ID: 959419588

View in Genome Browser
Species Human (GRCh38)
Location 3:106112635-106112657
Sequence ACGGGCCCCGCGGGGCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 61, 1: 11, 2: 0, 3: 3, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419588_959419607 25 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419588_959419601 17 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419588_959419596 4 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027
959419588_959419598 7 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419588_959419605 22 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419588 Original CRISPR ACGGGCCCCGCGGGGCCCGA GGG (reversed) Intergenic
900119108 1:1041047-1041069 GCGGGGCCTGCGGGGCCCGGCGG + Intronic
900233556 1:1575061-1575083 ATGGGCCCCACGGGGACCGAGGG - Intergenic
903338264 1:22638929-22638951 ACGGGCTCCGAGGGGGCCGCTGG - Exonic
903526492 1:23994968-23994990 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
903923427 1:26817444-26817466 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
904603157 1:31684530-31684552 CAGGGCCCCGCGGGGCCAAAAGG - Exonic
904794828 1:33051314-33051336 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
906436932 1:45804040-45804062 ACGGGCCCCGCGGGGCCCGAGGG + Exonic
906486658 1:46240475-46240497 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
906650295 1:47508203-47508225 GGGCGCCCCGCGGGGCCCGAAGG - Intergenic
907453914 1:54563068-54563090 ACGGGCCCCGCAGGGCCCGAGGG - Intronic
912381367 1:109249771-109249793 AGGGGCGCCGCGGGGCCCCCGGG + Intergenic
912825476 1:112899318-112899340 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
912844668 1:113068787-113068809 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
918482322 1:184991970-184991992 AGGGGCCCGGCAGGGCCCGGTGG - Intergenic
921414438 1:214870424-214870446 ACGGGCCCCGCGGGGCCCAAGGG - Intergenic
922306983 1:224352744-224352766 GCCGGCCCCGCGGGCCCCGCCGG - Intergenic
922306984 1:224352747-224352769 GCGGGGCCCGCGGGGCCGGCTGG + Intergenic
1065335700 10:24655548-24655570 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1065916283 10:30357079-30357101 ACAGTCCCAGCAGGGCCCGACGG + Intronic
1067140059 10:43648989-43649011 TCGGGCCCCGCAGGTCCCTAGGG + Intergenic
1070318247 10:75334199-75334221 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1072150165 10:92675987-92676009 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1072408953 10:95183447-95183469 AAGGTCCCCGCCAGGCCCGAGGG - Intergenic
1072950118 10:99840127-99840149 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1074996358 10:118760410-118760432 CCGGGGCCGGCGGGGCCCGCTGG + Intergenic
1081784947 11:45739176-45739198 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1083609678 11:63998930-63998952 ACGTGCCCCGCGCCGCCCCACGG - Intronic
1083771676 11:64871088-64871110 AGGGGCCAGGCGGGGCCAGACGG + Intronic
1084040457 11:66539619-66539641 GAGGGCCCAGCGGGGCCCCAGGG + Exonic
1084767908 11:71324388-71324410 TCTGGCCCCGCAGGGCCCTATGG + Intergenic
1089560157 11:119339785-119339807 GCGGGACCCGCGGGGCCCACCGG - Exonic
1089712442 11:120325406-120325428 ACGGGGCCCGCGCGGCCCATTGG + Intronic
1090832394 11:130428414-130428436 ACTCGGCCCGCGGGGCCCGGCGG + Exonic
1091762437 12:3095997-3096019 ACAGGCCCCGCGGGGCCCGAGGG - Intronic
1091770114 12:3145980-3146002 ACGGGGCACGCGGGGCCTGGCGG + Intronic
1095439351 12:42227173-42227195 ACGGGCCCCACGGGGCCCGAGGG + Intronic
1096022478 12:48333765-48333787 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1096101005 12:48970477-48970499 AGGAGACCCGCGAGGCCCGAGGG + Exonic
1096657973 12:53103576-53103598 ACGGGCCCCGCCTGGCTCCATGG - Exonic
1096741152 12:53695164-53695186 CCGGGCCCTGCGGAGGCCGAAGG - Intergenic
1097046195 12:56189314-56189336 CCGGGCCGCGCGGGGACCGGGGG - Intronic
1102578397 12:113871859-113871881 ACGGGCCCCGCGGGGCCGGAGGG + Intronic
1103509825 12:121466903-121466925 ATTGTCCCCGCGGTGCCCGATGG + Intronic
1104854260 12:131894798-131894820 GCGGGCCAGGCGGGGTCCGAGGG - Exonic
1106995049 13:35471270-35471292 CCCGGCCCGGCGGGGGCCGAGGG + Intronic
1110269184 13:73574278-73574300 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1115609555 14:35038544-35038566 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1116871646 14:50073959-50073981 ACGGACCCCGCGGGGCCCGAGGG + Intergenic
1122370258 14:101225588-101225610 AAGGGCCCCCCGGGGGCCGTGGG + Intergenic
1122964016 14:105112697-105112719 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1123684321 15:22786597-22786619 CCGCGCCCCGCGGGGCGGGATGG - Intronic
1124500411 15:30223226-30223248 TGCAGCCCCGCGGGGCCCGAGGG + Intergenic
1124743162 15:32315440-32315462 TGCAGCCCCGCGGGGCCCGAGGG - Intergenic
1125659011 15:41381932-41381954 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1128344054 15:66842639-66842661 CCGTGCCCCGCGGGGCCTGCGGG + Intergenic
1128656699 15:69467807-69467829 ATGGGCCCCGCCGGGCTGGAAGG - Intergenic
1129428279 15:75480805-75480827 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1134523930 16:14930387-14930409 ACGGGCCCCGTGGGGACGGCAGG + Intronic
1134711521 16:16328872-16328894 ACGGGCCCCGTGGGGACGGCAGG + Intergenic
1134719372 16:16372171-16372193 ACGGGCCCCGTGGGGACGGCAGG + Intergenic
1134948054 16:18339714-18339736 ACGGGCCCCGTGGGGACGGCAGG - Intergenic
1134955308 16:18379821-18379843 ACGGGCCCCGTGGGGACGGCAGG - Intergenic
1135775987 16:25257875-25257897 GCGGGCCCCGCGGCGCTCGGTGG - Exonic
1136129557 16:28211497-28211519 AGGGTCCCCTCGGGGCCCGGTGG - Exonic
1136413881 16:30091988-30092010 ACGGACCACGCGGGGGCCGCTGG + Intergenic
1142193053 16:88726663-88726685 GCGGGGCCAGCGGGGCCCCAGGG + Intronic
1142611055 17:1109370-1109392 GCGGGCCCTGCGGGGCCGGGCGG - Intronic
1145205673 17:20984014-20984036 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1145750719 17:27353630-27353652 GCGGGCCCCGAGGGGTCGGAAGG - Intergenic
1146281773 17:31549629-31549651 ACGGACCCTGCCCGGCCCGACGG + Intergenic
1147139571 17:38453764-38453786 CCGGGGCCCGGGGGCCCCGAAGG - Intronic
1147963190 17:44180016-44180038 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1149908733 17:60550848-60550870 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1150002815 17:61452164-61452186 ACCCGGCTCGCGGGGCCCGAGGG + Intergenic
1150267828 17:63842472-63842494 GCGGGGCCCGCGGGGCCCATGGG + Exonic
1151156127 17:72123907-72123929 ACAGGCCCCGCCGGCCCCGCAGG + Exonic
1151779983 17:76239743-76239765 ACCTGCCTCGCGGGGTCCGAGGG - Intronic
1152813378 17:82392745-82392767 AGGGGCCCCCCGGGGCCAGCAGG + Intronic
1160453763 18:78981279-78981301 GCGCGCCCCGCGGGGCCCCCAGG + Intronic
1160613790 18:80109152-80109174 AGGGGCCCCGGGGGGCCTGTGGG + Exonic
1160679995 19:408168-408190 TCGGGCCCCGCGGAGGGCGAGGG - Exonic
1160679998 19:408171-408193 TCGCCCTCCGCGGGGCCCGAGGG + Exonic
1160719266 19:590270-590292 TGCAGCCCCGCGGGGCCCGAGGG + Exonic
1160866165 19:1257089-1257111 ACGGACCCCGCGCGTCCCGCCGG - Exonic
1160972366 19:1775395-1775417 ACGGCCCCCGGGGGCCCCGCCGG + Exonic
1161236027 19:3198717-3198739 ACGGGCCCCACGTGGCCCAGAGG + Intronic
1162322517 19:9978581-9978603 AAGGGCCCCCCAGGGCCCGTGGG - Exonic
1162886697 19:13702774-13702796 ACGGGCCCCGCGGGGCCTGAGGG + Intergenic
1163906082 19:20150710-20150732 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1164653335 19:29901703-29901725 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1165040477 19:33064709-33064731 ACGGCCCCTGCAGGGCCCGGGGG + Intronic
1165955423 19:39499248-39499270 AGGGGGACCGCGGGGCCCCAGGG - Exonic
1166261443 19:41644244-41644266 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1166893408 19:46008346-46008368 ATGGGCCCCGCGGTGCATGATGG - Intronic
1167019192 19:46861357-46861379 ACGGGGACGGCGGGGCCCGGGGG - Intergenic
1167220405 19:48195388-48195410 GCGGTGCCCGAGGGGCCCGATGG + Exonic
1167501356 19:49850663-49850685 CCAGGCCGCGCGGGGCCCGCTGG + Intergenic
1167568617 19:50272681-50272703 GCGGGCCCAGCTGGGCCGGAAGG + Exonic
1167611795 19:50511274-50511296 AGGAGTCCCGCGGGGCCCCACGG - Exonic
1168290472 19:55354801-55354823 ACCAGCCCCGCGGTGCACGACGG - Exonic
1168300369 19:55401540-55401562 CCGGGCCCCCTGGGGCCCCAGGG + Exonic
1168315776 19:55484221-55484243 TCGGGCCCCGCGGGGCTCCCCGG + Exonic
927357068 2:22186440-22186462 CCGGGGCCGGCGGGGCCCGCGGG - Intergenic
929614377 2:43296873-43296895 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
931671878 2:64654408-64654430 AGGGTCCCCGCGGGGGGCGAGGG + Intronic
932827867 2:74958434-74958456 ACAGGCCCGTCGGGGCCAGAGGG + Intergenic
936545990 2:113393815-113393837 ACGGGCCCCGCAGGGCCCGAGGG + Intergenic
937919687 2:127120500-127120522 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
946326077 2:218985300-218985322 CCGGGCCGCGCGGGGGCCGGAGG - Exonic
947800780 2:232927732-232927754 GCGGGCCCGACGGGGCCCGGGGG + Intronic
948891082 2:240907422-240907444 ACGGACCCCTCGGGACCCCAGGG + Intergenic
1170425166 20:16228410-16228432 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1172277177 20:33686101-33686123 GCGGGCGCCGCGGGGCCGGTGGG + Exonic
1172350057 20:34231337-34231359 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1175872496 20:62215126-62215148 GGGGGCCCGGCTGGGCCCGAGGG - Exonic
1177178634 21:17721114-17721136 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1178981469 21:37268100-37268122 CCGGGCTCCGCGGGCCGCGAGGG + Intergenic
1179213651 21:39348829-39348851 CTGGGCCTCGCGGGGCCCGGCGG + Intronic
1183841633 22:40502714-40502736 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1183845110 22:40536438-40536460 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
950253865 3:11488307-11488329 ACGGACCCCGCGGGGCCCGAGGG - Intronic
950632632 3:14293309-14293331 CCGGGGCCCGCGGGGTCCGCCGG - Intergenic
951491014 3:23270499-23270521 ACGAGCCCTGCAGGGCCCCAGGG - Intronic
952896681 3:38082457-38082479 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
953657045 3:44862183-44862205 AGGGGCGCTGCGGGGCCCGCGGG + Intronic
954080525 3:48210862-48210884 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
955297225 3:57746956-57746978 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
956270214 3:67443385-67443407 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
959042500 3:101438867-101438889 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
959419588 3:106112635-106112657 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
961674313 3:128555523-128555545 ACGCGCCCCGAGGGGGCGGACGG - Intergenic
966359454 3:179119491-179119513 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
966696336 3:182793720-182793742 CCGGGTCCCGCGGGGCGCGGGGG - Exonic
969285428 4:6199720-6199742 CCCGGCGGCGCGGGGCCCGAAGG - Intronic
969559544 4:7938865-7938887 CCGCGCCCCCCGGGGCCCGCCGG + Intronic
972765901 4:42152140-42152162 ACCGGCCCCGAGGCGCCGGATGG - Exonic
973620597 4:52722151-52722173 ACGGGTCCTGCGGGTCCCGCGGG + Intergenic
973620598 4:52722157-52722179 CCGGGACCCGCGGGACCCGCAGG - Intergenic
974069454 4:57110492-57110514 GCAGGCCCCGCGGGGCCGGGAGG - Intergenic
975666901 4:76741540-76741562 CCCGGCCCCGCGGCGCTCGAAGG + Exonic
981491619 4:145346296-145346318 GCGGGCGGCGCGGGGCCCCAGGG + Intergenic
982460906 4:155667631-155667653 GGGGGACCCGCGGCGCCCGAGGG + Intronic
982616101 4:157637756-157637778 GACGGCCCCGCGGGGCCCGAGGG - Intergenic
984928456 4:184826327-184826349 CTGGGCCCCGCGATGCCCGAGGG + Intronic
992373719 5:76171074-76171096 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
992444220 5:76819700-76819722 GCTGGCCCCGCGGGGCCGGTGGG + Intronic
1000985246 5:167858844-167858866 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1002341413 5:178518804-178518826 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1002692509 5:181059883-181059905 ACTGGCCCCGGGGGGCCCCCTGG + Exonic
1004387947 6:15188461-15188483 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1006492129 6:34396994-34397016 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1011405424 6:87010809-87010831 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1015476538 6:133664304-133664326 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1019427248 7:983493-983515 CCGGGCCCAGCGGGGCACGCAGG + Intronic
1020616629 7:10466429-10466451 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1021872147 7:25017969-25017991 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1034911668 7:155002984-155003006 CCGGGCGCCGCGGGGGCCGGGGG - Exonic
1035508106 8:150591-150613 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1036536871 8:9658302-9658324 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1037783629 8:21888714-21888736 GCAGGCCTCGTGGGGCCCGAGGG - Intergenic
1039453350 8:37693152-37693174 ATGGGGCCCTCGGGGCCTGAAGG - Intergenic
1040032990 8:42842993-42843015 ACCGGCCCCGCGAGGCGCGCAGG + Intronic
1042048818 8:64685199-64685221 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1044660469 8:94590229-94590251 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1047687123 8:127315895-127315917 AAGGGCCCCGCGGGGCCCGAGGG + Intergenic
1047848268 8:128827128-128827150 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1053256034 9:36616016-36616038 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1053457072 9:38241565-38241587 ACGGGCCCCGCGGGGCCCGAGGG + Intergenic
1056643278 9:88388632-88388654 GCGGCCCGCGCGGGGCCCGGCGG + Intronic
1059210864 9:112513725-112513747 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1060064783 9:120495078-120495100 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1061285429 9:129620043-129620065 TGAGGCCCCGCGGGGCCCGGGGG - Intronic
1061984087 9:134119044-134119066 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1062117596 9:134817784-134817806 CCAGGCCCCGCAGGCCCCGAAGG + Exonic
1062117831 9:134818696-134818718 AGGGGCCCCCTGGGGGCCGATGG - Exonic
1187976692 X:24710051-24710073 ACGGGCCCCACGGGGCCCGAGGG - Intronic
1190789626 X:53686597-53686619 AATGGCTCCGCGGGGCCCGCAGG + Intronic
1191618308 X:63190317-63190339 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1192621084 X:72680859-72680881 ACGGGCCCCGCGGGGCCCGAGGG + Intronic
1195036317 X:100973375-100973397 ACGGGCCCCGCGGGGCCCGAGGG - Intronic
1196404611 X:115348251-115348273 ACGGGCCCCGCGGGGCCCGAGGG - Intergenic
1198394133 X:136206191-136206213 AAGCACCCCGCGGGGCCAGATGG - Intronic