ID: 959419588

View in Genome Browser
Species Human (GRCh38)
Location 3:106112635-106112657
Sequence ACGGGCCCCGCGGGGCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419588_959419596 4 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419588_959419605 22 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419588_959419607 25 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG No data
959419588_959419598 7 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419588_959419601 17 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419588 Original CRISPR ACGGGCCCCGCGGGGCCCGA GGG (reversed) Intergenic