:101528077-101528099 GATGGAGCAGGAGCCTGCCTGGG + Intergenic
1132501526 16:286576-286598 CAAGGAGATGGCCCCTGCCTGGG + Exonic
1132561881 16:598952-598974 CCAGCAGCAGCCGCCGGCCCCGG - Intronic
1132740234 16:1408445-1408467 CAAGGGGCAGCCACCCACCTAGG + Intronic
1132776625 16:1598771-1598793 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1132939533 16:2499986-2500008 CCAGGAGCACCCGCCTGCCCTGG + Intronic
1137421054 16:48334434-48334456 CAAAGGGCAGCCTCCTGCCCAGG - Intronic
1137570274 16:49560928-49560950 TAAAGAGCAGCCTCCTGCCCTGG - Intronic
1137730603 16:50686898-50686920 CACAGAGCAGCCTCCAGCCTGGG - Intergenic
1139522459 16:67492071-67492093 CAAGGAGTAGGCTCCAGCCTGGG - Intergenic
1141620517 16:85234766-85234788 CAGGGAGGAGCCGGCAGCCTTGG + Intergenic
1142132024 16:88435534-88435556 CGGGGAGCAGCCGCCTCGCTTGG + Exonic
1143109056 17:4543413-4543435 CAAGGGCCAACTGCCTGCCTGGG + Intronic
1144646060 17:16974348-16974370 CACGGAGCAGCTGGCTCCCTGGG + Intergenic
1144799091 17:17912824-17912846 CAACTCCCAGCCGCCTGCCTTGG - Intronic
1145205680 17:20984037-20984059 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1145255437 17:21319730-21319752 CCAGGAGAAGCCGGCTGCCCTGG - Intergenic
1146277706 17:31525661-31525683 CAAGGAGCAGCCCCGGGCCAGGG + Intronic
1147554465 17:41467595-41467617 AAAGGGTCAGCCGCATGCCTGGG + Intergenic
1147931440 17:43983904-43983926 CAAACAGCAGCCGCTCGCCTCGG - Intronic
1147963197 17:44180039-44180061 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1148127837 17:45245969-45245991 CCAGGAGCAGTTGCCTACCTTGG - Exonic
1149565253 17:57636528-57636550 CAGGGAGCTGCTTCCTGCCTTGG + Intronic
1149908740 17:60550871-60550893 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1149993351 17:61394837-61394859 CAAGGAGCAGAGGCCAGGCTAGG + Intergenic
1149997125 17:61411264-61411286 CAAGGCCCAGCCGCCGGCCGCGG - Intergenic
1150270211 17:63859323-63859345 CCTGGAGCTGCAGCCTGCCTGGG + Intergenic
1151472094 17:74325066-74325088 CAAGAAGCAGCCGTCAGCCTTGG - Intergenic
1151535384 17:74736424-74736446 CCAGGAGCTGCCGGGTGCCTGGG + Intronic
1152211931 17:79007070-79007092 CGGGGAGCAGCGTCCTGCCTGGG + Intronic
1152420187 17:80188565-80188587 CAGAGAGCGGCCTCCTGCCTTGG + Intronic
1152557214 17:81059356-81059378 CAACCAACAGCAGCCTGCCTTGG + Intronic
1152660609 17:81540263-81540285 CAGGGAGCACCCTCCTACCTCGG + Exonic
1152689939 17:81713379-81713401 CACTGGGCAGCCGCCTGTCTAGG + Intronic
1152769350 17:82157771-82157793 CAGGAAGCAGCCCCCAGCCTCGG - Exonic
1153659995 18:7317787-7317809 CAAGGGGCAGGGGCCGGCCTAGG - Intergenic
1153910779 18:9704973-9704995 CACCGAGCAGCCACCTTCCTTGG + Intergenic
1154326482 18:13395053-13395075 CCAGGAGGAGCAGCCTGCCCCGG + Intronic
1156816383 18:41316679-41316701 CAAGAAGCAGCCAAATGCCTAGG + Intergenic
1157545688 18:48544994-48545016 CAAGGGGCAGCCACCTGCTCCGG + Intronic
1157626762 18:49057326-49057348 CAAGGAGCAGCAGTCTGCAGAGG - Intronic
1160406921 18:78652698-78652720 CAAGTAGCCGCCGCCTTCCTCGG - Intergenic
1160556707 18:79730283-79730305 TAAGGAACAGTCACCTGCCTAGG + Intronic
1161646275 19:5455335-5455357 CCAGGAGCTGCCAGCTGCCTGGG - Intergenic
1161738863 19:6008070-6008092 CACGCAGGAGCTGCCTGCCTGGG + Intronic
1161978553 19:7619201-7619223 CAGGCAGCTGCCGCCTCCCTGGG - Intergenic
1162886703 19:13702797-13702819 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1163906075 19:20150687-20150709 CAAGGAGCAGCTGCCTGCCTTGG - Intergenic
1164191919 19:22925543-22925565 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1164653328 19:29901680-29901702 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1166261450 19:41644267-41644289 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1166851532 19:45763753-45763775 CAAGGAGCTGCCACCTGCCCTGG + Intronic
925845691 2:8031389-8031411 GAAGGAGCAGCCGCCCAGCTAGG + Intergenic
929614384 2:43296896-43296918 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
932124546 2:69131951-69131973 GTAGGAGCAGACCCCTGCCTGGG + Intronic
933377717 2:81501352-81501374 GATGGAGCTGCCACCTGCCTTGG - Intergenic
935082160 2:99808774-99808796 AGAGAAGCAGCCCCCTGCCTTGG + Intronic
936545997 2:113393838-113393860 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
937301986 2:120848247-120848269 CAAGCAGAAGCCTCCTGCCCTGG + Intronic
937919680 2:127120477-127120499 CAAGGAGCAGCCGCCTGCTTTGG - Intergenic
939646420 2:144704887-144704909 CAGGGAGCAAACACCTGCCTTGG - Intergenic
941656002 2:168145427-168145449 CAAGCAGCAGGGGCCTGCCTTGG - Intronic
1169149464 20:3277831-3277853 CAGGGACCAGCCTCCTGCCCTGG + Intronic
1170425159 20:16228387-16228409 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1170667541 20:18399790-18399812 CAAGGAGCAGCTGGCTGCTTTGG + Intronic
1170674630 20:18467524-18467546 GAAGGTGCAGCCGCCTGACGCGG + Exonic
1171313675 20:24167107-24167129 CCAGGTGCAGCCTCCTGCCAGGG - Intergenic
1171892512 20:30728879-30728901 CAATGAGCCTCCGCTTGCCTGGG + Intergenic
1172167953 20:32910354-32910376 CAAGGTGCTGCCTGCTGCCTGGG - Intronic
1172350050 20:34231314-34231336 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1174378241 20:50140284-50140306 CAGGGAGGAGGCGCCTGCCATGG - Intronic
1174488016 20:50873321-50873343 CTAGGAGAGGCCGCCTGGCTGGG + Intronic
1174646729 20:52092614-52092636 CAAGGCGGATCCGCCTGCCTTGG - Intronic
1175412117 20:58777291-58777313 CAAGGTGCAGGGGCCTGCCTGGG - Intergenic
1175695987 20:61103053-61103075 CAAGAAGAAGCCACATGCCTTGG + Intergenic
1177178627 21:17721091-17721113 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1178882715 21:36461693-36461715 CATGGTGCGGCTGCCTGCCTAGG + Exonic
1179098600 21:38337029-38337051 CAGGCAGCTGCCGCCTTCCTGGG - Intergenic
1179728610 21:43354596-43354618 CCAGGAGCACCCTCCTGCCCTGG + Intergenic
1180137210 21:45869482-45869504 CAGGGAGCAGCCACCTGCCAGGG - Intronic
1180843623 22:18970395-18970417 CTGGGCGCAGGCGCCTGCCTGGG - Intergenic
1181256759 22:21567830-21567852 TGAGAAGCCGCCGCCTGCCTCGG - Intronic
1181441684 22:22939268-22939290 CCAGGAGCAGGAGCCTGCCTTGG + Intergenic
1181908638 22:26220145-26220167 AAAGGTGGAGCCGCTTGCCTGGG - Intronic
1182583280 22:31328038-31328060 CAATCAGCAGCTTCCTGCCTGGG + Intronic
1183282399 22:36938586-36938608 CAAGGGGCAGCCTCCTGTCAAGG + Exonic
1183434650 22:37786584-37786606 CAACTCCCAGCCGCCTGCCTTGG + Intergenic
1183841626 22:40502691-40502713 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1183845117 22:40536461-40536483 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1183984358 22:41561476-41561498 CAAGCCGCAGCCTCCTGTCTGGG + Intronic
1184873722 22:47258894-47258916 CAAAGAGCAGCCGCAGGGCTGGG + Intergenic
1185051246 22:48555408-48555430 CAGGGAGCAGCCGCCCTCCCCGG - Intronic
950253858 3:11488284-11488306 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
950542693 3:13621662-13621684 CAAGGGGCAGGGGCCTGTCTGGG - Intronic
951013727 3:17705886-17705908 CAAGGAGCAGACGCCTGCCTTGG - Intronic
952430590 3:33219182-33219204 CAAGGAGCCCCCGCCCGTCTGGG + Exonic
952896674 3:38082434-38082456 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
952970886 3:38649553-38649575 CAAGCAGCAGCCGCCCACCCCGG - Exonic
953061050 3:39429145-39429167 CAGGGTGCAGCTTCCTGCCTTGG - Intergenic
954080532 3:48210885-48210907 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
954783411 3:53076174-53076196 CAAGGGCCAACCGCCTGCCCAGG - Intronic
955297232 3:57746979-57747001 CAAGGAGCAGCCGCCTGTCTTGG + Intergenic
956270221 3:67443408-67443430 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
957510501 3:81181780-81181802 CCAGTAGCAGCAACCTGCCTGGG + Intergenic
959042507 3:101438890-101438912 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
959419581 3:106112612-106112634 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
960941749 3:122939524-122939546 CAGGGAGCAGCCTCCTGGCTTGG + Intronic
961103215 3:124219699-124219721 CAAGGAGCATCCCCCTCCTTAGG - Intronic
966039235 3:175460908-175460930 CCAGGAGCAGCAACCTGCTTGGG - Intronic
966359461 3:179119514-179119536 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
968719876 4:2193844-2193866 GAGGGAGCAGCCCCCTGCCTGGG - Intronic
982616094 4:157637733-157637755 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
984171724 4:176368065-176368087 CAAGCACCAGCTGCGTGCCTAGG + Intergenic
984612482 4:181856704-181856726 CCAGGAGGAGCAGCCTGCCCAGG - Intergenic
985772330 5:1820651-1820673 ACAGGAGCAGCCGCCTCCCCTGG - Intergenic
988551877 5:32207596-32207618 TTTGGAGCAGCCGCCTGCCTTGG + Intergenic
988806550 5:34746001-34746023 CAAAGATCAGCCTTCTGCCTTGG + Intronic
989326825 5:40206261-40206283 CAAGGATCAGCCTGCTGACTTGG + Intergenic
992373726 5:76171097-76171119 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
992955029 5:81899749-81899771 CAAGGAGCAGCTGTCTGGGTAGG + Intergenic
997604387 5:135163607-135163629 GCAGGAGCAGAAGCCTGCCTGGG - Intronic
998338279 5:141393581-141393603 CAGTAAGCAGCCGCGTGCCTGGG - Exonic
999113454 5:149141662-149141684 CAAGGAGCAGCGACCCGCCCCGG - Exonic
999372155 5:151062446-151062468 CAAGGAGCAGCAGCCAACTTGGG - Intronic
999580647 5:153034892-153034914 CATCTAGCTGCCGCCTGCCTTGG - Intergenic
1000985253 5:167858867-167858889 CAAGGAGCAGCTGCCTGCCTTGG + Intronic
1001264436 5:170262655-170262677 AAAGGAGCAGCCCCCTGCCAGGG - Exonic
1002341406 5:178518781-178518803 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1004378810 6:15114747-15114769 CCAGGAGCCACTGCCTGCCTGGG - Intergenic
1004387955 6:15188484-15188506 CAAGGAGCAGCCGCCGGCCTTGG + Intergenic
1004774096 6:18823133-18823155 CAAGGAGCAGCTGCCTGGGGTGG - Intergenic
1006492136 6:34397017-34397039 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1006788089 6:36681052-36681074 CAAGGAGGAGGCGCCCGCCTAGG - Intronic
1007674423 6:43581532-43581554 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1007686320 6:43669351-43669373 CAGGGTGCAGCCGCCTGCCCAGG - Intronic
1007706400 6:43793945-43793967 CACGGGGCAGCCGCCTGGTTGGG + Intergenic
1007989749 6:46243066-46243088 GAAGGAGCAACCTCTTGCCTTGG + Intronic
1011405417 6:87010786-87010808 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1011912988 6:92465719-92465741 CAAGGAGCAGCCTCCTGGAGTGG + Intergenic
1013307097 6:108859313-108859335 CAAGGAGAAGCCGTCTCCCCAGG - Intronic
1015476545 6:133664327-133664349 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1015981392 6:138843105-138843127 TAAGTAGCAGCAGCCTCCCTAGG - Exonic
1017507445 6:155081591-155081613 CAGGGAGCCTCTGCCTGCCTGGG - Intronic
1018867599 6:167758370-167758392 GAAGGAGCTGCCGGCTGCCGTGG - Intergenic
1018908580 6:168089094-168089116 CAGGGGCCAGCAGCCTGCCTGGG + Intergenic
1019693741 7:2432900-2432922 GACGGAGCAGCCGCCTGCGCCGG + Exonic
1020440790 7:8214573-8214595 CAAGGAGCAGATGCCTGGCAGGG + Intronic
1020616622 7:10466406-10466428 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1021872154 7:25017992-25018014 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1023271272 7:38465449-38465471 CAATGAGCAGGGGCCTACCTGGG + Exonic
1026595835 7:71733375-71733397 CAAGGAGCAGACACCTGCTCAGG - Intergenic
1035173399 7:157033476-157033498 GACGGAGCTGCCGCCTGGCTGGG - Intergenic
1035508099 8:150568-150590 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1035742268 8:1937398-1937420 CTTGGATCAGCCGCCTACCTGGG + Intronic
1035749123 8:1983385-1983407 CAAGGAGCACCCAGCTGCCTGGG - Intronic
1036536864 8:9658279-9658301 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1037876942 8:22553018-22553040 CAAGGAGCTGCCCCCAGCCTTGG + Intronic
1042048825 8:64685222-64685244 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1042950353 8:74195268-74195290 AAAGGAGCAGCTGCCTTCCCGGG + Intergenic
1044527724 8:93270655-93270677 CAAGGAGAAACCATCTGCCTGGG - Intergenic
1044660476 8:94590252-94590274 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1047687131 8:127315918-127315940 CAGGGAGCAGCCGCCTGCCTTGG + Intergenic
1047848261 8:128827105-128827127 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1048290547 8:133178191-133178213 CAAGGAGCAGGAGGCAGCCTAGG - Intergenic
1048985289 8:139731695-139731717 CATGGAGCAGCCCCCTGTCCTGG + Intronic
1049802658 8:144525371-144525393 CAAGCAGCAGCCACTTGCCTGGG - Intronic
1049931427 9:460749-460771 CAAGGAAGAGCTACCTGCCTAGG - Intronic
1052816719 9:33107505-33107527 CCAGGGGCAGCCGCCTCCTTGGG + Intronic
1053256027 9:36615993-36616015 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1053457079 9:38241588-38241610 CAAGGAGCAGCCGCCTGCCTTGG + Intergenic
1053604070 9:39639372-39639394 CAAGGGGCTGACTCCTGCCTAGG - Intergenic
1053861885 9:42395424-42395446 CAAGGGGCTGACTCCTGCCTAGG - Intergenic
1054249470 9:62703042-62703064 CAAGGGGCTGACTCCTGCCTAGG + Intergenic
1054563581 9:66737574-66737596 CAAGGGGCTGACTCCTGCCTAGG + Intergenic
1056997248 9:91474430-91474452 CAAGGAGCAGCAGCCTTCATGGG - Intergenic
1057208104 9:93185079-93185101 CCAGGAGGAGCCGCCGGGCTTGG + Exonic
1057269859 9:93644720-93644742 CAAGGAGCAGGAGGCAGCCTGGG + Intronic
1058856041 9:109063352-109063374 CCATGATCCGCCGCCTGCCTTGG + Intronic
1059210871 9:112513748-112513770 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1060064790 9:120495101-120495123 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1060484393 9:124037948-124037970 CAAGGAGAAGCCACTTGCCCAGG + Intergenic
1061263962 9:129495155-129495177 CAGAGAGAAGCCGCCTCCCTGGG + Intergenic
1061826171 9:133259684-133259706 GAAGGAGCGGCCCCCTCCCTCGG + Intronic
1061984080 9:134119021-134119043 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1062198344 9:135287057-135287079 CAAGGAGCAGCCGAGGACCTGGG + Intergenic
1062446438 9:136597312-136597334 GAAGGAGGAGCCCCCAGCCTCGG - Intergenic
1062484043 9:136765307-136765329 CAAGGAGCAGCAGGTGGCCTCGG + Intronic
1185877660 X:3713467-3713489 GTGGGAGCAGCCGCCGGCCTCGG + Exonic
1186443850 X:9608854-9608876 CAGGGAGCAGCTGCCCGCCTTGG + Intronic
1187976685 X:24710028-24710050 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1191618301 X:63190294-63190316 CAAGGAGCAGCCGCCTGCCTTGG - Intergenic
1192239839 X:69320302-69320324 AAGGGATCAGCTGCCTGCCTAGG - Intergenic
1192621091 X:72680882-72680904 CAAGGAGCAGCCGCCTGCCTTGG + Intronic
1195036310 X:100973352-100973374 CAAGGAGCAGCCGCCTGCCTTGG - Intronic
1196404604 X:115348228-115348250 CAAGGAGCAGCCGCATGCCTTGG - Intergenic