ID: 959419586

View in Genome Browser
Species Human (GRCh38)
Location 3:106112630-106112652
Sequence CCCCGCGGGGCCCGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 66, 1: 10, 2: 2, 3: 30, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419586_959419601 22 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419586_959419598 12 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419586_959419605 27 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419586_959419596 9 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027
959419586_959419607 30 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419586 Original CRISPR CCCCGCGGGGCCCGAGGGCA AGG (reversed) Intergenic
900140197 1:1136652-1136674 GCCCGCAGGGACCCAGGGCAGGG - Intergenic
900157032 1:1207232-1207254 CCCCGCGGGCACCCAGGGCCCGG + Intergenic
900407876 1:2500365-2500387 CACCTCTGGGCCCGAGAGCATGG - Intronic
900488136 1:2933184-2933206 CCCCGAGGCCCCAGAGGGCAGGG - Intergenic
900667179 1:3823379-3823401 CCCCTGGTGACCCGAGGGCACGG + Intronic
901022717 1:6263119-6263141 CCCCGGGGGGCCAAGGGGCATGG + Intergenic
901409294 1:9071621-9071643 CCCCTCTGGGCCTGAGGGCCTGG - Intronic
901851703 1:12019953-12019975 CCCCGCAGGGCCGGGGGGCACGG - Intronic
901866989 1:12112801-12112823 CCCCGAGGGGCATGTGGGCAGGG + Intronic
903514774 1:23902967-23902989 CCCGGCGCGGCGCGAGGGCGCGG - Intronic
903526490 1:23994963-23994985 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
903792751 1:25906052-25906074 CCCGGCGGGGCCCGCAGGGAAGG + Intronic
903923429 1:26817449-26817471 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
904029519 1:27525644-27525666 CCCCGCAGGGCCCAAGGGGCCGG - Intergenic
904794830 1:33051319-33051341 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
906140830 1:43532385-43532407 CCCTGAGGGGCCACAGGGCAGGG + Intronic
906147489 1:43568692-43568714 CCCCGAGGGGCTGCAGGGCAAGG - Intronic
906263157 1:44407913-44407935 CCGCGCGGGGCCCGCGGGGCAGG - Intronic
906436934 1:45804045-45804067 CCCCGCGGGGCCCGAGGGCAAGG + Exonic
906486660 1:46240480-46240502 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
907179049 1:52553518-52553540 CCACCCGGGGCTCGCGGGCAGGG + Intergenic
907453912 1:54563063-54563085 CCCCGCAGGGCCCGAGGGCAAGG - Intronic
912825474 1:112899313-112899335 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
912844670 1:113068792-113068814 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
913131092 1:115838881-115838903 AGCCGCGGCGCCCGAGGGCCTGG + Exonic
915238584 1:154502932-154502954 CCCCTCTGAGCCCGGGGGCACGG - Intronic
915313865 1:155017459-155017481 CTCCCCGGGGCCAGAGGGCAGGG + Exonic
916694502 1:167221624-167221646 CCCCGCGCGGGGCGCGGGCAGGG - Intronic
920013688 1:202888700-202888722 CCCCCCGGGGGCAGAGGGCCGGG + Intronic
920531667 1:206706840-206706862 CCCCTCGGGGCTAGAAGGCAGGG + Intronic
921414436 1:214870419-214870441 CCCCGCGGGGCCCAAGGGCAAGG - Intergenic
921923138 1:220690451-220690473 CGCCGCGGGCCCCGAGGGCGAGG + Exonic
922250502 1:223845566-223845588 CCCCGACGCGCCCGAGGGCGCGG + Intronic
922730396 1:227946379-227946401 CTCCGCTGGGCCGGAGAGCAGGG + Intronic
923699021 1:236282159-236282181 CGCCGCGGAGCCCGAGGCCTCGG - Intergenic
923725133 1:236499199-236499221 TTCCTAGGGGCCCGAGGGCACGG - Intergenic
924802223 1:247335759-247335781 CCACGGGGAGCCGGAGGGCAGGG + Intergenic
1064687660 10:17880615-17880637 CCCTGATGGGACCGAGGGCATGG - Exonic
1065335702 10:24655553-24655575 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1067140056 10:43648981-43649003 ACCTGCGGGGCCCGAGCGCAGGG - Intergenic
1067140061 10:43648994-43649016 CCCCGCAGGTCCCTAGGGCGCGG + Intergenic
1067537423 10:47124065-47124087 CCCCGTGGAGCCAGGGGGCATGG + Intergenic
1069573319 10:69507366-69507388 CCCCTCGGGGCAGGAGGGAAGGG + Exonic
1070318245 10:75334194-75334216 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1072139056 10:92573881-92573903 ACCCACGGGGCCCGAGGGCCCGG + Intronic
1072150163 10:92675982-92676004 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1072950116 10:99840122-99840144 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1073240757 10:102056203-102056225 CCCGGCGGGGCGCGGGGACACGG - Intergenic
1074085723 10:110207918-110207940 CCCAGCGGGGTCCTCGGGCAGGG - Exonic
1076680631 10:132169580-132169602 CTCAGCGGGGCCCTGGGGCAGGG + Intronic
1076750402 10:132539257-132539279 CCCTGCAGGGCCAGAGGGTAGGG + Intronic
1076782105 10:132730172-132730194 CCCCGCAGGGGCTGAGGACAGGG - Intronic
1076889243 10:133275881-133275903 TCTGGAGGGGCCCGAGGGCAAGG + Intronic
1077121560 11:911108-911130 CCCCGCGCGGCCCCACGCCAAGG - Intronic
1077367882 11:2168485-2168507 CCCCGCGGGGCCCAAGGGTGAGG - Exonic
1077603554 11:3591456-3591478 CCCCGCGGGGCCCGACCCCCTGG - Intergenic
1078057348 11:8019088-8019110 CCCCGCGGGACCCGAGCGAGGGG + Intergenic
1081784945 11:45739171-45739193 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1081869024 11:46374948-46374970 CCCAGGGTGGCCCCAGGGCATGG - Exonic
1083809636 11:65096403-65096425 CCCCGCGGGGCCCGACCCCCTGG + Exonic
1083890075 11:65591671-65591693 CCCAGCAGTTCCCGAGGGCAGGG - Intronic
1083997213 11:66278401-66278423 CAGCGCGGGGCCCGGGCGCAAGG - Exonic
1084068542 11:66719281-66719303 CCCTGGTGGGCCAGAGGGCAGGG - Intronic
1084174795 11:67417562-67417584 CCCCGAGGGGGCCGAGGCCCGGG + Exonic
1091762435 12:3095992-3096014 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1092264496 12:6970486-6970508 GCCCGCCGGGCCCCGGGGCATGG - Exonic
1094048674 12:26195732-26195754 CGCCGCTGGGCCCGACGACATGG + Exonic
1094607300 12:31959652-31959674 GCCGGCGGGGCCCGAGGCCCGGG - Intronic
1095439353 12:42227178-42227200 CCCCACGGGGCCCGAGGGCAAGG + Intronic
1096022476 12:48333760-48333782 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1096738870 12:53677191-53677213 CGCCGCGGGGCCCGGGAGCCGGG - Intronic
1097552863 12:61098251-61098273 CCCTGCTGGGCCCCAGGCCAGGG + Intergenic
1098105840 12:67068912-67068934 GCCCGCGGGCCCTGAGGGCGCGG + Intergenic
1102217338 12:111170835-111170857 CCACGCTGGGCCCGAGGTCAGGG - Intronic
1102578399 12:113871864-113871886 CCCCGCGGGGCCGGAGGGCAAGG + Intronic
1103323052 12:120102709-120102731 TGCCGAGGGGCCCGGGGGCAGGG + Intronic
1103741537 12:123094746-123094768 CCCAGGTGGGGCCGAGGGCAGGG + Intronic
1106735649 13:32586220-32586242 CGCCGCGGGGCCCGCGAGAAGGG - Intergenic
1110269186 13:73574283-73574305 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1113647542 13:112009723-112009745 CCTCGCGTGGCTGGAGGGCAAGG - Intergenic
1113869335 13:113548541-113548563 CACAGCGGGGCCTGGGGGCAGGG + Intronic
1113981671 13:114281686-114281708 CCGCGCGGGGCCCGAGCGGGAGG + Exonic
1115609557 14:35038549-35038571 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1116871648 14:50073964-50073986 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1117910889 14:60637586-60637608 GCCCGCGGGGCCCGATCGGAAGG + Intergenic
1119410246 14:74425939-74425961 CTCCGCGGGGCTCGGGGGCTCGG + Exonic
1121870684 14:97404289-97404311 CCCAGTGGTCCCCGAGGGCAAGG + Intergenic
1122715547 14:103694788-103694810 CCCCGTGGGGCACGAAGGCTGGG + Intergenic
1122964014 14:105112692-105112714 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1122982404 14:105197589-105197611 CCCAGCTGGGCCTCAGGGCAGGG + Intergenic
1122993251 14:105248797-105248819 CCCGGCGCGGCGCGAGGGCGCGG + Exonic
1123004379 14:105314440-105314462 CCCCCCGGGAGCCGCGGGCAAGG - Exonic
1123040329 14:105487712-105487734 CCCCTCGGGGCGCGCGGGCGCGG - Intronic
1123040332 14:105487716-105487738 GCCCGCGCGCCCCGAGGGGAGGG + Intronic
1124500413 15:30223231-30223253 CCCCGCGGGGCCCGAGGGCCCGG + Intergenic
1124743160 15:32315435-32315457 CCCCGCGGGGCCCGAGGGCCCGG - Intergenic
1125079046 15:35655568-35655590 GCCCCGCGGGCCCGAGGGCAAGG + Intergenic
1125476848 15:40053563-40053585 CCCCGCGGGGCAGTAGGGGACGG - Intergenic
1125508929 15:40282636-40282658 CCCCGCGGGGCGCGAGAACAGGG - Intronic
1125659013 15:41381937-41381959 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1125678036 15:41512868-41512890 CCCCTCGGTGCCTGAGAGCAAGG + Exonic
1125722965 15:41853904-41853926 CCCCGAGGGGCCCTAGGACTTGG - Intronic
1129172606 15:73817305-73817327 CCCCACAGGGACCGATGGCATGG + Intergenic
1129428281 15:75480810-75480832 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1131098880 15:89672793-89672815 CCTGGCAGGGCCGGAGGGCACGG - Intronic
1132570407 16:641737-641759 CCCCCGGAGGCCCGAGGCCAAGG - Intronic
1132854279 16:2037879-2037901 CCCCACGGCGGCCGAGGCCAAGG + Exonic
1132872489 16:2122048-2122070 CCCGGTGGGGCCCGGGGCCAGGG + Intronic
1133317725 16:4894648-4894670 CCCGGCAGGGCCTGAGGGCCTGG + Intronic
1133365678 16:5207234-5207256 CCCCGCGGGGCCCGAACCCCTGG + Intergenic
1133784596 16:8964118-8964140 GCCCCCAGGGCCCGGGGGCAGGG - Intronic
1134134137 16:11668560-11668582 CCCCGCCCGGCCCGAGCGCGCGG - Intronic
1136771516 16:32845718-32845740 GCTCGAGGGGCCCGTGGGCAGGG - Intergenic
1137084124 16:36100919-36100941 GCTCGAGGGGCCCGTGGGCAGGG - Intergenic
1137426329 16:48384703-48384725 CCCCGCGGCGCCCGGAGGCCCGG - Intronic
1137590349 16:49689682-49689704 CCCCGGGGGCCCCAAAGGCATGG + Intronic
1141558818 16:84853529-84853551 CACCGAGGGGCCTGTGGGCAGGG - Intronic
1142305279 16:89281019-89281041 CTCCGCGGGAACCGGGGGCAGGG + Exonic
1203073940 16_KI270728v1_random:1107829-1107851 GCTCGAGGGGCCCGTGGGCAGGG - Intergenic
1142685371 17:1574598-1574620 CCCCACGGAGCCCGCCGGCAGGG + Exonic
1143116473 17:4584411-4584433 TCCCGCTGGGCTCCAGGGCAGGG + Intronic
1144650534 17:17004321-17004343 CCACGAAGGGCCCGAGAGCATGG - Intergenic
1145205675 17:20984019-20984041 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1145713116 17:26994513-26994535 CCCCGGGAGGCCCCAGAGCATGG - Intergenic
1145974355 17:28975797-28975819 CCACCTGGGGCACGAGGGCAGGG + Intronic
1146723903 17:35142204-35142226 CGCCGCGGGGCGCTAGGGCCCGG - Intronic
1147156703 17:38547785-38547807 CCCCGGGGGGCCCCAGGTCCTGG + Intronic
1147963192 17:44180021-44180043 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1148747070 17:49924406-49924428 CCCCCCGGGGCCCGGGAGGAGGG + Intergenic
1148755659 17:49971824-49971846 GCCCGCAGCGCCCGAGGCCACGG + Intronic
1149908735 17:60550853-60550875 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1150217252 17:63477480-63477502 AGCCGCGGGGCCCGAGCGCCGGG + Intergenic
1151712462 17:75814594-75814616 CCTCTTGGGGCCAGAGGGCAAGG - Intronic
1152644605 17:81463007-81463029 CCCCTCGGGGCCCCAGGGAGGGG + Intronic
1153565657 18:6414899-6414921 CCCCGCGGTGCCCGGCGGGAGGG + Intronic
1160204623 18:76822676-76822698 GCCGGCGGGGCGCGAGGGCGCGG - Intronic
1160719268 19:590275-590297 CCCCGCGGGGCCCGAGGGCCCGG + Exonic
1160844886 19:1161888-1161910 CCCCGCGGCTCCCCAGGGAAGGG - Intronic
1160858522 19:1227892-1227914 CCCTGCGGAGCACGAGGCCACGG - Exonic
1160948050 19:1652465-1652487 TCCCGCGGGGCCCGTGCGCGCGG + Intronic
1161015531 19:1981002-1981024 CCGCGTGGGGCGCGTGGGCACGG + Exonic
1161057604 19:2198475-2198497 CCCCCCGGGCCCGGAGGACAGGG - Intronic
1161196085 19:2987481-2987503 CCCCGGGGGACCCGAGGGGCAGG - Intronic
1161779171 19:6279798-6279820 CGACGCGGGGCCCGGGGGCGGGG - Exonic
1162059300 19:8085332-8085354 CCCTGGGGGTCCTGAGGGCATGG + Intronic
1162328072 19:10010386-10010408 CCCGGCGGGGCCCACGGGCAAGG + Exonic
1162463968 19:10829946-10829968 GCCTGAGGGGGCCGAGGGCAAGG + Intronic
1162479854 19:10921802-10921824 CCCGGCGGGGGCGGCGGGCAGGG - Exonic
1162780154 19:13002555-13002577 CCCGGCGGGGCGGGCGGGCAGGG + Intronic
1162886699 19:13702779-13702801 CCCCGCGGGGCCTGAGGGCAAGG + Intergenic
1163026922 19:14517999-14518021 GCCCGCGAGGCCGGAGGGCGGGG + Intronic
1163146063 19:15379951-15379973 CACCGCGGTGCCCGACGGCCCGG + Intergenic
1163551159 19:17967118-17967140 CCCCGCCGGGCCCGTGGACTGGG + Intronic
1163606969 19:18280968-18280990 CGCCGGGGGGCCCTCGGGCACGG - Exonic
1163631446 19:18419775-18419797 CCGCGCGGGGCACGTGGGCGCGG + Intronic
1163906080 19:20150705-20150727 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1164146918 19:22518072-22518094 CCCGGCAGGGTCCGAGGGCCTGG - Intronic
1164191914 19:22925525-22925547 GCCCACGGGGCCCGAGGGCAAGG + Intergenic
1164639341 19:29812590-29812612 CGCCGCGGGGCCGGACGGGACGG + Intronic
1164653333 19:29901698-29901720 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1165040480 19:33064714-33064736 CCCTGCAGGGCCCGGGGGAAAGG + Intronic
1165318989 19:35074494-35074516 CCCCTCAGAGCCCCAGGGCAGGG - Intergenic
1165803128 19:38565168-38565190 CGCGGCGGGGCTCGAGGGCACGG + Exonic
1165955422 19:39499243-39499265 GACCGCGGGGCCCCAGGGCCTGG - Exonic
1166094172 19:40529374-40529396 CCCCGCGGGACCCGTAGGCGCGG - Intronic
1166261445 19:41644249-41644271 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1166677480 19:44748628-44748650 CCCCGGGGGGGCCGGGGGCGGGG + Exonic
1166677531 19:44748789-44748811 CCCCGCGGGGCATCGGGGCATGG - Exonic
1166746941 19:45146003-45146025 GCCCCCGGGGCCTGAGGTCAAGG + Exonic
1167220408 19:48195393-48195415 GCCCGAGGGGCCCGATGGCGGGG + Exonic
1167468445 19:49662508-49662530 CTCCGCAGGGGCTGAGGGCAGGG + Exonic
1167648138 19:50716789-50716811 CCCCGGGGGACCCGGGGCCAGGG - Exonic
1168179276 19:54649827-54649849 CCCAGCTGGGCCAGAGTGCATGG - Intronic
925148388 2:1598439-1598461 CCGGGCTGGGCCCCAGGGCAGGG + Intergenic
926158988 2:10474903-10474925 CCTGGTGGGGCCAGAGGGCAGGG + Intergenic
929614379 2:43296878-43296900 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
929936284 2:46296885-46296907 CCCCACCTGGCCCGAGGGCCAGG + Intronic
931683021 2:64768364-64768386 CCCAGCCGCGCCCGAGGGCTTGG + Intergenic
931881547 2:66575789-66575811 CCCAGCCGAGCCCGGGGGCAAGG + Intergenic
932322060 2:70829571-70829593 CCAGGTGGGGACCGAGGGCAAGG + Intergenic
932771236 2:74502004-74502026 CCCCGCGGGGCCAGCGGTGAAGG - Intronic
933810745 2:86031413-86031435 GCCCCAGGGGCCCGAGGCCATGG - Exonic
933876284 2:86623913-86623935 GCCCGCAGGGGCCGAGGGCGGGG + Intronic
936545992 2:113393820-113393842 CCCCGCAGGGCCCGAGGGCAAGG + Intergenic
937044921 2:118846259-118846281 GTCCGCGGGGCCAGAAGGCATGG + Intronic
937853420 2:126656112-126656134 TCCCGCGCGGGCCGAGGGGAGGG - Exonic
937919685 2:127120495-127120517 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
937985094 2:127634814-127634836 CACCGCCGGGCCCCAGGGCCTGG - Intronic
938361859 2:130693664-130693686 CCGCGCCGAGCCCGAGGCCAGGG - Intergenic
941905571 2:170714670-170714692 CCGCGGTGGGGCCGAGGGCAGGG - Intergenic
946295738 2:218782233-218782255 CCCCGTGGGGGCAGAGGCCACGG - Exonic
946909043 2:224442561-224442583 TCCGGCGGGGCGCGAGGGCTAGG - Intergenic
947641261 2:231708977-231708999 GCCCTCGGGGGCCGAGGGCTAGG + Intronic
948560601 2:238848829-238848851 CCCCGCGGGCCGCGGGGGCTTGG + Intronic
948753363 2:240144909-240144931 CCCTGCTGGGACCGAGGACATGG - Intergenic
948901947 2:240960580-240960602 CCCAGCGGGGCCCACGGGGACGG + Intronic
1168753096 20:297646-297668 CCCCGCGCGGCCCGCGGCCCGGG + Exonic
1170425164 20:16228405-16228427 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1172350055 20:34231332-34231354 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1172933488 20:38602009-38602031 GCCCGCGGGATCCGAGGACACGG - Exonic
1175371400 20:58495517-58495539 CCCCCTGTGCCCCGAGGGCAGGG + Intronic
1175562040 20:59939235-59939257 GCCCGCAGGCCCCGAGGGCACGG - Exonic
1175933798 20:62505917-62505939 CCCAGTGGGGCCCCTGGGCAGGG + Intergenic
1175994250 20:62805180-62805202 CCCCGCCGGGCCCTGGGGCTGGG - Intronic
1176073471 20:63238271-63238293 CCCTGCAGTGCCCGTGGGCATGG - Intronic
1177178632 21:17721109-17721131 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1181034112 22:20161687-20161709 CCTCCGGGGGCCCAAGGGCAGGG + Intergenic
1181509242 22:23381714-23381736 CCTCTGGGGGCCCGAGGGCAGGG - Intergenic
1181725158 22:24806324-24806346 ACCCGCGGGGGCCGAGGCCATGG - Exonic
1182439879 22:30356975-30356997 CGCCGCGGTGCCCGCGGGGAGGG - Exonic
1183393766 22:37560453-37560475 GCCCGCGGAGCCCGCGGCCAGGG + Exonic
1183439775 22:37816592-37816614 CCCCGTGGTCCCCAAGGGCAAGG + Exonic
1183841631 22:40502709-40502731 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1183845112 22:40536443-40536465 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1184671401 22:46013863-46013885 CCCCGGGAAGCCAGAGGGCACGG - Intergenic
1184711102 22:46250033-46250055 CCCAGCGCTGCCCGAGGTCAGGG + Intronic
1185037343 22:48486383-48486405 CCCCGGGCAGCCCGAAGGCAAGG - Intergenic
1185078094 22:48694035-48694057 CTCCGCGTGGCCTGTGGGCAGGG - Intronic
1185362136 22:50414705-50414727 CCCCCCCGTTCCCGAGGGCAGGG + Intronic
1185380452 22:50505369-50505391 CCTGGGGGGGCCAGAGGGCAGGG - Intronic
1185393700 22:50576355-50576377 CACCGTGGGGCCAGATGGCAAGG + Intronic
950153898 3:10708200-10708222 CCCCGCGGGACCGGAGCGCGCGG + Intergenic
950253863 3:11488302-11488324 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
950668732 3:14512656-14512678 CCCTGCGGGGCCCGAGGAAAAGG - Intronic
951013733 3:17705904-17705926 GCCCCGCGGGCCCGAGGGCAAGG - Intronic
952896679 3:38082452-38082474 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
954080527 3:48210867-48210889 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
955297227 3:57746961-57746983 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
956270216 3:67443390-67443412 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
958004287 3:87792772-87792794 CCCCGGGGCGCGGGAGGGCAGGG - Intergenic
959042502 3:101438872-101438894 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
959419586 3:106112630-106112652 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
960120850 3:113947829-113947851 CCCCGCGGTGCCCGCGGGCGAGG - Intergenic
961822094 3:129580409-129580431 CCCCACGGAATCCGAGGGCATGG + Intronic
962367447 3:134795793-134795815 CATCCCGGGACCCGAGGGCAAGG + Intronic
966359456 3:179119496-179119518 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
968457125 4:705628-705650 AGCCGCGGGGCGCGAGGGCCAGG - Intergenic
968471864 4:786212-786234 CCCAGCAGCGCCCGAGGCCAGGG - Exonic
968474323 4:795833-795855 CTCAGCAGGGCCAGAGGGCAGGG - Intronic
968653349 4:1768515-1768537 CCCTGCAGGGGCCTAGGGCAGGG + Intergenic
968697588 4:2040707-2040729 GCACGCGGGGCCCGAGGGGCCGG - Intronic
969018021 4:4118109-4118131 CCCCGCGGGGCCCGACCCCCTGG - Intergenic
969240208 4:5892526-5892548 CCCCGGGAGGACCCAGGGCATGG - Intronic
969285426 4:6199715-6199737 CGGCGCGGGGCCCGAAGGCGAGG - Intronic
969330377 4:6471125-6471147 CCCCGCGGGACCCGTGCCCAGGG + Intronic
969559546 4:7938870-7938892 CCCCCCGGGGCCCGCCGGCCAGG + Intronic
969594668 4:8142298-8142320 GCCCGCACTGCCCGAGGGCATGG + Intronic
972960557 4:44447948-44447970 CGCTCCCGGGCCCGAGGGCACGG + Exonic
973293235 4:48490369-48490391 CCCCGCGGCCACCAAGGGCAAGG + Exonic
980937799 4:139242672-139242694 CCCCCGGGGGCCACAGGGCAGGG + Intergenic
982616099 4:157637751-157637773 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
983923505 4:173371518-173371540 CACCGAGGGGCGGGAGGGCAGGG - Intronic
984146336 4:176065917-176065939 CCCCTCGGAGCCCGCGGGCCCGG + Intronic
984928460 4:184826332-184826354 CCCCGCGATGCCCGAGGGGCGGG + Intronic
985580631 5:693655-693677 CCCCGGGGGGCCCCAGAGCCAGG - Intergenic
985782536 5:1878640-1878662 CCCCGCCGCGCCCGACGGCCCGG - Exonic
985903381 5:2814300-2814322 GTCCGCAGGGCCCAAGGGCAGGG + Intergenic
987696627 5:21341629-21341651 CCCCGCGGGGCAAGGGGGCAGGG + Intergenic
988755576 5:34244941-34244963 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
990165462 5:52989207-52989229 GCCCGCGGGGCCGCAGGGCCGGG + Intergenic
991743820 5:69710683-69710705 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
991753893 5:69844559-69844581 CCCCGCGGGGCAAGGGGGCAGGG + Intergenic
991795392 5:70290415-70290437 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
991803518 5:70401314-70401336 CCCCGCGGGGCAAGGGGGCAGGG + Intergenic
991823187 5:70585951-70585973 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
991833205 5:70719672-70719694 CCCCGCGGGGCAAGGGGGCAGGG + Intergenic
991887759 5:71289934-71289956 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
992320780 5:75611606-75611628 CTCCGCGGGCCCTGAGCGCAGGG - Exonic
992373721 5:76171079-76171101 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
992530237 5:77645710-77645732 CCCCGCCCGGCCCGACGGCGCGG - Intergenic
999766042 5:154741614-154741636 GCCTGCGGGCCCCTAGGGCATGG - Intronic
999768110 5:154755844-154755866 GCCGCCGGCGCCCGAGGGCAAGG + Intronic
1000345688 5:160312049-160312071 CCCGCCGGGGCCCGGGGCCAGGG - Intronic
1000985248 5:167858849-167858871 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1001640181 5:173238521-173238543 CCCCGCGCGGGCCGAGAGCGAGG - Intergenic
1001641362 5:173246254-173246276 TCCGGCGGGGCCGGAGTGCAGGG + Intergenic
1001997481 5:176173880-176173902 CCTCCCAGGGCCCGGGGGCATGG - Intergenic
1002261261 5:177995401-177995423 CCCCATGGGGCCCAAGGGCGTGG + Intronic
1002341411 5:178518799-178518821 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1002888124 6:1313253-1313275 CCCCTCGCGGCCCTGGGGCAAGG + Exonic
1003290488 6:4775721-4775743 CCCCGCGGGGCGCGCGGCCCGGG + Intronic
1004387949 6:15188466-15188488 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1005554212 6:26956714-26956736 CCCCGCGGGGCAAGGGGGCAGGG - Intergenic
1006458518 6:34145030-34145052 CCCCAGGAGGCCGGAGGGCACGG + Intronic
1006492131 6:34396999-34397021 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1006535548 6:34696388-34696410 CCTCGGGGGCCCCGAGGGGAAGG - Intronic
1007111187 6:39314281-39314303 CCGGGCGGCTCCCGAGGGCAGGG - Exonic
1007674429 6:43581550-43581572 GCCCCGCGGGCCCGAGGGCAAGG - Intronic
1011405422 6:87010804-87010826 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1012475788 6:99613776-99613798 CCGCGCAGGGCCCCAGAGCAGGG - Exonic
1015476540 6:133664309-133664331 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1016369924 6:143362792-143362814 CCACGAGGGGCCCGTGGGTAGGG - Intergenic
1018722242 6:166581740-166581762 ACCCGCTGGGCAGGAGGGCACGG + Intronic
1019085258 6:169469453-169469475 CCCCAGTGGGCCTGAGGGCAGGG - Intronic
1019416165 7:927399-927421 CCACGCCAGCCCCGAGGGCATGG + Intronic
1019666271 7:2253670-2253692 GCCCACGGGGCCAGAAGGCACGG + Exonic
1019937538 7:4266173-4266195 CTCCGCGGGACACGAGGACACGG + Exonic
1020096855 7:5374319-5374341 CCCCGCGGGCACCTACGGCAAGG - Exonic
1020101598 7:5397134-5397156 GGCCCCGGGGCCCGAGGGCTTGG - Intronic
1020281659 7:6653174-6653196 CGCCGCGGGGCCCGAGGACACGG + Exonic
1020616627 7:10466424-10466446 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1021872149 7:25017974-25017996 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1024061607 7:45702853-45702875 CCCTGCAGGGACCTAGGGCAGGG - Intronic
1027218943 7:76202008-76202030 ACCGGCGGGACCCGAGGGCCTGG + Exonic
1029076461 7:97938618-97938640 CCCCGCGGGGCCCGACCCCCTGG - Intergenic
1029137821 7:98387137-98387159 CCCCGCTGGGACAGAGGGTAGGG + Intronic
1029506438 7:100966311-100966333 CCCCGCGGGGCCCAGGTGCACGG + Intronic
1034911665 7:155002979-155003001 CGCCGCGGGGGCCGGGGGCGGGG - Exonic
1035224406 7:157425516-157425538 CCAGGCGGGGCCTGAGAGCAGGG - Intergenic
1035508104 8:150586-150608 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1036241284 8:7083124-7083146 CCCCGCGGGGCCCGACCTCCTGG + Intergenic
1036536869 8:9658297-9658319 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1037116843 8:15237409-15237431 CCCTGCTGGGGCCGAGGACACGG - Intronic
1037529108 8:19756987-19757009 CCCGCCGGGGGCCCAGGGCACGG - Intronic
1038632931 8:29262902-29262924 CCCCACGGCGGCCGAGGGAAGGG + Intronic
1041369455 8:57143457-57143479 CCCCGCTGCGGCGGAGGGCAGGG - Intergenic
1042048820 8:64685204-64685226 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1044660471 8:94590234-94590256 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1044666484 8:94639226-94639248 CCCCGCGACGCCCGAGGGCCTGG + Intergenic
1045488652 8:102654272-102654294 CCCCGCGGGCCCGGCGCGCACGG - Intronic
1047251093 8:123182600-123182622 GCCCTCCCGGCCCGAGGGCAGGG + Exonic
1047687126 8:127315900-127315922 CCCCGCGGGGCCCGAGGGCAGGG + Intergenic
1047848266 8:128827123-128827145 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1048302949 8:133264989-133265011 GCCAGTGGGGCCTGAGGGCAAGG - Intronic
1048997475 8:139803334-139803356 GCCCACGGGGCTGGAGGGCAGGG - Intronic
1049109611 8:140635148-140635170 CCGCCCGGGGCCCGCGGGCTGGG - Intronic
1049433258 8:142574951-142574973 CCCAGCGAGGCCCCAGGGTAGGG + Intergenic
1049587061 8:143437130-143437152 CCCCGCGGGGCCCCTTGGCCTGG - Intergenic
1049641745 8:143719070-143719092 CCCCGAGGGGCCTGAGGACCAGG + Exonic
1049708359 8:144052899-144052921 CCCTGCGCGCCCCGAGGGAAGGG + Exonic
1050090645 9:2014911-2014933 CCCCGCGGCGCCCGAGGAAGAGG + Intergenic
1051358123 9:16258394-16258416 TCCAGCGCGGCCCGAGGCCAAGG - Intronic
1053003282 9:34589554-34589576 GCCCGGGTGGCCCGAGGGCGCGG - Exonic
1053129231 9:35605685-35605707 GCCCCCGGGGCCGGGGGGCACGG + Exonic
1053256032 9:36616011-36616033 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1053457074 9:38241570-38241592 CCCCGCGGGGCCCGAGGGCAAGG + Intergenic
1056813486 9:89782505-89782527 CCCAGAGGGGCCCAGGGGCAAGG - Intergenic
1057180239 9:93025908-93025930 ACCCTCGGGGCTCCAGGGCAGGG + Intronic
1057208079 9:93184986-93185008 CGGCGCGGGGCCCGCGGGCATGG + Exonic
1059210866 9:112513730-112513752 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1060064785 9:120495083-120495105 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1060811235 9:126612609-126612631 CCGGGCGGGGGCGGAGGGCATGG - Intergenic
1061285425 9:129620038-129620060 CCCCGCGGGGCCCGGGGGGCGGG - Intronic
1061881401 9:133570965-133570987 ACCGGCGGGGCCAGAGGGAAGGG + Intronic
1061984085 9:134119039-134119061 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1062368802 9:136225961-136225983 CCCCGAGAGGCCCTGGGGCAGGG + Intronic
1062429244 9:136519669-136519691 ACCCCGGGGGCCCCAGGGCAGGG - Intronic
1062464066 9:136673526-136673548 CCTCCCCGGGCTCGAGGGCAGGG - Exonic
1062549473 9:137079273-137079295 CCCCGAGGAGCCCGTGGGCGTGG + Exonic
1062696656 9:137879167-137879189 CCCGGCTGGGCCTGAGGGCAGGG + Intronic
1186466310 X:9786563-9786585 CCGCGCGCGGCCCGAGCGCCTGG + Exonic
1187976690 X:24710046-24710068 CCCCACGGGGCCCGAGGGCAAGG - Intronic
1190259928 X:48791211-48791233 CCCCTCTGGGCCTGAGGGCTTGG + Exonic
1191618306 X:63190312-63190334 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1192621086 X:72680864-72680886 CCCCGCGGGGCCCGAGGGCAAGG + Intronic
1195036315 X:100973370-100973392 CCCCGCGGGGCCCGAGGGCAAGG - Intronic
1196404609 X:115348246-115348268 CCCCGCGGGGCCCGAGGGCAAGG - Intergenic
1198302391 X:135344842-135344864 CCCCGAGCGGCCAGAGGGCGTGG + Intronic