ID: 959419590

View in Genome Browser
Species Human (GRCh38)
Location 3:106112643-106112665
Sequence AGGAGCGGACGGGCCCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 62, 1: 8, 2: 1, 3: 13, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419590_959419596 -4 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027
959419590_959419601 9 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419590_959419607 17 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419590_959419605 14 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419590_959419598 -1 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419590 Original CRISPR AGGAGCGGACGGGCCCCGCG GGG (reversed) Intergenic
900113757 1:1020129-1020151 AGGAGCGCGCGGGCCGCGCCGGG - Exonic
900145753 1:1158072-1158094 AGAAGCGGAGGAGCCCCGGGCGG + Intergenic
901526090 1:9824107-9824129 AGGAGCGGAGGGAGCGCGCGCGG + Exonic
901930980 1:12595913-12595935 AAGAGCGGACGGTCCCGGGGCGG - Intronic
902053644 1:13583287-13583309 CGGAGCGGGCGGGCTCCGGGGGG - Intergenic
903526494 1:23994976-23994998 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
903923425 1:26817436-26817458 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
904528824 1:31155059-31155081 GGGAGCGGCCGGGCCCTGGGCGG + Intergenic
904794826 1:33051306-33051328 AGGAGCGGACGGGCCCCGCGGGG + Intronic
905247520 1:36625420-36625442 AGGAGCAGAGGGGCCCCAGGTGG - Intergenic
906436930 1:45804032-45804054 AGGAGCGGACGGGCCCCGCGGGG + Exonic
906486656 1:46240467-46240489 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
907453916 1:54563076-54563098 AGGAGCGGACGGGCCCCGCAGGG - Intronic
908973410 1:69865768-69865790 AGGAACGGTCGGGCCGGGCGCGG - Intronic
912825478 1:112899326-112899348 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
912844666 1:113068779-113068801 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
918105740 1:181413644-181413666 TGGAGCGGATGGGCCCCGTGAGG + Intronic
919789818 1:201283918-201283940 AGGGGCGCACGGACCACGCGGGG - Intronic
920184481 1:204151712-204151734 GGGAGCCGCCGGGCCCCCCGAGG - Exonic
920251293 1:204624169-204624191 AGGAGCTGAGGGGCCCAGCAGGG - Intronic
921414440 1:214870432-214870454 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1065335698 10:24655540-24655562 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1066963667 10:42242540-42242562 CGAGTCGGACGGGCCCCGCGGGG - Intergenic
1070318249 10:75334207-75334229 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1072150167 10:92675995-92676017 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1072950120 10:99840135-99840157 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1073102729 10:101015266-101015288 AGGAGCGGACAGGTGCCACGTGG - Intronic
1076896446 10:133315041-133315063 AGCAGCCGACAGGCCCCGGGCGG - Intronic
1081784949 11:45739184-45739206 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1083776140 11:64895129-64895151 AGGGGCTGACGGGCGCCGTGGGG - Exonic
1084396113 11:68911625-68911647 AGGAGCGGACGGGCTCTGACAGG - Intronic
1084790873 11:71474635-71474657 AGGAGCAGGCGGGACCCCCGGGG - Intronic
1084790898 11:71474707-71474729 AGGAGCAGGCGGGACCCCCGGGG - Intronic
1085526697 11:77168087-77168109 AGGAATGGATGGGCCCAGCGAGG - Intronic
1090788628 11:130070487-130070509 GGGAGCGTACGGGGTCCGCGCGG - Intronic
1091762439 12:3096005-3096027 AGGAGCGGACAGGCCCCGCGGGG - Intronic
1092861905 12:12725656-12725678 AGGCGGGGAGGGGCCCCGGGCGG - Intergenic
1094041518 12:26125128-26125150 AGGAGGGGCCGGGCCGGGCGGGG + Intronic
1094839541 12:34337162-34337184 CGGAGCTGCTGGGCCCCGCGGGG + Intergenic
1094840246 12:34339786-34339808 CGGAGTGGCTGGGCCCCGCGGGG + Intergenic
1094840614 12:34341272-34341294 CGGAGCGGCTGGGCCCCGCGGGG + Intergenic
1094840729 12:34341652-34341674 CGGAGCAGCTGGGCCCCGCGGGG + Intergenic
1094841537 12:34344508-34344530 CGGAGCTGCTGGGCCCCGCGGGG - Intergenic
1095439349 12:42227165-42227187 AGGAGCGGACGGGCCCCACGGGG + Intronic
1096022480 12:48333773-48333795 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1096156683 12:49345203-49345225 AGGAGGGGTCGGGACCCGGGCGG + Intergenic
1096598631 12:52714231-52714253 CGGAGGGAAGGGGCCCCGCGGGG + Intergenic
1096657974 12:53103584-53103606 AGACGCAGACGGGCCCCGCCTGG - Exonic
1097191964 12:57223789-57223811 AGGAGCGGCCGGGCCAGGCCCGG - Intronic
1101674326 12:106903743-106903765 AGGAGCAGCTGGGCCCGGCGTGG + Intergenic
1102578394 12:113871851-113871873 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1103779551 12:123389517-123389539 TGGAGCGGAGGGGCCCGGGGAGG + Exonic
1105217534 13:18297771-18297793 TGGAGCGGAGGGGCCCGGGGAGG + Intergenic
1105413872 13:20192909-20192931 AGGAGCGCGCGGGCGCTGCGGGG + Intergenic
1110269182 13:73574270-73574292 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1113494550 13:110716078-110716100 CGGGCCGGACGGGCCCCGTGGGG + Intronic
1115609553 14:35038536-35038558 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1116871644 14:50073951-50073973 AGGAGCGGACGGACCCCGCGGGG + Intergenic
1120167801 14:81220119-81220141 CAGCGCGGACGGGCCCCTCGGGG + Intronic
1122595314 14:102886272-102886294 AGGGGCGGCCGGGCCCGGCCGGG + Intronic
1122888906 14:104723765-104723787 AGGAGCGCACCTGCCCCCCGTGG - Intergenic
1122964018 14:105112705-105112727 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1123190344 14:106563739-106563761 TGGAGAGGACGGGCCGGGCGCGG + Intergenic
1125659009 15:41381924-41381946 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1126940325 15:53759498-53759520 AGGAGGGGACGGCCCGCGCTTGG - Intronic
1128656701 15:69467815-69467837 AGGAGCTAATGGGCCCCGCCGGG - Intergenic
1128982486 15:72197645-72197667 AGGAGCCGTCCTGCCCCGCGCGG + Intronic
1129428277 15:75480797-75480819 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1130348056 15:83067080-83067102 AGGCGGAGCCGGGCCCCGCGGGG - Exonic
1131119803 15:89814991-89815013 AGGAGCGGAGGAGCCCTGGGGGG - Intronic
1132803108 16:1763782-1763804 AGGTGCGGGCGGGCGCTGCGGGG + Exonic
1133220088 16:4316095-4316117 CGGAGCGGCCGGGCGCCGGGCGG + Intronic
1134523422 16:14928559-14928581 TGGGGCGGACGGGCCACGTGGGG - Intronic
1134711016 16:16327043-16327065 TGGGGCGGACGGGCCACGTGGGG - Intergenic
1134948567 16:18341566-18341588 TGGGGCGGACGGGCCACGTGGGG + Intergenic
1135691149 16:24539221-24539243 AGGAGCTGACGGGGCCTGTGGGG + Intronic
1138360757 16:56425455-56425477 AGGAGCGGCCCGGCCCGGCCCGG - Exonic
1139402923 16:66696572-66696594 AGGAGCGGGCGGACTCAGCGGGG + Exonic
1139785015 16:69385760-69385782 AGTAGCGGGCGGGCCCGGCGGGG - Exonic
1141132221 16:81444561-81444583 TGGGGCGGGCGAGCCCCGCGGGG - Intergenic
1141586583 16:85037880-85037902 AAGAGCAGAGGGGCCCCGTGAGG + Intronic
1142018509 16:87765608-87765630 AGGAGGGGGCGGGCCCCGTCTGG + Intronic
1142688581 17:1591695-1591717 ATGAGCTGACAGGCACCGCGGGG + Exonic
1143106529 17:4533123-4533145 AGGACAGGTGGGGCCCCGCGGGG + Exonic
1143554505 17:7651914-7651936 TGGAGCGGACAGGCCCCGAGAGG - Intronic
1144519557 17:15944964-15944986 TGGACCGGAGGGGCCCCGCGCGG + Exonic
1145205671 17:20984006-20984028 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1146339670 17:32007856-32007878 ACCAGCGCACGGGCCCGGCGGGG + Intronic
1147963188 17:44180008-44180030 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1148060226 17:44830760-44830782 AGGATCTGGCGGGCCCTGCGTGG + Exonic
1148645850 17:49219438-49219460 AGGGGCGGACGGGAACCGGGAGG - Intronic
1149470866 17:56914121-56914143 AGGACTGGGCGGGCCTCGCGAGG + Intergenic
1149908731 17:60550840-60550862 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1152354711 17:79801139-79801161 AGGGGCGGACGGGCCCCAGCGGG + Intronic
1152808668 17:82371188-82371210 GGGAGCTGCAGGGCCCCGCGGGG - Intergenic
1153290696 18:3499086-3499108 GGGAGCGGACGGGCTCGGAGGGG + Exonic
1153480565 18:5543323-5543345 AGGCGCGGGCGGGCGCAGCGCGG - Intronic
1154202235 18:12307910-12307932 CGGAGCCGACGTGGCCCGCGGGG - Intronic
1159797960 18:72867230-72867252 GGGAGCGCACGGGCGCGGCGGGG + Intronic
1160453480 18:78980246-78980268 AGCGGCGCTCGGGCCCCGCGCGG - Intergenic
1160717240 19:581963-581985 AGGGGCAGAAGGGCTCCGCGAGG - Intronic
1160808900 19:1004544-1004566 AGGGCCGCACGGGCCCCGTGTGG + Exonic
1160860413 19:1235160-1235182 AGGAGAGGGTGGGCCCCGGGCGG + Intronic
1161068954 19:2251036-2251058 AGGAGCGGGCGGGGGCGGCGTGG + Intronic
1161236025 19:3198709-3198731 CCCAGCGGACGGGCCCCACGTGG + Intronic
1161241299 19:3225191-3225213 AGGAGGGGAGGGGGCCCGCTCGG - Intronic
1161511673 19:4675620-4675642 AGAAGCGGCCAGGGCCCGCGGGG - Exonic
1161708605 19:5834413-5834435 AGCAGCGGACTGGCCCCAGGGGG + Intronic
1162886695 19:13702766-13702788 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1163631440 19:18419760-18419782 CGGCGCGGGCGGGCACCGCGCGG + Intronic
1163906084 19:20150718-20150740 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1164653337 19:29901711-29901733 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1166039287 19:40192076-40192098 CGGTCCAGACGGGCCCCGCGGGG - Exonic
1166261441 19:41644236-41644258 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1166846489 19:45731603-45731625 AGGAGGGGACGGGCCGGGCGCGG - Intergenic
925609457 2:5691834-5691856 GGGAGCGGCCGAGCCCCGCGAGG + Intergenic
926154866 2:10448208-10448230 AGGCGCTGACGGGCGCGGCGGGG - Exonic
927467966 2:23351155-23351177 TGGAGCTGATGGGCCCCGTGGGG - Intergenic
927809726 2:26174193-26174215 AGGGGCTGCCGGGCCCCACGGGG - Intronic
927964805 2:27262315-27262337 AGGATGGGCCGGGCTCCGCGCGG - Intronic
929614375 2:43296865-43296887 AGGAGCGGACGGGCCCCGCGGGG + Intronic
934296773 2:91748882-91748904 TGGAGCGGAGGGGCCCGGGGAGG - Intergenic
936545988 2:113393807-113393829 AGGAGCGGACGGGCCCCGCAGGG + Intergenic
937919689 2:127120508-127120530 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1169224386 20:3847030-3847052 AGGAGGGGACAGGACGCGCGGGG + Intronic
1170425168 20:16228418-16228440 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1172350059 20:34231345-34231367 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1172457589 20:35090150-35090172 AGGAGCGGAAGGGCACAGCATGG + Intronic
1172764799 20:37345841-37345863 GGGGGCGGATGGGGCCCGCGGGG + Intronic
1176169461 20:63690440-63690462 AGGTGCGGACGGGCAGCGCTGGG + Exonic
1176204769 20:63882312-63882334 TAGAGCGGACGGGCCCCCTGAGG - Intronic
1176237035 20:64058184-64058206 AGGAGCGGACGGGACAGGCAGGG - Intronic
1176240752 20:64074859-64074881 AGGAGCCGAAGGGCCCCTCCTGG - Intronic
1177178636 21:17721122-17721144 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1181269879 22:21652731-21652753 AGGAGCTGACGGGCCACGCAGGG - Intronic
1182420710 22:30247252-30247274 AGGAGGGGCCGGGGCCGGCGTGG + Intergenic
1183425202 22:37735378-37735400 TGGAGCAGACGGGCCCCCTGGGG + Exonic
1183841635 22:40502722-40502744 AGAAGCAGACGGGCCCCGCGGGG - Intronic
1183845108 22:40536430-40536452 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1184298635 22:43542049-43542071 AGGAGAGGACGAGCCCCGTAGGG + Intronic
1185045776 22:48528080-48528102 AGGAGAGGACAGGCACCGGGGGG - Intronic
1185258523 22:49849342-49849364 AGACGGGGACCGGCCCCGCGGGG + Intergenic
1185332028 22:50256241-50256263 AGGAGCGGACAGGCCACCCACGG + Intronic
950253867 3:11488315-11488337 AGGAGCGGACGGACCCCGCGGGG - Intronic
950573639 3:13817625-13817647 ATGAGCAGCCGGGCCCAGCGGGG - Exonic
954080523 3:48210854-48210876 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
955297223 3:57746948-57746970 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
956270212 3:67443377-67443399 AGGAGCGGACGGGCCCCGCGGGG + Intronic
956406389 3:68932576-68932598 AGGAGGGGCCGGGCCCGCCGCGG + Exonic
959042498 3:101438859-101438881 AGGAGCGGACGGGCCCCGCGGGG + Intronic
959419590 3:106112643-106112665 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
960289196 3:115862965-115862987 AGGAGCGCATGGGCCCAGCCTGG - Intronic
961446637 3:126984201-126984223 AGGAGGGGAGGGGCTCCGAGGGG + Intergenic
966359452 3:179119483-179119505 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
968309822 3:197674188-197674210 AGGAGCGGTCGGCCCCCTCTTGG - Intronic
969858606 4:10019022-10019044 AGGAGCCGAAGGCGCCCGCGAGG + Exonic
985672625 5:1214180-1214202 AGGAGGGAACGGGCCCATCGGGG - Intronic
985996659 5:3600733-3600755 AGGAGTGGTCGGGACCCGGGCGG + Intronic
992373717 5:76171066-76171088 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1000985244 5:167858836-167858858 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1001191552 5:169637213-169637235 AGGAGAGGGCGGGCCCTGAGAGG + Intergenic
1002021303 5:176365877-176365899 CGCAGCGCACAGGCCCCGCGCGG + Intronic
1002341415 5:178518812-178518834 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1003087044 6:3068662-3068684 GTGAGCGGACTGGCACCGCGCGG + Intronic
1003645525 6:7910623-7910645 GGCGGCGGACGGGCCCCCCGCGG - Exonic
1004387945 6:15188453-15188475 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1006492127 6:34396986-34397008 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1006683142 6:35811632-35811654 AGGAGGGGAGGGGCCACGGGAGG + Intronic
1011260374 6:85464457-85464479 AGGAGCGGACGGAGCCTGGGAGG + Intronic
1011405426 6:87010817-87010839 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1015476536 6:133664296-133664318 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1020099989 7:5389182-5389204 AGGAGCGGGCGGGCCGCGGCGGG - Exonic
1020105609 7:5421028-5421050 AGGAGGGGACGGGCACGGCGCGG + Intronic
1020616631 7:10466437-10466459 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1021872145 7:25017961-25017983 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1022410273 7:30134836-30134858 AGGAGCGGCCGGCACCCCCGCGG - Exonic
1027774225 7:82444103-82444125 CGGAGCGGACCAGCCCCGCGGGG + Intergenic
1029118715 7:98252180-98252202 AGGAGCGGACCGGCCCTCCCGGG + Exonic
1032090870 7:128910832-128910854 AGGACCGGCCGGGCCCGGGGCGG - Intergenic
1035508108 8:150599-150621 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1036536873 8:9658310-9658332 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1038807936 8:30812235-30812257 AGGGGCGGACGGGACCGGGGCGG + Intronic
1041261112 8:56021176-56021198 AGGAGCTGACAGGCCCAGCTGGG - Intergenic
1042048816 8:64685191-64685213 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1044660467 8:94590221-94590243 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1047100126 8:121667429-121667451 AGGAGTGCAGGGGCCCAGCGCGG - Intergenic
1047418488 8:124685881-124685903 GGGAGGGGACAGGCCACGCGGGG + Intronic
1047687121 8:127315887-127315909 AGGAGCGGAAGGGCCCCGCGGGG + Intergenic
1047848270 8:128827136-128827158 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1048687837 8:136924397-136924419 AGGAGTGGGCTGGCCCCGCTGGG + Intergenic
1049891399 9:73527-73549 AGGGGCGGGCGGTCCCCGGGCGG - Intergenic
1053256036 9:36616024-36616046 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1053457070 9:38241557-38241579 AGGAGCGGACGGGCCCCGCGGGG + Intergenic
1053586466 9:39464232-39464254 AGGGGCTGCCGGGCCCCGCGGGG - Intergenic
1054579840 9:66901001-66901023 AGGGGCTGCCGGGCCCCGCGGGG + Intronic
1055611809 9:78031694-78031716 AGGAGCGGGCGCGCCGGGCGCGG - Intergenic
1057048023 9:91900638-91900660 TGGAACCGACGTGCCCCGCGAGG - Intronic
1057758089 9:97853121-97853143 AGGTGCGCCCGGGCCCCGGGGGG + Intergenic
1059210862 9:112513717-112513739 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1060064781 9:120495070-120495092 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1060548649 9:124475142-124475164 AGGATGGGACAGGCCCAGCGTGG + Intronic
1061166061 9:128922667-128922689 AGGAGGGGGCGGGGCCTGCGAGG + Intronic
1061226070 9:129281679-129281701 GAGAGCGGACGGGCCACGCTGGG + Intergenic
1061773492 9:132945123-132945145 AGGAGCTGCTGGGGCCCGCGTGG + Intergenic
1061984089 9:134119052-134119074 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1062504508 9:136866143-136866165 AGGAGCGGCCGGGCCGGGCGGGG - Intronic
1187976694 X:24710059-24710081 AGGAGCGGACGGGCCCCACGGGG - Intronic
1191618310 X:63190325-63190347 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1192621082 X:72680851-72680873 AGGAGCGGACGGGCCCCGCGGGG + Intronic
1195036319 X:100973383-100973405 AGGAGCGGACGGGCCCCGCGGGG - Intronic
1195278853 X:103310514-103310536 AGGAGGGCCCGGGCCCGGCGTGG - Intronic
1196404613 X:115348259-115348281 AGGAGCGGACGGGCCCCGCGGGG - Intergenic
1200117059 X:153774041-153774063 AGGGGCGGGCAGGCCCCTCGCGG - Exonic
1200218441 X:154379041-154379063 TGGAGGGGGCGGGGCCCGCGCGG - Intergenic