ID: 959419589

View in Genome Browser
Species Human (GRCh38)
Location 3:106112636-106112658
Sequence GACGGGCCCCGCGGGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 61, 1: 11, 2: 0, 3: 27, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419589_959419601 16 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419589_959419605 21 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419589_959419607 24 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419589_959419596 3 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027
959419589_959419598 6 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419589 Original CRISPR GACGGGCCCCGCGGGGCCCG AGG (reversed) Intergenic
900233557 1:1575062-1575084 TATGGGCCCCACGGGGACCGAGG - Intergenic
900240659 1:1615862-1615884 GGCAGGCCTCGCGCGGCCCGGGG + Intronic
900398543 1:2463302-2463324 GACGGGCCCCCAGAGGCCCCTGG - Intronic
900513311 1:3070241-3070263 GGCGGGGCGCGCGGAGCCCGGGG - Intronic
900553485 1:3268489-3268511 GACGGGCCCTGCGAGGGGCGAGG + Intronic
900581475 1:3411904-3411926 GACGGCAGCTGCGGGGCCCGAGG + Exonic
901238640 1:7680524-7680546 GCCGCGCCCCGCGGGGTCTGGGG + Intronic
901250131 1:7771554-7771576 GACGGGCCGGGCGGGTCCCGCGG + Intronic
901332763 1:8423722-8423744 GCCGCGCGGCGCGGGGCCCGGGG + Intronic
901660768 1:10796491-10796513 GAGGCGCCCCGGGAGGCCCGCGG + Intronic
901704054 1:11060204-11060226 GCCGGGCCCCACGTGGCCCCTGG - Intergenic
902530529 1:17087850-17087872 GACAGGCCCAGTGGGGCCCAGGG + Intronic
903034726 1:20486266-20486288 GAGGGGACCCGCGGGCCTCGGGG + Intergenic
903420761 1:23216941-23216963 GACGCCCCCCGAGGGGCCCCGGG - Intergenic
903526493 1:23994969-23994991 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
903652495 1:24930308-24930330 GCCCCGCCCCGCGGGCCCCGGGG - Intronic
903923426 1:26817443-26817465 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
904794827 1:33051313-33051335 GACGGGCCCCGCGGGGCCCGAGG + Intronic
905684996 1:39901700-39901722 GCCCGGCCCCGCCGGGCCCTGGG - Intronic
905819751 1:40980074-40980096 GAGGGGCCAAGCGGGGCGCGGGG + Intronic
906436931 1:45804039-45804061 GACGGGCCCCGCGGGGCCCGAGG + Exonic
906486657 1:46240474-46240496 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
906719769 1:47996793-47996815 GCCAGGGCCCGCGGGGCGCGGGG + Exonic
907453915 1:54563069-54563091 GACGGGCCCCGCAGGGCCCGAGG - Intronic
907540882 1:55214903-55214925 GCGGGCCCCCGCCGGGCCCGGGG + Exonic
907880717 1:58546852-58546874 CACAGTCTCCGCGGGGCCCGGGG - Intergenic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
912825477 1:112899319-112899341 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
912844667 1:113068786-113068808 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
915519909 1:156436129-156436151 GCCGGACCCCGCCGCGCCCGCGG - Intergenic
917438624 1:175045715-175045737 GTCCTGCCCCGCCGGGCCCGCGG - Intergenic
919925062 1:202187885-202187907 GACTGGCCTCGCAGGGCCAGAGG + Intergenic
920045318 1:203128792-203128814 GACGGGCACCAAGGGGCACGAGG - Exonic
921414439 1:214870425-214870447 GACGGGCCCCGCGGGGCCCAAGG - Intergenic
923506486 1:234609849-234609871 GACGGGCCGCGCGGGCGCGGGGG + Intergenic
924613107 1:245590111-245590133 GCTGGGCCCCGCGGGGTCGGGGG + Intronic
1063393681 10:5666598-5666620 GCCGGGCCGCGCGGGGCCGCTGG + Intergenic
1064354243 10:14603840-14603862 GCCGGGCGCCGCGGGGCGAGGGG + Intronic
1065099884 10:22321841-22321863 GGCGGGCGGCGCGGGGCGCGGGG - Intronic
1065335699 10:24655547-24655569 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1070318248 10:75334200-75334222 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1071997572 10:91163034-91163056 GGCGGGCCGCGCGGGGCGCGTGG - Intronic
1072150166 10:92675988-92676010 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1072950119 10:99840128-99840150 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1075112021 10:119596006-119596028 GGTGGGCCCCGCGGGCCCTGAGG - Intronic
1076372511 10:129964454-129964476 GGCGGGGCTCGCGGGGCTCGCGG - Intergenic
1076864382 10:133159980-133160002 GCAGGGCCGGGCGGGGCCCGGGG - Intergenic
1077043656 11:535263-535285 GTGGGGCCGGGCGGGGCCCGCGG - Intronic
1077322181 11:1947434-1947456 GACGGACCCCACAGGGCGCGCGG + Intronic
1077866347 11:6224469-6224491 GACTGGCCTCCCGGGGCCCTGGG - Exonic
1077916052 11:6612109-6612131 GACCGGGGGCGCGGGGCCCGGGG + Exonic
1080384832 11:31805155-31805177 GGCAGGCCCCGAGGGGCGCGGGG - Intronic
1081528622 11:43943305-43943327 GCCGGTCCCCGCGCGGACCGCGG - Intronic
1081773885 11:45665149-45665171 GCCGGGCCCCGCGGGCTCCGGGG - Intronic
1081784948 11:45739177-45739199 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1084028457 11:66467066-66467088 GGCGGGCCCCGGCGGGCGCGGGG + Intronic
1084489574 11:69471138-69471160 GACGGGCGGCGAGGGGGCCGGGG - Intergenic
1084546936 11:69819289-69819311 GGGGAGCCCCGCGGGGCTCGGGG + Intergenic
1084973026 11:72781680-72781702 GCCGGGGCCCGCCGGGGCCGGGG + Intronic
1086064714 11:82733093-82733115 GGCAGGCCCCGCGGGGGCCACGG - Exonic
1089457729 11:118635073-118635095 GGCGTGGCCCGCGGGGCCGGGGG - Intronic
1090698996 11:129278683-129278705 CGTGGGCCCCGCGGGGCCAGAGG - Intronic
1202805199 11_KI270721v1_random:2747-2769 GACGGACCCCACAGGGCGCGCGG + Intergenic
1091762438 12:3095998-3096020 GACAGGCCCCGCGGGGCCCGAGG - Intronic
1091770113 12:3145978-3146000 GCCAGGCCCCGCGTGCCCCGTGG - Intronic
1094048673 12:26195725-26195747 GTCGGGCCCAGCGGCGTCCGCGG - Exonic
1094844067 12:34353832-34353854 GGCTGGCCCCCCTGGGCCCGAGG + Intergenic
1094853428 12:34392460-34392482 GCTGGCCCCCGTGGGGCCCGAGG - Intergenic
1095439350 12:42227172-42227194 GACGGGCCCCACGGGGCCCGAGG + Intronic
1095584580 12:43836172-43836194 GAAGGGTCGCGCGGGGCGCGGGG - Exonic
1096022479 12:48333766-48333788 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1096215506 12:49795822-49795844 GACAGGCCCCGAGGGGGCCCTGG - Exonic
1097046197 12:56189315-56189337 GCCGGGCCGCGCGGGGACCGGGG - Intronic
1097247185 12:57613035-57613057 GACGGGCCCTGGGGGGCCTGGGG - Exonic
1100592750 12:96044764-96044786 GCAGAGCCCCGCGGGGCCAGTGG - Intergenic
1102256605 12:111418825-111418847 GTCGGGGCCATCGGGGCCCGGGG - Exonic
1102578396 12:113871858-113871880 GACGGGCCCCGCGGGGCCGGAGG + Intronic
1102973552 12:117190156-117190178 GCCCGGCCCCGGGGGGCGCGGGG + Intronic
1103091993 12:118104054-118104076 GCCGGGTCCCGCCGGGCCAGGGG + Intronic
1103510042 12:121467600-121467622 GCCGGGCCGGGCGGGGCGCGGGG - Intronic
1103595915 12:122024071-122024093 GCCGGCCGCCCCGGGGCCCGCGG - Intronic
1103800471 12:123534087-123534109 GAGGGGCGCCGCGGGTCCGGCGG - Intergenic
1104624348 12:130339184-130339206 GCCGGGCTCTGCGAGGCCCGGGG + Intronic
1104903988 12:132203812-132203834 GACGGGCCTGGTGGGTCCCGGGG + Intronic
1106995047 13:35471269-35471291 GCCCGGCCCGGCGGGGGCCGAGG + Intronic
1107945960 13:45418123-45418145 GCCGGGCTCGGCGGGGCGCGAGG - Intronic
1108643635 13:52406168-52406190 GGCGGGCCCCGCGGGGCTGTGGG - Intronic
1110269183 13:73574277-73574299 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1110318505 13:74135301-74135323 GCAGACCCCCGCGGGGCCCGGGG + Intergenic
1113695597 13:112343270-112343292 GCCTGGCCCCGCGGGCCCAGGGG - Intergenic
1114224136 14:20723258-20723280 GAGGATCCCCTCGGGGCCCGGGG - Intergenic
1115609554 14:35038543-35038565 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1116871645 14:50073958-50073980 GACGGACCCCGCGGGGCCCGAGG + Intergenic
1118404934 14:65413234-65413256 GCCGGGCCCCGCGCGCCTCGGGG + Intronic
1119480675 14:74955810-74955832 GGCGGGCGCGGCGCGGCCCGGGG - Intergenic
1121050494 14:90816460-90816482 GGCGGGCGCGGCGGGGCCCCGGG + Intronic
1122370257 14:101225587-101225609 CAAGGGCCCCCCGGGGGCCGTGG + Intergenic
1122516754 14:102314395-102314417 GACGGGGCGCGCCGGGGCCGGGG - Intergenic
1122581997 14:102777173-102777195 GAGGAGGCCCGCGGGGCGCGCGG + Intergenic
1122620924 14:103057368-103057390 GCCGGGCCCCGCGGGTCCATGGG + Exonic
1122775978 14:104117137-104117159 GCCCTGCCACGCGGGGCCCGCGG + Intergenic
1122857652 14:104567522-104567544 GAGGGGCCCTCCGGGGCCTGAGG + Intronic
1122964017 14:105112698-105112720 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1124118202 15:26867156-26867178 GGCGGGCGGCGCGCGGCCCGGGG + Intronic
1124340252 15:28885807-28885829 GACCGGCCCGGGGGGACCCGGGG + Intronic
1124453640 15:29821825-29821847 GAGGGGCTCCCCGCGGCCCGCGG + Intronic
1124500410 15:30223225-30223247 GTGCAGCCCCGCGGGGCCCGAGG + Intergenic
1124743163 15:32315441-32315463 GTGCAGCCCCGCGGGGCCCGAGG - Intergenic
1125079045 15:35655563-35655585 GACGGGCCCCGCGGGCCCGAGGG + Intergenic
1125659010 15:41381931-41381953 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1125899244 15:43329956-43329978 GTCGAGCCCCGCGGCGCCCAGGG + Exonic
1128171485 15:65517490-65517512 GACGGTCCGGGCGGGGCCGGGGG - Intronic
1128344052 15:66842638-66842660 CCCGTGCCCCGCGGGGCCTGCGG + Intergenic
1128501279 15:68229283-68229305 GCCGAGCCCCGCTGGGCCCCAGG + Intronic
1129428278 15:75480804-75480826 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1129917023 15:79283041-79283063 AACAGGACCCGCGGGGCCCGGGG + Intergenic
1130531178 15:84748682-84748704 GCCGGGCCGAGCGGGGCCTGCGG + Intronic
1131136049 15:89936520-89936542 GACCGGGCCCGCAGGGCCTGGGG - Intergenic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1134523419 16:14928552-14928574 GACGGGCCACGTGGGGCGGGCGG - Intronic
1134711013 16:16327036-16327058 GACGGGCCACGTGGGGCGGGCGG - Intergenic
1134948570 16:18341573-18341595 GACGGGCCACGTGGGGCGGGCGG + Intergenic
1136242163 16:28951235-28951257 GACCGGCCCCGGGGGCTCCGGGG - Exonic
1136315919 16:29454742-29454764 GATGGGTCCCGCGGGGGTCGCGG + Exonic
1136430496 16:30194084-30194106 GATGGGTCCCGCGGGGGTCGCGG + Exonic
1136522471 16:30805835-30805857 GTCGCGCCCCGCGGCCCCCGAGG - Intergenic
1138558987 16:57788810-57788832 GACTGGACCCGCTGGGCCCTGGG - Intronic
1141538468 16:84699951-84699973 GCCGCGCGCCGCGGGGCGCGGGG - Intergenic
1141665390 16:85462957-85462979 GACGGGCCCGGAGGGGGCGGGGG - Intergenic
1141697820 16:85628388-85628410 GAGGGGGCCCATGGGGCCCGGGG + Intronic
1141989970 16:87603824-87603846 GAAGGGCCAGGCTGGGCCCGCGG + Intronic
1142683107 17:1561967-1561989 GAGAGGCCCCGCGGCGGCCGAGG - Intronic
1143041566 17:4041464-4041486 GACGGTGCCCGCGGGACCCAAGG - Intronic
1144095233 17:11894439-11894461 GACGGGCACCGCCAGCCCCGTGG + Exonic
1145205672 17:20984013-20984035 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1146132570 17:30291742-30291764 GCCGGGCCTCACGGGGACCGCGG + Intronic
1147044254 17:37742112-37742134 GACGGACCCTGCGGGCGCCGCGG - Intronic
1147393152 17:40122265-40122287 GGCGGGCCCGGCCGGGCCAGGGG + Intergenic
1147963189 17:44180015-44180037 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1147994520 17:44353652-44353674 GAGGGCCCCCGCGGGCCCCCGGG + Exonic
1148183042 17:45620507-45620529 GCGGGGGGCCGCGGGGCCCGGGG + Intergenic
1148265811 17:46225184-46225206 GCGGGGGGCCGCGGGGCCCGGGG - Intronic
1149430823 17:56594479-56594501 GACCGGCCCGGCGGGGGCGGGGG + Exonic
1149908732 17:60550847-60550869 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1150267826 17:63842470-63842492 CATGGGCCCCGCGGGCCCCGCGG - Exonic
1150267827 17:63842471-63842493 CGCGGGGCCCGCGGGGCCCATGG + Exonic
1150488779 17:65560916-65560938 GGCCGGCCCGGGGGGGCCCGGGG - Intronic
1151308748 17:73280585-73280607 GAAGTGCCCTGCGGGGCCCTAGG + Intergenic
1151355021 17:73553230-73553252 GACAGGCCACGGGGGGCCAGTGG + Intronic
1151542322 17:74770891-74770913 GACTGGCCACGCGGGGGCAGTGG - Exonic
1152233332 17:79125723-79125745 GAAGGGCGCCGCGTGGCCCTGGG + Intronic
1152362723 17:79839908-79839930 GGCGGGGCCCGCGCGTCCCGGGG - Intergenic
1152697500 17:81804317-81804339 GGCGGGCGCGGCGGGGCCGGGGG + Intronic
1152758975 17:82098503-82098525 GTCGGGGCCCGCGGGGCGGGAGG - Intergenic
1153997600 18:10455086-10455108 CCCGGGCGCCGCGGAGCCCGCGG + Intronic
1154338678 18:13485578-13485600 GATGTGCCCTGCTGGGCCCGGGG + Intronic
1155053092 18:22165122-22165144 GACGGGCCCGGCGGGACCTGTGG - Intergenic
1155166728 18:23237848-23237870 GAGGGGCCTGGCGGGGCCCTGGG + Intronic
1158236588 18:55322564-55322586 GCCGGGGCCCGCGGAGCCCGGGG - Intronic
1159040687 18:63320407-63320429 GCCGGGCCCCGCGGGCGCAGCGG - Intergenic
1160242301 18:77132607-77132629 GAGGGGCGCCGCGGGGTCCAAGG + Exonic
1160613788 18:80109150-80109172 CACAGGCCCCCCGGGGCCCCTGG - Exonic
1160613789 18:80109151-80109173 CAGGGGCCCCGGGGGGCCTGTGG + Exonic
1160719265 19:590269-590291 GTGCAGCCCCGCGGGGCCCGAGG + Exonic
1160788290 19:912033-912055 GGCTGGCACCTCGGGGCCCGGGG + Intronic
1160887045 19:1354967-1354989 GCCGCTCCCCGCGGGGCCGGGGG - Intronic
1160957179 19:1699154-1699176 GGCGGGCGCCGCGGGGGCCTGGG + Intergenic
1160982749 19:1823749-1823771 GAGGGGTCCCGCGGTGCCCCCGG - Exonic
1160987937 19:1848246-1848268 TTCCGGCACCGCGGGGCCCGGGG - Exonic
1161200335 19:3011070-3011092 GACTGGCCGAGCTGGGCCCGGGG + Exonic
1161439079 19:4280225-4280247 GCCGGACCCCGCGGGCCCTGGGG + Exonic
1161703081 19:5805346-5805368 GCCTGGGCCCGCGGTGCCCGGGG - Intergenic
1161779175 19:6279804-6279826 GGCGAGCGACGCGGGGCCCGGGG - Exonic
1162030766 19:7916410-7916432 GCCGGGCGCCGCGGGGAACGGGG - Exonic
1162322518 19:9978582-9978604 TAAGGGCCCCCCAGGGCCCGTGG - Exonic
1162572415 19:11480878-11480900 GCGCGGCCCCGCGGGGCCCGGGG + Exonic
1162886696 19:13702773-13702795 GACGGGCCCCGCGGGGCCTGAGG + Intergenic
1163103238 19:15109749-15109771 GAGGCGCCTGGCGGGGCCCGGGG - Exonic
1163583770 19:18153407-18153429 GTCGGGCCCCGCGGGAACTGGGG + Intronic
1163666713 19:18606918-18606940 GGCGGGGCGCGCGGTGCCCGCGG - Intronic
1163906083 19:20150711-20150733 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1164653336 19:29901704-29901726 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1165040476 19:33064708-33064730 CACGGCCCCTGCAGGGCCCGGGG + Intronic
1165080103 19:33302058-33302080 GACGGCGCCGCCGGGGCCCGCGG + Exonic
1166261442 19:41644243-41644265 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1166367380 19:42284425-42284447 GACGGCCCCCGCGCGCGCCGGGG + Intronic
1166677278 19:44747856-44747878 GCCGGGGCCCGCGGGGCACCGGG - Intronic
1166790393 19:45395694-45395716 GCGGGGCCCCGCGGGGCTGGGGG + Exonic
1167019193 19:46861358-46861380 GACGGGGACGGCGGGGCCCGGGG - Intergenic
1168315775 19:55484219-55484241 GGGGAGCCCCGCGGGGCCCGAGG - Exonic
1168339306 19:55614450-55614472 GGCGGGCCCCCCGCGGCCGGTGG - Exonic
1168419220 19:56190292-56190314 GACCGGGCCCGCAGGGCCTGGGG + Exonic
1168421770 19:56208713-56208735 GACTGGGCCCGCAGGGCCTGGGG - Exonic
926095740 2:10079954-10079976 GGCGGGCTCCGGGGGGCCCCAGG + Exonic
927357070 2:22186441-22186463 CCCGGGGCCGGCGGGGCCCGCGG - Intergenic
927652185 2:24919715-24919737 GACGGTCCCCGCGCGGGCTGGGG + Exonic
929614376 2:43296872-43296894 GACGGGCCCCGCGGGGCCCGAGG + Intronic
932036477 2:68251985-68252007 CCCGGGCCCGGCGGGTCCCGCGG - Intronic
936545989 2:113393814-113393836 GACGGGCCCCGCAGGGCCCGAGG + Intergenic
937045651 2:118850030-118850052 GCCGGGCCGCGCGGCGCGCGGGG - Intergenic
937919688 2:127120501-127120523 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
938338905 2:130522744-130522766 CACGGGCCGCGGGGGGCGCGGGG + Intronic
938350933 2:130598006-130598028 CACGGGCCGCGGGGGGCGCGGGG - Intronic
938368814 2:130756206-130756228 GCCCGACCCCGCGGGGCCCCTGG + Intronic
938501854 2:131834678-131834700 GACGGGGCCCGCGGGCGGCGGGG + Intergenic
942890531 2:180981154-180981176 GGAGGGCCGCGCGGGGGCCGCGG - Intronic
944154126 2:196593192-196593214 GGCGGGTCGCGCGGGGGCCGTGG - Intronic
945314824 2:208360342-208360364 AAGGGGCCCCGAGGGGCTCGGGG - Intronic
945664172 2:212721098-212721120 GACTGGCCCCGCGGAGCAGGGGG + Intergenic
946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG + Exonic
947800779 2:232927731-232927753 TGCGGGCCCGACGGGGCCCGGGG + Intronic
947992294 2:234497147-234497169 GGCGGGCGGGGCGGGGCCCGGGG - Intergenic
948393292 2:237627479-237627501 GACGGGGGCCGCGGGGACCCGGG - Intergenic
1170425167 20:16228411-16228433 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1172083279 20:32358850-32358872 GGGGGGCTCCGTGGGGCCCGGGG + Intronic
1172277176 20:33686100-33686122 GGCGGGCGCCGCGGGGCCGGTGG + Exonic
1172350058 20:34231338-34231360 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1173672915 20:44810421-44810443 GGCGGGCGCGGCGGGGCCGGCGG + Intergenic
1174246885 20:49188247-49188269 GGCGGGCGCCGCCGGGCCGGGGG + Exonic
1175210577 20:57351428-57351450 GACGGGACGCGCGCGGCACGGGG - Intronic
1177178635 21:17721115-17721137 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1178981467 21:37268099-37268121 GCCGGGCTCCGCGGGCCGCGAGG + Intergenic
1179810282 21:43865460-43865482 GCGGGGCCCCGGGCGGCCCGAGG - Intronic
1179810299 21:43865497-43865519 GCCGCGCTCCGCGGGGCGCGGGG + Intronic
1180045192 21:45301937-45301959 GACGGGGCCCCCGGGGACCTCGG + Intergenic
1180871595 22:19149980-19150002 GCGGGGCCCGGCGGAGCCCGGGG - Intronic
1182296049 22:29311685-29311707 GGCCGGCCCCGGGGGGCCCCAGG + Intronic
1182439883 22:30356981-30357003 GTCGGACGCCGCGGTGCCCGCGG - Exonic
1182445478 22:30387193-30387215 GCTGGGCCTGGCGGGGCCCGGGG - Exonic
1182663921 22:31944067-31944089 GACCCGCCCCTCGGGGCACGCGG + Intronic
1183841634 22:40502715-40502737 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1183845109 22:40536437-40536459 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1184545563 22:45164600-45164622 CACGGGCCGGGCGGGGCGCGCGG + Intronic
1184620461 22:45672358-45672380 GTGGGTCCCCGCGGGGCCTGGGG + Intronic
1184856670 22:47150137-47150159 GAAGGGCCCCACGCGGCACGGGG + Intronic
1185045774 22:48528073-48528095 GACAGGCACCGGGGGGCCCCGGG - Intronic
1185317474 22:50185310-50185332 GTCGGGCCCCAGGGGCCCCGCGG - Intergenic
950253866 3:11488308-11488330 GACGGACCCCGCGGGGCCCGAGG - Intronic
951013734 3:17705909-17705931 GACGGGCCCCGCGGGCCCGAGGG - Intronic
951558777 3:23945753-23945775 GGCGGGCGCCGGGCGGCCCGGGG - Intronic
952896682 3:38082458-38082480 GACGGGCCCCGCGGGGCCCGAGG - Intronic
953325999 3:42013302-42013324 GATGGGACCCCCGCGGCCCGGGG - Intergenic
953618161 3:44510528-44510550 GAGCGGCCCGGCGGGGCGCGGGG - Intronic
953657044 3:44862182-44862204 GAGGGGCGCTGCGGGGCCCGCGG + Intronic
953891878 3:46756833-46756855 GACGGCCTCCGCAGGGGCCGTGG - Intronic
954080524 3:48210861-48210883 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
955297224 3:57746955-57746977 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
955400118 3:58585521-58585543 AGCGGGCCGCGCGGGGCGCGGGG + Intronic
956270213 3:67443384-67443406 GACGGGCCCCGCGGGGCCCGAGG + Intronic
959042499 3:101438866-101438888 GACGGGCCCCGCGGGGCCCGAGG + Intronic
959419589 3:106112636-106112658 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
964622611 3:158732292-158732314 GGCGGCGCCCGCGGGGTCCGGGG - Exonic
964647833 3:158977543-158977565 GAAGGGCCCTGAGGGGCCTGGGG + Intronic
965590740 3:170358036-170358058 GACGGGAGCCGCGGGGACCCCGG + Intronic
966359453 3:179119490-179119512 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
966696338 3:182793721-182793743 TCCGGGTCCCGCGGGGCGCGGGG - Exonic
966861495 3:184233339-184233361 GGCGGGCCTGGCGGGGCCAGCGG - Exonic
968230697 3:197003173-197003195 GAAGGGCCGCGCGGGCCCGGGGG + Exonic
968433825 4:575202-575224 GCCGGGGCCGGCGGGGCCGGCGG - Intergenic
968503422 4:961339-961361 GCCGGGCTCAGCGGGGACCGGGG + Intronic
968674648 4:1871141-1871163 GAGGCGGCTCGCGGGGCCCGCGG + Intergenic
968820200 4:2844111-2844133 GGCGGGGGCCGCGGGGCCTGCGG + Intronic
968896719 4:3408639-3408661 GACGGGACCTGCTGGGCACGTGG - Intronic
969559541 4:7938863-7938885 GGCGGGCCCCGGGGGGCGCGGGG - Intronic
969716784 4:8871732-8871754 GTCGGGCCCCGCAGGGCAGGCGG + Exonic
973292338 4:48483287-48483309 GGCGGGGCCTGCGGGGCGCGGGG + Intergenic
973620596 4:52722150-52722172 TACGGGTCCTGCGGGTCCCGCGG + Intergenic
977809848 4:101346555-101346577 GAAGGGCGCCGCGGGGGCGGGGG + Intronic
979624161 4:122827156-122827178 GCCGGGCCCCGCAGGGACCATGG + Exonic
981491618 4:145346295-145346317 GGCGGGCGGCGCGGGGCCCCAGG + Intergenic
982358312 4:154492076-154492098 GACGTGCACCGCGGGGCGGGTGG + Intergenic
982616102 4:157637757-157637779 GGACGGCCCCGCGGGGCCCGAGG - Intergenic
985825165 5:2185982-2186004 GACAGGCCCCGCAGGGCCACTGG + Intergenic
986733183 5:10649806-10649828 GGCGGGCGCTGCGGGGCCCCGGG - Exonic
992373718 5:76171073-76171095 GACGGGCCCCGCGGGGCCCGAGG + Intronic
992444218 5:76819698-76819720 CACCGGCCCCGCGGGGCCAGCGG - Intronic
992444219 5:76819699-76819721 CGCTGGCCCCGCGGGGCCGGTGG + Intronic
998583484 5:143403749-143403771 GAGGGGCCGCGCGGCGGCCGCGG + Intronic
999188437 5:149730158-149730180 GCGGGGCCGCGCGGCGCCCGCGG - Intergenic
999928932 5:156409495-156409517 TAAGGGCCCAGCCGGGCCCGGGG - Intronic
1000985245 5:167858843-167858865 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1002180963 5:177431002-177431024 GAGGGGCCCTGCTGGGGCCGGGG + Intronic
1002341414 5:178518805-178518827 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1003049332 6:2765754-2765776 GGCGGGGCACGCGGAGCCCGCGG + Exonic
1004387946 6:15188460-15188482 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1006313564 6:33277702-33277724 GGCGGGCTGCGCGAGGCCCGGGG + Exonic
1006492128 6:34396993-34397015 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1006932720 6:37697432-37697454 GACGAGCGCCGCGGGTCCCCGGG + Exonic
1007674430 6:43581555-43581577 GACGGGCCCCGCGGGCCCGAGGG - Intronic
1011405425 6:87010810-87010832 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1011517039 6:88166236-88166258 GCCGGGCCAGGCGGGGCTCGCGG - Exonic
1013155560 6:107489454-107489476 GACCGGCCGGGCGGGGCGCGGGG + Intergenic
1013170811 6:107634977-107634999 GGCGGGCCCCGAGGCGGCCGCGG + Exonic
1013272500 6:108557881-108557903 GAGGGACGCGGCGGGGCCCGCGG - Intergenic
1015476537 6:133664303-133664325 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1015965747 6:138693591-138693613 GGGGGACCCCGAGGGGCCCGGGG - Intergenic
1017738228 6:157381959-157381981 GGCGGGGCCCGCGCGGCCGGGGG + Exonic
1018400467 6:163415090-163415112 GCCGGGTCCCGAGCGGCCCGCGG + Exonic
1018682335 6:166275044-166275066 GAAGGGCCCAGTGGGGCCGGGGG - Intergenic
1019474175 7:1236163-1236185 CGCGGTCCCCGCGGCGCCCGAGG - Exonic
1019564036 7:1670847-1670869 GACGGTCCCCGCGCGGAGCGAGG - Intergenic
1019700826 7:2474433-2474455 GAAGGTCCCAGCGGGGCCCAGGG - Intergenic
1020016889 7:4836430-4836452 GCCGGGCTCCTCGGGGCCCTGGG + Exonic
1020274379 7:6615707-6615729 GCCGGGCCGCGCGGGGGCCGGGG - Exonic
1020281657 7:6653168-6653190 GGCGGCCGCCGCGGGGCCCGAGG + Exonic
1020616630 7:10466430-10466452 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1021872146 7:25017968-25017990 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1025007463 7:55365687-55365709 GACGGGCTCTGCGGGCCACGGGG + Exonic
1027774226 7:82444110-82444132 GACCAGCCCCGCGGGGCTCCCGG + Intergenic
1029440807 7:100585805-100585827 CCCGGGCCGGGCGGGGCCCGGGG + Intronic
1034911670 7:155002985-155003007 GCCGGGCGCCGCGGGGGCCGGGG - Exonic
1035437378 7:158869170-158869192 GAGGGACCCCTCTGGGCCCGTGG + Intronic
1035437389 7:158869209-158869231 GAGGGACCCCTCTGGGCCCGTGG + Intronic
1035508107 8:150592-150614 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1036536872 8:9658303-9658325 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1037783630 8:21888715-21888737 GGCAGGCCTCGTGGGGCCCGAGG - Intergenic
1040065444 8:43140804-43140826 GCCGGGCCCCGCGGAGGCGGGGG + Intronic
1040471310 8:47737826-47737848 GGCGGGCGGCGCGGGGCCCCTGG - Exonic
1042048817 8:64685198-64685220 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1042155419 8:65840913-65840935 GGCGAGCGCCGCGGGGCGCGCGG + Intronic
1044591465 8:93917348-93917370 GAAGGGCGCCGCGGGGCCGGCGG + Intronic
1044660468 8:94590228-94590250 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1047687122 8:127315894-127315916 GAAGGGCCCCGCGGGGCCCGAGG + Intergenic
1047848269 8:128827129-128827151 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1048981180 8:139703946-139703968 GAGGGGTCCCGCGGGCCTCGCGG + Intergenic
1049306045 8:141904861-141904883 GACAGGCCCTGCGGTGCCCCTGG + Intergenic
1049788518 8:144462595-144462617 CACGGAGCCCGCGGGCCCCGCGG + Intronic
1050090643 9:2014905-2014927 GAGGAGCCCCGCGGCGCCCGAGG + Intergenic
1053003382 9:34589909-34589931 GCGGGGGCGCGCGGGGCCCGTGG - Intronic
1053008510 9:34620379-34620401 TACGGGCCGGGCGGGGCGCGCGG - Exonic
1053256035 9:36616017-36616039 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1053435014 9:38068736-38068758 GACGCCCCCCGCCGGGGCCGGGG - Exonic
1053457071 9:38241564-38241586 GACGGGCCCCGCGGGGCCCGAGG + Intergenic
1056712014 9:88998961-88998983 GACAGGCAGCGCAGGGCCCGGGG - Exonic
1057075692 9:92137066-92137088 GACTGGCCCCGCAGGGCCAAAGG + Intergenic
1057259674 9:93576683-93576705 GCCGGGCCGCGCGGGGGCGGCGG - Exonic
1057618912 9:96618693-96618715 GACGGGCAACGCGGCGCCCAGGG + Intronic
1057802364 9:98198167-98198189 GACGGGCCCCGTGGTGGCCCTGG - Intergenic
1059210863 9:112513724-112513746 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1059269010 9:113060785-113060807 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059270146 9:113066234-113066256 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059271282 9:113071684-113071706 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059272413 9:113077128-113077150 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059273548 9:113082570-113082592 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059274684 9:113088016-113088038 GGGGGGCCCCGAGGGGGCCGAGG - Intergenic
1059435831 9:114275730-114275752 GACGGGCCCCCCGGCCCCCCTGG + Exonic
1060064782 9:120495077-120495099 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1060480021 9:124012323-124012345 GGCGGGACCGGCGGGGCCGGGGG - Exonic
1060480038 9:124012366-124012388 GTCGGGCCCCGAGGTGCACGGGG + Exonic
1060994483 9:127868299-127868321 GGTGGGCCCCGCGGGCCCAGGGG - Exonic
1061285430 9:129620044-129620066 GTGAGGCCCCGCGGGGCCCGGGG - Intronic
1061415522 9:130445078-130445100 GACGCCCGCCCCGGGGCCCGCGG + Intronic
1061483812 9:130910221-130910243 GACCAGCCCCGCTGGCCCCGGGG + Intronic
1061824945 9:133252270-133252292 GCAGGGACCCGAGGGGCCCGAGG + Intronic
1061984088 9:134119045-134119067 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1062103213 9:134739006-134739028 GTGGGGCCCCTCGGGGCCCAGGG + Intronic
1062408655 9:136410400-136410422 GTCGTGCCCCGCCGGGCCGGCGG - Exonic
1062461933 9:136665882-136665904 GGCGGGACCCGCGGAGCCCCCGG + Intronic
1062556333 9:137114803-137114825 GACGGTCTCCGTGGGGACCGCGG - Intronic
1062626021 9:137441777-137441799 GACGGGCGCCGCGGGGCTGCAGG - Intronic
1185464524 X:346599-346621 GACGGGGCGGGCGGGGCCCGGGG - Intronic
1187976693 X:24710052-24710074 GACGGGCCCCACGGGGCCCGAGG - Intronic
1190560674 X:51682568-51682590 GGCGGGCCCCGGCGGGTCCGGGG + Intergenic
1190563617 X:51710753-51710775 GGCGGGCCCCGGCGGGTCCGGGG - Intergenic
1191618309 X:63190318-63190340 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1192621083 X:72680858-72680880 GACGGGCCCCGCGGGGCCCGAGG + Intronic
1195036318 X:100973376-100973398 GACGGGCCCCGCGGGGCCCGAGG - Intronic
1196404612 X:115348252-115348274 GACGGGCCCCGCGGGGCCCGAGG - Intergenic
1197980954 X:132217780-132217802 GACGACCCCCGCGGGAGCCGGGG - Exonic
1200124304 X:153806021-153806043 GACGGGCACAGCGGGGCCTTGGG + Intronic
1200256175 X:154584568-154584590 GGAGGGCCCAGCGGGACCCGGGG - Intergenic
1200261594 X:154619835-154619857 GGAGGGCCCAGCGGGACCCGGGG + Intergenic
1200267576 X:154654132-154654154 GGAGGGCCCAGCGGGACCCGGGG + Intergenic
1202161134 Y:21938133-21938155 GCAGGGCCCCGAGGGGCACGTGG - Intergenic
1202230222 Y:22648240-22648262 GCAGGGCCCCGAGGGGCACGTGG + Intergenic
1202312934 Y:23547925-23547947 GCAGGGCCCCGAGGGGCACGTGG - Intergenic
1202557868 Y:26122669-26122691 GCAGGGCCCCGAGGGGCACGTGG + Intergenic