ID: 959419591

View in Genome Browser
Species Human (GRCh38)
Location 3:106112644-106112666
Sequence GAGGAGCGGACGGGCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 67, 1: 6, 2: 1, 3: 18, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419591_959419601 8 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419591_959419605 13 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419591_959419598 -2 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419591_959419607 16 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419591_959419596 -5 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419591 Original CRISPR GAGGAGCGGACGGGCCCCGC GGG (reversed) Intergenic
900113758 1:1020130-1020152 GAGGAGCGCGCGGGCCGCGCCGG - Exonic
900216165 1:1482751-1482773 GAGGAGCAGCCGAGCCCAGCAGG - Intronic
901322778 1:8349628-8349650 GACGGACGGACGGGCCCTGCAGG - Intergenic
901828853 1:11879966-11879988 GTGGAGCCCACGGGCCCCTCCGG - Intergenic
903526495 1:23994977-23994999 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
903923424 1:26817435-26817457 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
904236743 1:29121776-29121798 GAGGTGCGGAGGAGCCCCGAGGG - Exonic
904432009 1:30470349-30470371 GGGGATCTGACGGGCCCCTCAGG + Intergenic
904794825 1:33051305-33051327 GAGGAGCGGACGGGCCCCGCGGG + Intronic
905774369 1:40659082-40659104 GAGGAGCGGAAGGGCTCCACAGG + Intronic
906436929 1:45804031-45804053 GAGGAGCGGACGGGCCCCGCGGG + Exonic
906486655 1:46240466-46240488 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
907453917 1:54563077-54563099 GAGGAGCGGACGGGCCCCGCAGG - Intronic
910788107 1:91022077-91022099 GGGGAGCGGAGGGGGGCCGCTGG - Exonic
910981234 1:92961525-92961547 GGGGAGTGGGCGGGCCCGGCCGG - Intergenic
912825479 1:112899327-112899349 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
912844665 1:113068778-113068800 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
915393315 1:155562989-155563011 GAGGAAGGGACGGGCCGAGCGGG + Intergenic
915522741 1:156457357-156457379 CAGGCGAGGACGGGCCCCGCAGG + Intergenic
915737989 1:158096600-158096622 GTGGTGCGGAAGGGCACCGCAGG + Intronic
920251294 1:204624170-204624192 CAGGAGCTGAGGGGCCCAGCAGG - Intronic
920331376 1:205211062-205211084 GAGGGGAGGAAGGGGCCCGCTGG - Intronic
920512612 1:206562155-206562177 GAGGAGCTGACTGGCCAGGCAGG - Intronic
921414441 1:214870433-214870455 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
922701907 1:227766103-227766125 GAGGAGGGTACGGGCTCTGCTGG + Intronic
922925371 1:229342918-229342940 GAGGATCGGCCGGGCGCGGCGGG - Exonic
923930089 1:238684899-238684921 GAGCAGCCGGCGGGCCCTGCCGG - Intergenic
1065335697 10:24655539-24655561 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1067234680 10:44437616-44437638 GAGGAGCTGATGGGCCCTGGGGG + Intergenic
1067556781 10:47278326-47278348 GAGGCGCTGACGGGCCCCCAAGG + Intergenic
1068538598 10:58267772-58267794 GAGGAGCGCCCGCGCCCCGGCGG - Exonic
1070318250 10:75334208-75334230 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1070865736 10:79707138-79707160 GAGGAGCTGCAGGGCCCAGCAGG + Intronic
1070879528 10:79845269-79845291 GAGGAGCTGCAGGGCCCAGCAGG + Intronic
1072150168 10:92675996-92676018 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1072950121 10:99840136-99840158 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1074772482 10:116742756-116742778 GAGGAGAGGCCGGGCCTCGGCGG - Intergenic
1075753432 10:124792010-124792032 GGAGAGCGCACGGTCCCCGCCGG - Intergenic
1076208730 10:128623866-128623888 GAAGAGCGGAAGAGCCCGGCCGG + Intergenic
1076876035 10:133215951-133215973 CGGGAGCGGACGGACCTCGCCGG + Intronic
1077037286 11:501536-501558 GAGGACCGGACGGGGCTCCCTGG - Intronic
1077962382 11:7089396-7089418 GGGGAGGCGGCGGGCCCCGCCGG - Exonic
1078527279 11:12110647-12110669 GCGCAGCGATCGGGCCCCGCGGG - Exonic
1080034940 11:27700656-27700678 GAGGTGAGGACAGGCCCCGGGGG - Intronic
1081784950 11:45739185-45739207 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1083731867 11:64656664-64656686 GAGGAGAGGACAGGCCAGGCTGG - Intronic
1084014783 11:66371886-66371908 GGGGAGCGGGCGGGTTCCGCAGG - Intronic
1084968113 11:72754934-72754956 GAGGAGCGGATGGGCGGCGCGGG - Exonic
1085231194 11:74972445-74972467 GAGGAGGGGGCGGGCCCAGGAGG - Intronic
1087672780 11:101127639-101127661 GCGGCGCGAACGGGCCCTGCTGG + Exonic
1088823472 11:113475273-113475295 GAGCAGTGGACGGGCCGCGGCGG + Exonic
1089466419 11:118689243-118689265 GAGCAGCCGACCGGCCCTGCTGG - Intergenic
1089961868 11:122623814-122623836 GAGGAGTGGACAGGACCTGCAGG - Intergenic
1091277574 11:134362760-134362782 GAGGAGGGGATGGGCCCAGGTGG + Intronic
1091762440 12:3096006-3096028 GAGGAGCGGACAGGCCCCGCGGG - Intronic
1094041517 12:26125127-26125149 GAGGAGGGGCCGGGCCGGGCGGG + Exonic
1094840613 12:34341271-34341293 CCGGAGCGGCTGGGCCCCGCGGG + Intergenic
1095439348 12:42227164-42227186 GAGGAGCGGACGGGCCCCACGGG + Intronic
1096022481 12:48333774-48333796 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1096598630 12:52714230-52714252 GCGGAGGGAAGGGGCCCCGCGGG + Intergenic
1097712832 12:62934454-62934476 GAGGAGAGCAGGGGCGCCGCCGG + Intronic
1097982003 12:65744450-65744472 GAGCAGCTGGCTGGCCCCGCAGG + Intergenic
1101259364 12:103013122-103013144 GAGAAGAGGAGGGGCCCAGCCGG - Intergenic
1102578393 12:113871850-113871872 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1103783408 12:123414382-123414404 GAGCAGCTGGCGGGCCCTGCCGG - Exonic
1105413871 13:20192908-20192930 GAGGAGCGCGCGGGCGCTGCGGG + Intergenic
1105471910 13:20703112-20703134 GAGGAGAGGGCTGGCCCTGCCGG - Intronic
1106597816 13:31161688-31161710 GAGGAACGGCCAGACCCCGCGGG - Exonic
1106735916 13:32587126-32587148 GAGGGGCGGGCGGGGACCGCGGG + Intronic
1110269181 13:73574269-73574291 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1112613082 13:100975788-100975810 GAGCAGCGGGCCGGCCCTGCCGG + Intergenic
1113924752 13:113935241-113935263 GAGGAGCTGAAGGGCGCCGGGGG - Intergenic
1115609552 14:35038535-35038557 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1116452344 14:45080528-45080550 GAGCAGCCGACCGGCCCTGCCGG + Intergenic
1116845688 14:49862902-49862924 GGGGAGCGGGGGGGCCACGCCGG + Intergenic
1116871643 14:50073950-50073972 GAGGAGCGGACGGACCCCGCGGG + Intergenic
1119038826 14:71254388-71254410 GAGCAGCGGGCCGGCCCTGCCGG + Intergenic
1120884480 14:89441176-89441198 GAGGAGGGAAAGGGCCCAGCAGG - Intronic
1122405170 14:101496533-101496555 GAGGAGCAAACAGGCCCGGCGGG - Intergenic
1122595313 14:102886271-102886293 TAGGGGCGGCCGGGCCCGGCCGG + Intronic
1122964019 14:105112706-105112728 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1122968245 14:105141815-105141837 GAGGGGCGGCCGGGGCCGGCAGG + Exonic
1123949145 15:25253462-25253484 GAGCAGCGGGCCGGCCCTGCCGG - Intergenic
1124363293 15:29054299-29054321 GAGGAGTGGACGGACTCGGCGGG + Exonic
1124640269 15:31392487-31392509 GAGGAGCGCAGGGGACCCGGGGG - Intronic
1125079043 15:35655555-35655577 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1125659008 15:41381923-41381945 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1125891241 15:43268716-43268738 GAGGAGTGGACAGTACCCGCAGG - Intergenic
1128656702 15:69467816-69467838 AAGGAGCTAATGGGCCCCGCCGG - Intergenic
1128758077 15:70196568-70196590 GAGGAGGGCACTGGCCCTGCAGG + Intergenic
1129255168 15:74330287-74330309 GAGGAGCCGCCTGGCCCAGCAGG + Exonic
1129428276 15:75480796-75480818 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1130348057 15:83067081-83067103 GAGGCGGAGCCGGGCCCCGCGGG - Exonic
1131119804 15:89814992-89815014 GAGGAGCGGAGGAGCCCTGGGGG - Intronic
1131160288 15:90101239-90101261 GAAGAGGGGATGGGGCCCGCTGG - Intronic
1131186041 15:90275060-90275082 GAGGAGCGCGCGGGCCCGGGCGG - Exonic
1132987823 16:2777198-2777220 GAGGGGCGGCCGGGCCGGGCCGG - Intronic
1134163925 16:11915432-11915454 GCGGCGCTGCCGGGCCCCGCAGG + Exonic
1134549436 16:15132250-15132272 GAGGAGTGGAGGGGCTCAGCGGG + Intronic
1134710867 16:16326466-16326488 GAGGAGTGGAGGGGCTCAGCGGG - Intergenic
1134948734 16:18342179-18342201 GAGGAGTGGAGGGGCTCAGCGGG + Intergenic
1135691148 16:24539220-24539242 GAGGAGCTGACGGGGCCTGTGGG + Intronic
1136993321 16:35170365-35170387 GAGGAGCGGAGCGGCGCGGCAGG - Intergenic
1139785016 16:69385761-69385783 CAGTAGCGGGCGGGCCCGGCGGG - Exonic
1141121616 16:81362866-81362888 GAGGAGGGGGCAGGCCACGCTGG - Intronic
1141972536 16:87493058-87493080 GGGGGGGGGACGGGCCCGGCAGG - Intergenic
1142030491 16:87836090-87836112 GAGGAGCGCCTGGGCCCAGCTGG - Intronic
1142229316 16:88892340-88892362 GCTGAGCTGCCGGGCCCCGCAGG + Exonic
1142688580 17:1591694-1591716 GATGAGCTGACAGGCACCGCGGG + Exonic
1142882925 17:2895308-2895330 GAGGAGGAGAAGGGGCCCGCTGG - Intronic
1144997864 17:19283212-19283234 GAGAACTGGACGGGCCCCACGGG - Exonic
1145205670 17:20984005-20984027 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1146594174 17:34155346-34155368 GAGGAGAGGCCGGGCACCCCAGG - Intronic
1147057043 17:37843082-37843104 GGGGAGCAGACAGGCCCAGCAGG - Intergenic
1147963187 17:44180007-44180029 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1148443769 17:47725664-47725686 GTGGAGCTGACGGGCCCAGGGGG - Intergenic
1148555425 17:48576291-48576313 GAGGAGAAGACGGGCCTCGGTGG - Exonic
1148859949 17:50599611-50599633 GAGGAGCGGGCCAGCCCTGCGGG + Exonic
1149908730 17:60550839-60550861 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1150289420 17:63972932-63972954 GAGGAGTGGACGGCCCGCCCAGG - Intergenic
1150792231 17:68207949-68207971 GAGCAGCCGGCAGGCCCCGCCGG + Intergenic
1151678181 17:75610526-75610548 GGGGAGCGGACGGGGCCCAGGGG - Intergenic
1152104153 17:78319095-78319117 GAGGACCCCACGGGCCTCGCTGG + Intergenic
1152354710 17:79801138-79801160 GAGGGGCGGACGGGCCCCAGCGG + Intronic
1152361139 17:79833729-79833751 CAGGAGAGGGCGAGCCCCGCCGG + Exonic
1152455985 17:80416426-80416448 GAGGAACGGAGGGGCCCAGGAGG - Intronic
1152600952 17:81261891-81261913 GAGGTCCGGACGGGGCCTGCAGG + Intronic
1153688453 18:7568094-7568116 GCGGAGCGGACGGACCCCGAGGG + Intronic
1153833423 18:8943259-8943281 GAGGGGCGTACGTGCCCAGCAGG + Intergenic
1154202236 18:12307911-12307933 GCGGAGCCGACGTGGCCCGCGGG - Intronic
1156471148 18:37377981-37378003 GAGGAGGAGAAGGTCCCCGCTGG - Intronic
1157977496 18:52342378-52342400 GAGGAGGGGACCGGCCCGGGAGG - Intronic
1160190314 18:76709566-76709588 GGACAGCGGACGGGCCCTGCGGG + Intergenic
1160512174 18:79458739-79458761 GAGGCCCGGACGGGCAGCGCCGG - Intronic
1160793204 19:932515-932537 GAGGAGGGGCTGGGCCCCCCAGG + Exonic
1160857065 19:1222395-1222417 GAGCAGCGGACGGGGTCAGCAGG + Intronic
1160948051 19:1652466-1652488 GCCGCGCGCACGGGCCCCGCGGG - Intronic
1161162398 19:2768550-2768572 GGGGAGCGGACAGGCCATGCAGG + Intronic
1161172472 19:2819935-2819957 TCGGAGCGGACGCCCCCCGCAGG - Exonic
1161511674 19:4675621-4675643 GAGAAGCGGCCAGGGCCCGCGGG - Exonic
1161920315 19:7260975-7260997 GAGGATCGCATGGGCCCCGGGGG - Intronic
1162744651 19:12791719-12791741 GAGGCCCGGAGCGGCCCCGCAGG + Exonic
1162886694 19:13702765-13702787 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1162954260 19:14089814-14089836 CAGGCCCGGACGGGCGCCGCCGG - Exonic
1163358454 19:16829901-16829923 GAGGTGGAGAGGGGCCCCGCTGG - Intronic
1163906085 19:20150719-20150741 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1164191911 19:22925512-22925534 GAGGAGCGGACGGGCCCACGGGG + Intergenic
1164653338 19:29901712-29901734 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1165458052 19:35926295-35926317 GAGGAGCTGAGGGGCCCAGTGGG - Intergenic
1166039288 19:40192077-40192099 GCGGTCCAGACGGGCCCCGCGGG - Exonic
1166261440 19:41644235-41644257 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1166391183 19:42409758-42409780 GAGGAGCTGGCTGGCCCAGCTGG + Intronic
1167093777 19:47362556-47362578 GAGCAGCGGAAGGGCCGGGCGGG + Exonic
1167414389 19:49362466-49362488 GAGGGGGGGGCGGGCCCGGCCGG + Intronic
1168721815 19:58558519-58558541 GAGGAGCGGAGCGGCGCGGCAGG - Exonic
927467967 2:23351156-23351178 GTGGAGCTGATGGGCCCCGTGGG - Intergenic
927809336 2:26173022-26173044 GAGGAGGGGGCGGGGCCCGGGGG + Intergenic
927809727 2:26174194-26174216 GAGGGGCTGCCGGGCCCCACGGG - Intronic
929614374 2:43296864-43296886 GAGGAGCGGACGGGCCCCGCGGG + Intronic
936545987 2:113393806-113393828 GAGGAGCGGACGGGCCCCGCAGG + Intergenic
937238026 2:120442327-120442349 GGGGGGCGCACGGGCCCCGAAGG + Intergenic
937919690 2:127120509-127120531 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
937996993 2:127701649-127701671 GAGGAGTGGCTGGGCCGCGCGGG + Exonic
939053233 2:137331876-137331898 GAGCAGCCGGCCGGCCCCGCCGG - Intronic
941397947 2:164995023-164995045 GAGCAGCCGGCGGGCCCTGCCGG - Intergenic
942278119 2:174337031-174337053 GCGGAGCGGCTGGGCCCGGCCGG + Exonic
946366610 2:219252937-219252959 GAAGAGCGCGCGGGCCCTGCCGG - Intronic
946923584 2:224603970-224603992 GAGCAGCCGGCGGGCCCTGCCGG - Intergenic
1169068897 20:2709730-2709752 GAGGAGCGGAGCAGCCCCCCCGG + Intronic
1170425169 20:16228419-16228441 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1171972578 20:31573307-31573329 GGGGAGGGGGCGGGCCCGGCCGG + Intronic
1172320597 20:33993253-33993275 GAGGGGAGGAGGGGCCCCGGGGG - Intergenic
1172350060 20:34231346-34231368 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1175843371 20:62045319-62045341 GAGGAGCGGGCAGGCACGGCAGG - Intronic
1176169460 20:63690439-63690461 CAGGTGCGGACGGGCAGCGCTGG + Exonic
1176237036 20:64058185-64058207 AAGGAGCGGACGGGACAGGCAGG - Intronic
1177178637 21:17721123-17721145 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1179511431 21:41876635-41876657 GAGGAGCGGACGTGGCCCCGGGG + Intronic
1179658919 21:42862520-42862542 GAGGAGGGGAGGAGCCACGCTGG - Intronic
1180790700 22:18574079-18574101 GAGGAGGGGCTGGGCCCCGAGGG - Intergenic
1180993716 22:19953998-19954020 AAGGAGTGGAGGGGCCCCACAGG + Intronic
1181231037 22:21421235-21421257 GAGGAGGGGCTGGGCCCCGAGGG + Intronic
1181247611 22:21513633-21513655 GAGGAGGGGCTGGGCCCCGAGGG - Intergenic
1181269880 22:21652732-21652754 CAGGAGCTGACGGGCCACGCAGG - Intronic
1183697382 22:39430931-39430953 GAGGTGAGGACTGGCCCCGGTGG + Exonic
1183841636 22:40502723-40502745 GAGAAGCAGACGGGCCCCGCGGG - Intronic
1183845107 22:40536429-40536451 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1184298634 22:43542048-43542070 CAGGAGAGGACGAGCCCCGTAGG + Intronic
1184514677 22:44954801-44954823 GAGGAGTGGTCTGGCCCCGCTGG + Intronic
1184844649 22:47074016-47074038 GAGGATCAGTCGGGCCCCGGAGG + Intronic
1185045777 22:48528081-48528103 GAGGAGAGGACAGGCACCGGGGG - Intronic
1185067455 22:48639286-48639308 GTGCAGCTGAGGGGCCCCGCAGG - Intronic
1185080780 22:48708339-48708361 GAGGAGCTGAAGGGCCCTCCGGG - Intronic
1185258522 22:49849341-49849363 GAGACGGGGACCGGCCCCGCGGG + Intergenic
949769975 3:7568688-7568710 GAGCAGCGGGCCGGCCCTGCCGG + Intronic
950253868 3:11488316-11488338 GAGGAGCGGACGGACCCCGCGGG - Intronic
950573640 3:13817626-13817648 GATGAGCAGCCGGGCCCAGCGGG - Exonic
951013736 3:17705917-17705939 GAGGAGCGGACGGGCCCCGCGGG - Intronic
954080522 3:48210853-48210875 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
954573703 3:51663061-51663083 GAGGAACTGACGGGGCCTGCTGG - Exonic
955297222 3:57746947-57746969 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
956270211 3:67443376-67443398 GAGGAGCGGACGGGCCCCGCGGG + Intronic
957009198 3:74985394-74985416 GAGCAGCTGGCGGGCCCTGCTGG - Intergenic
959042497 3:101438858-101438880 GAGGAGCGGACGGGCCCCGCGGG + Intronic
959419591 3:106112644-106112666 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
962998124 3:140651516-140651538 GAGCAGCCGGCCGGCCCCGCCGG + Intergenic
964378513 3:156073252-156073274 GAGTGGCTGACTGGCCCCGCCGG + Intronic
965044152 3:163552590-163552612 GAGCAGCGGGCCGGCCCTGCCGG - Intergenic
966359451 3:179119482-179119504 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
966743232 3:183253291-183253313 GAGGACTGGACGGGCAGCGCTGG - Exonic
967499170 3:190177317-190177339 GAGCAGCGGGCCGGCCCTGCCGG - Intergenic
968051697 3:195658655-195658677 GAGGAGTGGCCGGGCTCGGCCGG + Intergenic
968104118 3:195989678-195989700 GAGGAGTGGCCGGGCTCGGCCGG - Intergenic
968181612 3:196599305-196599327 GAGCAGCTGGCGGGCCCTGCTGG - Intergenic
968302420 3:197627268-197627290 GAGGAGTGGCCGGGCTCGGCCGG - Intergenic
968606004 4:1536111-1536133 CAGGAGAGGCCGGGCCCTGCTGG - Intergenic
969288290 4:6222045-6222067 GCGGAGCGGCCCGGCCCCTCTGG + Intergenic
974484804 4:62492164-62492186 GAGCAGCCGGCGGGCCCTGCCGG - Intergenic
975022297 4:69503743-69503765 GAGGAGTGGAAGGCCCCTGCTGG - Intronic
980053775 4:128061465-128061487 GCGGAGAGGACGGGGCCGGCGGG + Intronic
982616103 4:157637764-157637786 GAGGAGCGGACGGCCCCGCGGGG - Intergenic
982728176 4:158927794-158927816 GAGCAGCCGGCGGGCCCTGCTGG + Intronic
985062405 4:186092448-186092470 GAGGAGCGCACCAGCCCCGTGGG + Intergenic
988369227 5:30345821-30345843 GAGCAGCTGACCGGCCCTGCCGG + Intergenic
988684748 5:33515654-33515676 GAGCAGCGGGCCGGCCCTGCCGG - Intergenic
992373716 5:76171065-76171087 GAGGAGCGGACGGGCCCCGCGGG + Intronic
994932447 5:106206313-106206335 GAGTGGCCGACCGGCCCCGCTGG - Intergenic
996585990 5:125088795-125088817 GAGGGGCGGGCTGGCCCCACTGG + Intergenic
997980376 5:138464755-138464777 GAGGAGCGGCTGGGCCCGCCTGG - Intergenic
1000985243 5:167858835-167858857 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1001529826 5:172454169-172454191 GAGGAGGGGACGGGAAGCGCTGG + Intronic
1001931381 5:175675560-175675582 GAGGAGAGGATGGGCCCTGAGGG + Intronic
1002341416 5:178518813-178518835 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1002888194 6:1313476-1313498 GAGGAGCGCGCCAGCCCCGCGGG + Exonic
1003087127 6:3068933-3068955 GCGCGGCGGGCGGGCCCCGCCGG + Intronic
1004387944 6:15188452-15188474 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1005135946 6:22570013-22570035 GAGGAGCGCGGGGGACCCGCCGG + Exonic
1006040232 6:31246452-31246474 GAGGAGCTGAAGGGCCCGGGTGG + Intergenic
1006048643 6:31321866-31321888 GAGGAGCTGAAGGGCCCAGGTGG + Intronic
1006492126 6:34396985-34397007 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1007431730 6:41780663-41780685 GAGGGGCGGGCGGGGGCCGCTGG + Intronic
1007674432 6:43581563-43581585 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1011405427 6:87010818-87010840 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1012760515 6:103294671-103294693 GAGCAGCGGGCCGGCCCTGCCGG - Intergenic
1014632533 6:123803910-123803932 GAGGCGCGCTCGGGGCCCGCAGG - Intergenic
1015476535 6:133664295-133664317 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1015600332 6:134904824-134904846 GAGCAGCCGACCGGCCCTGCTGG + Intergenic
1016092845 6:139999851-139999873 GAGCAGCCGGCGGGCCCTGCCGG - Intergenic
1019453060 7:1109689-1109711 GGGGAGGGGAAGGGCCCTGCTGG - Intronic
1019527003 7:1484971-1484993 GGGGAGGGGACGGGGCCAGCCGG - Intronic
1019527018 7:1485006-1485028 GGGGAGGGGACGGGGCCAGCCGG - Intronic
1019527033 7:1485041-1485063 GGGGAGGGGACGGGGCCAGCCGG - Intronic
1020099990 7:5389183-5389205 AAGGAGCGGGCGGGCCGCGGCGG - Exonic
1020445408 7:8262251-8262273 GCGGTGCGCACGGGCTCCGCCGG - Exonic
1020616632 7:10466438-10466460 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1021872144 7:25017960-25017982 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1024985153 7:55187916-55187938 GAGAAGGTGAGGGGCCCCGCAGG - Intronic
1027238024 7:76309704-76309726 GAGCAGCCGGCCGGCCCCGCCGG - Intergenic
1027774224 7:82444102-82444124 GCGGAGCGGACCAGCCCCGCGGG + Intergenic
1028303306 7:89228995-89229017 GAGCAGCCGGCCGGCCCCGCCGG - Intronic
1029118714 7:98252179-98252201 GAGGAGCGGACCGGCCCTCCCGG + Exonic
1030820212 7:114085077-114085099 GAGGAGAGAGCGGGCCCCGGAGG - Intergenic
1031088099 7:117323266-117323288 GCAGAGCGGACGGGGCGCGCGGG - Exonic
1032268362 7:130383650-130383672 GAGGAGCAGAGGGGCAGCGCAGG - Intronic
1033312437 7:140271572-140271594 GAGGGGCCGGCCGGCCCCGCAGG - Intergenic
1035508109 8:150600-150622 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1035663528 8:1364197-1364219 GAGGGGCGGACGGTGCCCCCGGG + Intergenic
1036536874 8:9658311-9658333 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1036660076 8:10702181-10702203 GAGGAGAGGACAGGCCCAGCTGG + Intronic
1039068718 8:33631770-33631792 GAGCAGCCGACCAGCCCCGCTGG + Intergenic
1041218333 8:55624050-55624072 GAGGAGTGGGCTGGCCCAGCTGG - Intergenic
1041261113 8:56021177-56021199 GAGGAGCTGACAGGCCCAGCTGG - Intergenic
1042048815 8:64685190-64685212 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1044660466 8:94590220-94590242 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1046445320 8:114311444-114311466 GAGCAGCCGACCGGCCCTGCCGG + Intergenic
1047687120 8:127315886-127315908 GAGGAGCGGAAGGGCCCCGCGGG + Intergenic
1047848271 8:128827137-128827159 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1048068714 8:130999537-130999559 GTGGAGAGGACGGGCCCCTCAGG - Intronic
1048687836 8:136924396-136924418 GAGGAGTGGGCTGGCCCCGCTGG + Intergenic
1049368484 8:142252303-142252325 GAGGAAGGGCCGGGCCCCCCCGG + Intronic
1049641134 8:143716503-143716525 GGGGACCGGCCGCGCCCCGCAGG - Intronic
1049668433 8:143859079-143859101 GAGCTGCGGCCGGGCCCCGGGGG + Exonic
1049668852 8:143860687-143860709 GAGCTGCGGCCGGGCCCCGGGGG + Exonic
1049669267 8:143862289-143862311 GAGCTGCGGCCGGGCCCCGGGGG + Exonic
1049669679 8:143863882-143863904 GAGCTGCGGCCGGGCCCCGGGGG + Exonic
1049670094 8:143865490-143865512 GAGCTGCGGCCGGGCCCCGGGGG + Exonic
1053256037 9:36616025-36616047 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1053457069 9:38241556-38241578 GAGGAGCGGACGGGCCCCGCGGG + Intergenic
1053586467 9:39464233-39464255 TAGGGGCTGCCGGGCCCCGCGGG - Intergenic
1054579839 9:66901000-66901022 TAGGGGCTGCCGGGCCCCGCGGG + Intronic
1056369750 9:85941639-85941661 GAGGAGCCGGCAGGCACCGCAGG - Intronic
1057354743 9:94323879-94323901 GAGGAGCTGCAGGGCCCAGCAGG - Intronic
1057511122 9:95680423-95680445 GAGCAGCTGGCGGGCCCTGCCGG + Intergenic
1057758088 9:97853120-97853142 GAGGTGCGCCCGGGCCCCGGGGG + Intergenic
1058174886 9:101724383-101724405 GAGCAGCGGGCCGGCCCTGCCGG - Intronic
1059210861 9:112513716-112513738 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1060064780 9:120495069-120495091 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1061226069 9:129281678-129281700 GGAGAGCGGACGGGCCACGCTGG + Intergenic
1061483808 9:130910213-130910235 GAGCAGCCGACCAGCCCCGCTGG + Intronic
1061610869 9:131744821-131744843 GAGGAGCTGATTGGCCCAGCTGG + Intergenic
1061984090 9:134119053-134119075 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1062504509 9:136866144-136866166 GAGGAGCGGCCGGGCCGGGCGGG - Intronic
1062526284 9:136979260-136979282 TAGGAGCCGAGGGACCCCGCGGG - Exonic
1185465346 X:351133-351155 CTGGAGGGGCCGGGCCCCGCAGG + Intronic
1185836172 X:3347104-3347126 CAGGAGCGGGCTGGCCCCGCCGG + Intergenic
1187976695 X:24710060-24710082 GAGGAGCGGACGGGCCCCACGGG - Intronic
1191618311 X:63190326-63190348 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1192214675 X:69150202-69150224 GAGGAGGTGGCGGGCCCTGCCGG + Intergenic
1192621081 X:72680850-72680872 GAGGAGCGGACGGGCCCCGCGGG + Intronic
1194384365 X:93235823-93235845 GAGCAGCGGGCCAGCCCCGCTGG + Intergenic
1195036320 X:100973384-100973406 GAGGAGCGGACGGGCCCCGCGGG - Intronic
1196404614 X:115348260-115348282 GAGGAGCGGACGGGCCCCGCGGG - Intergenic
1198683392 X:139204485-139204507 GAGGAGCGGCCGGGACTCCCCGG + Intronic