ID: 959419592

View in Genome Browser
Species Human (GRCh38)
Location 3:106112645-106112667
Sequence GGAGGAGCGGACGGGCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 65, 1: 6, 2: 3, 3: 38, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419592_959419605 12 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419592_959419607 15 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419592_959419601 7 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419592_959419598 -3 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419592_959419596 -6 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG 0: 68
1: 4
2: 46
3: 1012
4: 14027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419592 Original CRISPR GGAGGAGCGGACGGGCCCCG CGG (reversed) Intergenic
900094793 1:936001-936023 GGAGGAGCGGCCTGTCCCCCAGG + Intronic
900137879 1:1126111-1126133 GGAGGAGGGCAGGGGCCGCGGGG + Intergenic
900584768 1:3427516-3427538 GGAGGAGGGGATGGGCTCTGAGG - Intronic
900827843 1:4940875-4940897 GGAGGACTGGAGGGGCCCCAGGG + Intergenic
901628760 1:10638355-10638377 GGGGGAGCAGCCGGGCCCTGGGG + Exonic
902033412 1:13439286-13439308 AGAGGCGCGGACGGGAACCGGGG + Intergenic
902385512 1:16073450-16073472 GGCGCAGCGGCCCGGCCCCGCGG - Exonic
903526496 1:23994978-23995000 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
903879690 1:26500501-26500523 GGAGGAGTGGAGGGGCGCCTTGG - Intergenic
903923423 1:26817434-26817456 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
904046973 1:27614963-27614985 GGAGGAGGGGCTGGGGCCCGGGG - Intronic
904079180 1:27861335-27861357 GGAGGAGAGGCCGGGCGCAGTGG + Intergenic
904236744 1:29121777-29121799 GGAGGTGCGGAGGAGCCCCGAGG - Exonic
904612927 1:31735247-31735269 GGAGGAGCAGGCTGGCCCAGGGG + Exonic
904673943 1:32186299-32186321 GGAGGAGAGGACGGGGCAGGTGG + Intronic
904794824 1:33051304-33051326 GGAGGAGCGGACGGGCCCCGCGG + Intronic
906365467 1:45206170-45206192 GCAGGTGGGGGCGGGCCCCGAGG + Exonic
906436928 1:45804030-45804052 GGAGGAGCGGACGGGCCCCGCGG + Exonic
906486654 1:46240465-46240487 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
912825480 1:112899328-112899350 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
912844664 1:113068777-113068799 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
913250617 1:116909888-116909910 GGAGGCGCGGGCGGGCGCTGCGG + Intergenic
914993100 1:152515472-152515494 GGAGGAGGAGGCGGGCGCCGGGG - Exonic
915121873 1:153634386-153634408 TGAGGAGCGGAAGGGGCCGGCGG + Intronic
920258223 1:204671122-204671144 GGAGGAGAGGACTGGCCCAGAGG + Intronic
920665336 1:207959261-207959283 GGAGGAGCGGCGCGGCCCCCAGG - Intergenic
921414442 1:214870434-214870456 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
922252654 1:223864148-223864170 GGAGGAGCTGGAGGCCCCCGTGG + Intergenic
923008036 1:230067480-230067502 GGAGGAGCGCAGGGGCGGCGCGG - Intronic
924628039 1:245711790-245711812 GGAGGAGGGGACTGTCCCCTGGG + Intergenic
1064155269 10:12898431-12898453 GGGGGGGCGCACGGGCCCCCGGG + Exonic
1065335696 10:24655538-24655560 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1065993045 10:31031627-31031649 GGAGGCGAGGCCGCGCCCCGTGG - Intronic
1066479880 10:35785583-35785605 CGAGCAGCGGAAGGGCCCTGGGG - Intergenic
1067070674 10:43128801-43128823 GGAGGGGAAGAGGGGCCCCGAGG + Exonic
1067234679 10:44437615-44437637 GGAGGAGCTGATGGGCCCTGGGG + Intergenic
1067991553 10:51219420-51219442 GGAGGAGCGGCCGGGCGCAGTGG + Intronic
1069698423 10:70404610-70404632 GGCGAAGCGGCCGGGCACCGAGG - Intronic
1070318251 10:75334209-75334231 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1070610203 10:77927159-77927181 GGAGGAGGGGACGGGCGGAGGGG + Intergenic
1071397570 10:85238564-85238586 GGAGGAGGTGAGGGGCCCTGTGG + Intergenic
1072150169 10:92675997-92676019 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1072694104 10:97590392-97590414 GGAGGAGCTGAGGGCCCTCGAGG + Exonic
1072733330 10:97862966-97862988 AGAGGAGGAGACGGGCCCAGGGG + Intronic
1072750365 10:97974656-97974678 GGGGAAGCGGAGGGGACCCGGGG - Intronic
1072950122 10:99840137-99840159 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1073509817 10:104035717-104035739 GGAGGAACGGAGGGGCCCACGGG + Intronic
1073772468 10:106750441-106750463 GGAGGAGGGGCCGGGCGCAGTGG + Intronic
1076507489 10:130987613-130987635 GGAGGAGCGGAGGGGAGTCGGGG - Intergenic
1076930530 10:133528931-133528953 GGAGGAGCCTGCGGGCCCAGAGG - Intronic
1076991985 11:280211-280233 GGAGGAGGCGATGGGGCCCGCGG + Exonic
1077016304 11:400468-400490 GGAGGAGGGGCCGTGCCCCCGGG + Intronic
1077102181 11:827272-827294 GGAGGAGCGGCCCGGGCGCGCGG + Intronic
1077149363 11:1062611-1062633 GGAAGAGAAGACGGGCACCGAGG - Intergenic
1078527280 11:12110648-12110670 GGCGCAGCGATCGGGCCCCGCGG - Exonic
1078973962 11:16449577-16449599 GAAGGGGCGGCCGGGCGCCGTGG - Intronic
1079128615 11:17735239-17735261 GGAGGAGATGGCGGGCCCCCTGG - Exonic
1080034941 11:27700657-27700679 GGAGGTGAGGACAGGCCCCGGGG - Intronic
1081784951 11:45739186-45739208 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1083669364 11:64291681-64291703 GGCGGAGCGGGCGGCCGCCGGGG - Intronic
1083776142 11:64895131-64895153 GAAGGGGCTGACGGGCGCCGTGG - Exonic
1084182922 11:67455597-67455619 TGGGGAGCAGACAGGCCCCGAGG + Exonic
1084184562 11:67464784-67464806 GGAGGTGCGAGCGGGCACCGGGG - Exonic
1084946721 11:72642547-72642569 GGAGGATCCGACGGGCCGAGAGG - Intronic
1084968114 11:72754935-72754957 AGAGGAGCGGATGGGCGGCGCGG - Exonic
1085353452 11:75815450-75815472 AGAGCAGCGGCCGGGCCCGGGGG - Exonic
1085472952 11:76769657-76769679 GCAGGAGGGGAGGGGCCTCGGGG - Intergenic
1085641591 11:78196404-78196426 GGAGGAGCTGCCGCGCCGCGTGG + Exonic
1086724614 11:90167192-90167214 GAAGGAGCGGGCGGGAACCGGGG + Intronic
1090204755 11:124878086-124878108 GGAGGAGCGTACTGGCTCCAGGG - Exonic
1090375173 11:126283184-126283206 GGAGGCGCGGCGGGGCTCCGTGG + Intronic
1090752592 11:129760430-129760452 GGAGGTGTGGAGGGGCCCAGGGG - Intergenic
1091390944 12:125756-125778 GGAGGAGCGGCCGGGGGCAGGGG + Exonic
1091762441 12:3096007-3096029 GGAGGAGCGGACAGGCCCCGCGG - Intronic
1092160020 12:6310879-6310901 GGCGGGGCGGCCGGGACCCGGGG + Intronic
1092462399 12:8698067-8698089 GGAGAAGCTGACGGGACGCGAGG + Exonic
1094041516 12:26125126-26125148 GGAGGAGGGGCCGGGCCGGGCGG + Exonic
1094267935 12:28580137-28580159 GGAGGAGCAGATGTGCCACGTGG - Intergenic
1095439347 12:42227163-42227185 GGAGGAGCGGACGGGCCCCACGG + Intronic
1095953065 12:47791844-47791866 GGAGGCGCGGGTGGGGCCCGAGG - Intronic
1096022482 12:48333775-48333797 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1096073686 12:48789266-48789288 GGAGGAGAGGAGGGGGCGCGCGG - Intergenic
1096377398 12:51124597-51124619 GGAGGAGCGGACTGCCCCGCCGG + Intronic
1100963164 12:99985062-99985084 GGAGGAGCCGACGCGGCCCGGGG - Intergenic
1101381332 12:104216135-104216157 GGAGGAGCGGGCCCGCCGCGAGG + Intronic
1101870352 12:108560830-108560852 GGAGGAGCAGGTGGGCCCGGGGG - Exonic
1102578392 12:113871849-113871871 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1103318126 12:120073540-120073562 GGAGGAGAGGACTGTTCCCGTGG + Intronic
1103562672 12:121800486-121800508 GGAGGAGCCGGTGGGACCCGGGG + Intronic
1103700077 12:122844673-122844695 TGAGTAGCGGACAGACCCCGGGG + Intronic
1103915143 12:124372287-124372309 GGAGGAGCAGAAGCCCCCCGCGG - Exonic
1104928556 12:132326549-132326571 GGAGGAGCGGGAGGGCCACTGGG - Intronic
1104947608 12:132423574-132423596 GGCGGGGCGGACGGGGTCCGCGG + Intergenic
1105475005 13:20721526-20721548 GGAGGACAGGACAGTCCCCGAGG + Intronic
1105918802 13:24941589-24941611 GGGGGAGGGGAGGGGGCCCGGGG - Intergenic
1105964393 13:25371908-25371930 GGAGGAGCGGACGGGAGGCTGGG - Intergenic
1106128805 13:26922489-26922511 GGAGAAGGGGAAGGGCCTCGGGG - Intergenic
1110269180 13:73574268-73574290 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1111232572 13:85363153-85363175 GGAGGCGCGGGCGGGAGCCGGGG + Intergenic
1113924753 13:113935242-113935264 TGAGGAGCTGAAGGGCGCCGGGG - Intergenic
1114312237 14:21477628-21477650 GGAGGAGAGCACGGACTCCGGGG + Intronic
1115609551 14:35038534-35038556 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1116871642 14:50073949-50073971 GGAGGAGCGGACGGACCCCGCGG + Intergenic
1116945299 14:50830752-50830774 GGAGGAGGGGCCGGTCCCGGAGG - Intronic
1117297762 14:54394706-54394728 GGAGGCGCGGGCGGGAACCGAGG - Intergenic
1118760679 14:68878855-68878877 GCAGGAGAGGACGAGCCCCATGG + Intronic
1119478125 14:74942800-74942822 GGAGGAGGGGGCAGGCCCAGAGG + Intronic
1122405171 14:101496534-101496556 GGAGGAGCAAACAGGCCCGGCGG - Intergenic
1122531290 14:102429132-102429154 AGAGGAGCGGCCGGGCACAGTGG - Intronic
1122879375 14:104683200-104683222 GGAGGGGAGGAGGGGCCCTGGGG + Intergenic
1122964020 14:105112707-105112729 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1124363292 15:29054298-29054320 GGAGGAGTGGACGGACTCGGCGG + Exonic
1124640270 15:31392488-31392510 TGAGGAGCGCAGGGGACCCGGGG - Intronic
1125079042 15:35655554-35655576 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1125659007 15:41381922-41381944 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1129428275 15:75480795-75480817 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1131007248 15:88987999-88988021 GGAGGAGCAGGCAGGCCCCTGGG - Intergenic
1131119805 15:89814993-89815015 GGAGGAGCGGAGGAGCCCTGGGG - Intronic
1132671747 16:1104775-1104797 GGAGGAGGGGAGGGGCCCAGAGG + Intergenic
1132886155 16:2183072-2183094 GGAGGTGCGGCCGGGCGCGGTGG - Intronic
1133768244 16:8852618-8852640 GGAAGAGAGGACGGGCCTCGGGG - Intergenic
1134539566 16:15054105-15054127 GCAGGAGGGGAAGGGCCCAGTGG - Intronic
1134549435 16:15132249-15132271 GGAGGAGTGGAGGGGCTCAGCGG + Intronic
1134710868 16:16326467-16326489 GGAGGAGTGGAGGGGCTCAGCGG - Intergenic
1134833971 16:17346226-17346248 GGAGGTGAGAACGGGCCTCGTGG - Intronic
1134948733 16:18342178-18342200 GGAGGAGTGGAGGGGCTCAGCGG + Intergenic
1135691147 16:24539219-24539241 AGAGGAGCTGACGGGGCCTGTGG + Intronic
1136778732 16:32884756-32884778 GGAGGAGCGGGAGGGCTGCGAGG + Intergenic
1136891886 16:33976758-33976780 GGAGGAGCGGGAGGGCTGCGAGG - Intergenic
1137846686 16:51696618-51696640 GGAGGAGCAGATGGTCCCGGAGG + Intergenic
1139395126 16:66632707-66632729 GGAGGAAAGGAGGAGCCCCGTGG + Intronic
1139785017 16:69385762-69385784 GCAGTAGCGGGCGGGCCCGGCGG - Exonic
1139836022 16:69839202-69839224 TGTGGAGTGGACGGACCCCGTGG + Intronic
1140078636 16:71723955-71723977 GGCGGAGCCGGCGGGCCGCGGGG - Intronic
1141066357 16:80917047-80917069 GGAAGAGGGGCCGGGCACCGTGG - Intergenic
1203081149 16_KI270728v1_random:1146850-1146872 GGAGGAGCGGGAGGGCTGCGAGG + Intergenic
1142666650 17:1467456-1467478 TGAGGCGCGGGCGGCCCCCGGGG - Intronic
1143118629 17:4594159-4594181 GGAGGAGTGGCCGGGCGCGGTGG + Intronic
1144827731 17:18115787-18115809 GGAGGAGCAGACAGGCCAGGTGG - Intronic
1145205669 17:20984004-20984026 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1145936295 17:28716904-28716926 GGAGCACCGGACAGGCACCGTGG - Exonic
1147882530 17:43663171-43663193 GGAGGAGCCGAAGGGCACCCAGG + Intergenic
1147949905 17:44101468-44101490 GGAGGAGGGGAGGGGACCCAAGG + Intronic
1147963186 17:44180006-44180028 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1148110835 17:45144025-45144047 GGAGGAGTGAGCAGGCCCCGGGG + Exonic
1148168523 17:45501074-45501096 GTGGGAGCGCACGGGGCCCGCGG - Intergenic
1148280289 17:46341866-46341888 GTGGGAGCGCACGGGGCCCGCGG + Intronic
1148302517 17:46559803-46559825 GTGGGAGCGCACGGGGCCCGCGG + Intronic
1148443770 17:47725665-47725687 GGTGGAGCTGACGGGCCCAGGGG - Intergenic
1148562314 17:48613139-48613161 GGCGGCGCGGCCGGGACCCGCGG + Exonic
1149908729 17:60550838-60550860 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1150212013 17:63446665-63446687 GGGGGATGGGACGGGCCCCGAGG + Intergenic
1150399717 17:64847525-64847547 GTGGGAGCGCACGGGGCCCGCGG - Intergenic
1150685184 17:67314850-67314872 GTAGGATCGGATGGGCACCGTGG + Intergenic
1150830104 17:68511835-68511857 GGAGGAGGTGGCGGCCCCCGCGG - Intronic
1151314399 17:73312524-73312546 GGAGGAGCCGGCCAGCCCCGAGG + Intergenic
1151678182 17:75610527-75610549 AGGGGAGCGGACGGGGCCCAGGG - Intergenic
1152361967 17:79837008-79837030 GGAGGAGCAGCCGGGGCCCTTGG - Intronic
1152362404 17:79838906-79838928 GGGGGAGCGGACGGGAGGCGGGG - Intronic
1152590859 17:81211309-81211331 GCAGGAGAGGAAGGGCCCCATGG + Intronic
1152690554 17:81715965-81715987 GGAGGGGCGGGCGGGCCGAGGGG - Intronic
1152781328 17:82228608-82228630 GGAGGTGCGCGCGGGTCCCGTGG - Intronic
1153688452 18:7568093-7568115 GGCGGAGCGGACGGACCCCGAGG + Intronic
1154173612 18:12067790-12067812 GGAGGAGGGGATGGGAGCCGGGG + Intergenic
1155392736 18:25352349-25352371 GCAGGAGCGGGCGGGGCGCGCGG - Intergenic
1156448928 18:37255574-37255596 GGAGGTGGGGACGGGCCAGGAGG - Intronic
1157473578 18:48007846-48007868 GGAGGAGCGTCCGGGCCCCCAGG - Intergenic
1160550442 18:79691508-79691530 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550457 18:79691546-79691568 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550472 18:79691584-79691606 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550486 18:79691621-79691643 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550500 18:79691658-79691680 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550515 18:79691696-79691718 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550530 18:79691734-79691756 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550544 18:79691771-79691793 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550570 18:79691846-79691868 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550585 18:79691884-79691906 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550600 18:79691922-79691944 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550615 18:79691960-79691982 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550630 18:79691998-79692020 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550644 18:79692035-79692057 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550658 18:79692072-79692094 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160550684 18:79692147-79692169 GGAGGAGTGGACGGCTCCCAGGG + Intronic
1160560816 18:79754846-79754868 GGAGGAGGGGACGTGAGCCGAGG - Exonic
1160679638 19:406840-406862 GGAGGAGGAGAGGGGCCTCGGGG - Exonic
1160760624 19:782403-782425 GGAGGGGCGGAGTGGCCTCGAGG + Intergenic
1160825330 19:1077671-1077693 GGAGGAGTGGCCGGGCGCGGTGG - Intronic
1160867202 19:1261189-1261211 GGAAGAGGGGGCGAGCCCCGGGG + Intronic
1160948052 19:1652467-1652489 GGCCGCGCGCACGGGCCCCGCGG - Intronic
1160950829 19:1666491-1666513 GGAGGAGAGGCCGGGCGCGGTGG - Intergenic
1160968911 19:1758768-1758790 GGAGGGGCGGGCGGGCTCCTCGG + Intronic
1161022099 19:2015451-2015473 GGAGGAGGCGGCGGGCCCGGGGG - Exonic
1161063698 19:2227521-2227543 GGGGGAGCGGCCTGGCCCTGGGG + Intronic
1161288964 19:3482861-3482883 GGAGGGGCGGCGGGGCTCCGGGG + Intergenic
1161296454 19:3522880-3522902 GGAGGTGCAGGCGAGCCCCGTGG + Intronic
1161511675 19:4675622-4675644 GGAGAAGCGGCCAGGGCCCGCGG - Exonic
1161620166 19:5293332-5293354 GCTGCAGGGGACGGGCCCCGAGG + Intronic
1161920316 19:7260976-7260998 GGAGGATCGCATGGGCCCCGGGG - Intronic
1162886693 19:13702764-13702786 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1163547623 19:17949122-17949144 GGAGGGGATGACGGGGCCCGGGG - Intergenic
1163672638 19:18637563-18637585 GGAGGTGCTGAAGGGCCCCAAGG + Intronic
1163906086 19:20150720-20150742 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1164191910 19:22925511-22925533 GGAGGAGCGGACGGGCCCACGGG + Intergenic
1164522369 19:28989187-28989209 AGGGAAGCGGTCGGGCCCCGGGG - Intergenic
1164653339 19:29901713-29901735 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1165116767 19:33533421-33533443 GGAGCAGGGGACGGGGCCAGCGG - Intergenic
1165458053 19:35926296-35926318 GGAGGAGCTGAGGGGCCCAGTGG - Intergenic
1165488835 19:36111544-36111566 GTAGGGGCGGACAGGTCCCGAGG - Intronic
1165775617 19:38402969-38402991 GGCGGGGCGGGCGGGCCCCGGGG + Intergenic
1165903904 19:39181792-39181814 GGAGGTGAGGAGGGGCCCGGAGG + Intronic
1165956362 19:39504196-39504218 GTAGCAGAGGACGGGCCCCTGGG - Exonic
1166066957 19:40365821-40365843 GGAGGAGGGGGCGGGGCCTGTGG - Exonic
1166261439 19:41644234-41644256 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1166563321 19:43747789-43747811 GGAGGAGGGGAAGGGGCCTGTGG - Exonic
1166747935 19:45150852-45150874 GGTGGAGGGGACAGCCCCCGAGG - Exonic
1167001166 19:46746403-46746425 GGAGGAGCGAGCGGCCGCCGCGG - Exonic
1167080652 19:47274560-47274582 GGACGAGGGGGCGGGCTCCGAGG + Exonic
1167375308 19:49107942-49107964 GGAGGAGCGGAGGCGCTCCAGGG + Exonic
924988041 2:288633-288655 GGCGGAGCGCACGGGACGCGGGG + Intronic
925376200 2:3387997-3388019 CCAGTAGCGGAGGGGCCCCGAGG + Exonic
925590693 2:5506947-5506969 GGAGGAGTGGATGGGCCACGGGG - Intergenic
927146286 2:20168601-20168623 GATGGAGCGGCCGGGCCCCGAGG + Intergenic
927467968 2:23351157-23351179 AGTGGAGCTGATGGGCCCCGTGG - Intergenic
927809335 2:26173021-26173043 GGAGGAGGGGGCGGGGCCCGGGG + Intergenic
927809728 2:26174195-26174217 GGAGGGGCTGCCGGGCCCCACGG - Intronic
928087481 2:28355098-28355120 GGATGAGAGCACGGGCCCAGGGG + Intergenic
928549504 2:32357268-32357290 CGAGGAGCAGCCGGGGCCCGAGG - Exonic
928904500 2:36355855-36355877 GGAGGCGGGGACCGGCCCGGAGG + Intergenic
929614373 2:43296863-43296885 GGAGGAGCGGACGGGCCCCGCGG + Intronic
930046283 2:47175948-47175970 GGAGGAGCGCGCGGGGCCCTGGG - Intronic
930317090 2:49810959-49810981 AGAGGAGCGGCCGGGCGCGGTGG - Intergenic
932433395 2:71688709-71688731 GGAGCATCGGACTGGCCCGGCGG + Intergenic
932608099 2:73177580-73177602 CGAGGAGCTGAAGGGCCCGGCGG - Intergenic
934655915 2:96116760-96116782 GGGAGAGCGGAGGGGCCCGGCGG + Intergenic
934759279 2:96844572-96844594 GGAGGAGCGGGGGAGCCCGGGGG - Intronic
937919691 2:127120510-127120532 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
937996992 2:127701648-127701670 GGAGGAGTGGCTGGGCCGCGCGG + Exonic
938824695 2:134993161-134993183 GGAGGAGAGGCCAGGCCCAGTGG - Intronic
941119119 2:161507872-161507894 GGAGGCGCGGCCTGGGCCCGCGG - Intronic
942748663 2:179264447-179264469 GGAGAAGCGCGCAGGCCCCGCGG - Intronic
945084398 2:206116658-206116680 GGAGGAGCGCCTGGGCCCAGGGG + Intronic
945664168 2:212721089-212721111 GGTGGATGGGACTGGCCCCGCGG + Intergenic
947641428 2:231709629-231709651 GGGGGGGCGCCCGGGCCCCGTGG + Intronic
947846932 2:233251968-233251990 AGTGGGGCGGGCGGGCCCCGCGG + Intronic
948201296 2:236131231-236131253 GGAGGGTCGCACGGGTCCCGGGG + Exonic
949019669 2:241734274-241734296 GGAGGAGCGGGCCGGCCCCCAGG + Intergenic
1168757189 20:325817-325839 GGAGGGGCGGCCCCGCCCCGCGG - Exonic
1169135610 20:3195326-3195348 GGAGGAGAGGAAGGCCCGCGAGG - Exonic
1170425170 20:16228420-16228442 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1171823582 20:29876096-29876118 GGAGGACCGGAGGGGACCCCAGG + Intergenic
1172061534 20:32190179-32190201 GGACGCGCGCACGGTCCCCGCGG - Intergenic
1172320598 20:33993254-33993276 GGAGGGGAGGAGGGGCCCCGGGG - Intergenic
1172350061 20:34231347-34231369 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1172757314 20:37295119-37295141 GGAGGAGCTGAGAGGCCACGAGG - Intronic
1172864532 20:38085582-38085604 GGAGTAGCTGAGGAGCCCCGTGG + Intronic
1173617471 20:44412533-44412555 AGAGGAGAGGAAGGGCCCTGGGG + Intronic
1174604629 20:51751873-51751895 AGAGGAGCGGCCGGGCGCGGTGG - Intronic
1175030341 20:55947288-55947310 GGAGGAGGGGACGGGCGCGGTGG + Intergenic
1175231541 20:57476705-57476727 GGAAGCCCGGACGGGCCCAGAGG - Intergenic
1175466184 20:59192416-59192438 GGTGGAGCGCACGGGGCCCGGGG - Exonic
1175643356 20:60649760-60649782 TGAGGACCGGAAGGGCCGCGTGG - Intergenic
1176022864 20:62970986-62971008 GGAGGAGCGTCCAGGCCCCGTGG + Intergenic
1176030289 20:63008301-63008323 CCAGGAGCGCAGGGGCCCCGAGG + Intergenic
1176184549 20:63771219-63771241 AGAGGAGCCGGCGGCCCCCGGGG + Intronic
1177178638 21:17721124-17721146 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1179511430 21:41876634-41876656 TGAGGAGCGGACGTGGCCCCGGG + Intronic
1179906518 21:44425853-44425875 GGCGGAGTGGCCGGGCCCCTGGG + Intronic
1180790701 22:18574080-18574102 TGAGGAGGGGCTGGGCCCCGAGG - Intergenic
1181028147 22:20137394-20137416 GCAGGTGCAGAGGGGCCCCGAGG + Intronic
1181231036 22:21421234-21421256 TGAGGAGGGGCTGGGCCCCGAGG + Intronic
1181247612 22:21513634-21513656 TGAGGAGGGGCTGGGCCCCGAGG - Intergenic
1181648702 22:24247319-24247341 GGAGGAGGGAGCAGGCCCCGAGG + Intergenic
1182790887 22:32951883-32951905 GGAGGAGGGGAGGGGGCCCATGG - Intronic
1183172374 22:36197806-36197828 GGGGGAGGGGATGGGCCCAGAGG + Intronic
1183228156 22:36564300-36564322 GGAGGAGGGCGCGGTCCCCGGGG - Exonic
1183279604 22:36924814-36924836 GGAGGATGGGCAGGGCCCCGGGG - Intronic
1183429598 22:37757682-37757704 GGAGCAGCGGGCGGGCTCTGAGG + Exonic
1183460546 22:37947347-37947369 GGAGGTGGGGACGGGCTGCGAGG + Exonic
1183841637 22:40502724-40502746 GGAGAAGCAGACGGGCCCCGCGG - Intronic
1183845106 22:40536428-40536450 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1184444179 22:44537718-44537740 GGAGGAGTGGGCGGGCTCCAGGG - Intergenic
1184893684 22:47394619-47394641 GGAGGAGAAGACAGGCTCCGAGG + Intergenic
1185045778 22:48528082-48528104 GGAGGAGAGGACAGGCACCGGGG - Intronic
1185258521 22:49849340-49849362 GGAGACGGGGACCGGCCCCGCGG + Intergenic
1185282993 22:49983635-49983657 GGAGGAGGGGGCGGGCCCGGGGG - Intergenic
1185330298 22:50249265-50249287 GGGGGAGGGGAGGGGCCCAGGGG + Intronic
1185332261 22:50257067-50257089 GGCTGAGGGTACGGGCCCCGGGG - Exonic
1185367442 22:50443400-50443422 CGAGCAGCAGACGGGCCCCCTGG - Intronic
1185418260 22:50721379-50721401 GGAGGAGCGGAAGTCACCCGAGG + Intergenic
950253869 3:11488317-11488339 GGAGGAGCGGACGGACCCCGCGG - Intronic
950696672 3:14706056-14706078 GGAGGAGAGGACGGGTCTCTGGG + Intronic
950729806 3:14947706-14947728 GGTGGCGGGGACGGGCCCGGGGG - Intronic
951013737 3:17705918-17705940 GGAGGAGCGGACGGGCCCCGCGG - Intronic
952888284 3:38024933-38024955 CGAGGAGGTGCCGGGCCCCGCGG + Intronic
954080521 3:48210852-48210874 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
954448000 3:50557011-50557033 GCAGGAGCGGATGGGCACTGGGG + Intergenic
954796024 3:53161688-53161710 GGAGGGACGGACGGGCCCCTCGG - Intronic
955297221 3:57746946-57746968 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
956270210 3:67443375-67443397 GGAGGAGCGGACGGGCCCCGCGG + Intronic
956392221 3:68785624-68785646 AGAGGTGCGGACGGGAACCGGGG - Intronic
957270973 3:78029934-78029956 GGAGGCGCAGACGGGAACCGGGG + Intergenic
959042496 3:101438857-101438879 GGAGGAGCGGACGGGCCCCGCGG + Intronic
959419592 3:106112645-106112667 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
961356457 3:126343010-126343032 GGAGGAGGGGACGAGCCCCTGGG + Exonic
961402104 3:126654844-126654866 GGACGAGCGGCTGGGCCCGGGGG + Intronic
961574724 3:127824843-127824865 GGAGGAGAGGCCGGGCTCAGTGG + Intergenic
963437702 3:145292010-145292032 GAAAGAGCGGCCGGGCACCGTGG - Intergenic
966359450 3:179119481-179119503 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
967281572 3:187828591-187828613 GGAGCACTGGACGGGCCCCTGGG + Intergenic
968454027 4:688290-688312 GGAGGAGGGGAGAGGCCCCGGGG + Intronic
968831487 4:2934664-2934686 GGGGGAGGAGACGGGACCCGGGG - Intronic
979539926 4:121869975-121869997 GGAGGAGGAGAAGGGCCCTGGGG + Intronic
980328424 4:131379370-131379392 GGAGGCGCGGGCGGGAGCCGAGG + Intergenic
982616104 4:157637765-157637787 GGAGGAGCGGACGGCCCCGCGGG - Intergenic
985062404 4:186092447-186092469 AGAGGAGCGCACCAGCCCCGTGG + Intergenic
985067574 4:186138511-186138533 GGAGGAGAGGAAGGGCACTGGGG - Intronic
985944237 5:3164142-3164164 GGAGGATGGCACAGGCCCCGAGG - Intergenic
985994841 5:3592221-3592243 GGAGGAGAGGAAAGGCCCAGAGG - Intergenic
986717281 5:10533445-10533467 AGAGGAGGGGAGGGGACCCGGGG - Intergenic
987057666 5:14210126-14210148 GGAGGAGCGGTCGGCCCCTTTGG + Intronic
987100701 5:14588970-14588992 GGAGGAGAGAACGGACCCTGGGG + Intronic
987820603 5:22961502-22961524 GGAGGAGAGGCTGGGCCCGGTGG - Intergenic
991371543 5:65925498-65925520 GGAGCAGCGGGCAGGCCTCGAGG + Intergenic
991772418 5:70052253-70052275 GGAGGATCGGCCGGGCGCTGTGG + Intronic
991851711 5:70927672-70927694 GGAGGATCGGCCGGGCGCTGTGG + Intronic
992371175 5:76145759-76145781 GGAGGAGAGGAGGGGCCACTTGG - Intronic
992373715 5:76171064-76171086 GGAGGAGCGGACGGGCCCCGCGG + Intronic
992487423 5:77210371-77210393 GGAGGGGCGGAGGGGCGCAGTGG + Intergenic
993459033 5:88160465-88160487 TGAGGAGCGGCCGGGCGCAGTGG + Intergenic
997736373 5:136215533-136215555 GGAGGAGGGGCCGGGCGCAGTGG + Intronic
1000985242 5:167858834-167858856 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1001549497 5:172593033-172593055 GCAGGAGCGGTCTGGGCCCGAGG + Intergenic
1001931380 5:175675559-175675581 AGAGGAGAGGATGGGCCCTGAGG + Intronic
1002341417 5:178518814-178518836 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1002843722 6:927323-927345 TGAGGAACGGGAGGGCCCCGGGG + Intergenic
1002879477 6:1238432-1238454 GGGGGAGAGGAGGGACCCCGGGG + Intergenic
1002888193 6:1313475-1313497 GGAGGAGCGCGCCAGCCCCGCGG + Exonic
1003395463 6:5749117-5749139 GGAGGAGAGGACTGGGCCCGTGG - Intronic
1003592832 6:7450004-7450026 GGAGGAGCTGCCGGGCGCAGTGG - Intergenic
1003645369 6:7910116-7910138 GGAGGAGGGGGCGGACCCCTAGG - Intronic
1004387943 6:15188451-15188473 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1006492125 6:34396984-34397006 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1006642831 6:35497427-35497449 GCCGGAGCGCACGGGCCCCGGGG + Intergenic
1006841057 6:37028070-37028092 GGAGGAGCTGAAGGGCCGCTGGG + Exonic
1007674433 6:43581564-43581586 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1007918699 6:45586564-45586586 GGAGGGGCGGGAGGGCCCCCTGG + Intronic
1010002000 6:70957186-70957208 GGAGGCGCGGAGGGACCCCTTGG + Intergenic
1011405428 6:87010819-87010841 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1012410237 6:98948000-98948022 GGAGGAGGGGCGGGGCCGCGGGG + Intronic
1013225722 6:108118428-108118450 GCAAGCGCGGACGGGCTCCGTGG - Intronic
1015476534 6:133664294-133664316 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1017820844 6:158048200-158048222 GGAGGAAGGGAGAGGCCCCGGGG + Intronic
1018374517 6:163198556-163198578 GGTGGATCGGATGGGCACCGAGG + Intronic
1018582173 6:165316941-165316963 GAAGGAGCGGACAGCTCCCGGGG - Intergenic
1019190392 6:170247507-170247529 GGAGCAGCCGCCGGGCCCCTGGG - Intergenic
1019481569 7:1269481-1269503 GCAGGAGGGGACCGGCTCCGGGG - Intergenic
1019656313 7:2197961-2197983 GGAGGGGCTGATGGGCCCTGTGG - Intronic
1020079146 7:5277265-5277287 GGAGGAGAGGCCGGGCACAGTGG - Intronic
1020106976 7:5426723-5426745 GGGGGCGCGGGCGGGCCACGCGG + Intergenic
1020616633 7:10466439-10466461 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1021116741 7:16753617-16753639 GGAGGGGCGGAGCGGTCCCGGGG - Exonic
1021872143 7:25017959-25017981 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1022028759 7:26472327-26472349 GGAGGAGAGGACAGGCGCGGTGG - Intergenic
1022300354 7:29097062-29097084 GGAGGAGCAGACAGCCCCAGGGG + Intronic
1023030284 7:36084930-36084952 GGAGAAGGGGTCGGGCCCAGGGG - Exonic
1023850267 7:44146269-44146291 GGGGGAGTGGGCGGGGCCCGAGG - Intronic
1024243235 7:47451215-47451237 GGAGCAGCGCACAGGCCCTGGGG - Intronic
1024676005 7:51638432-51638454 GGAGGAGCAGACGGGGCAGGAGG + Intergenic
1025199747 7:56954920-56954942 GGAGGAGAGGCCGGGCACAGTGG + Intergenic
1025672198 7:63622014-63622036 GGAGGAGAGGCCGGGCACAGTGG - Intergenic
1026805814 7:73429234-73429256 GGAGGACCGGAGGGGCCGGGAGG - Intergenic
1027126404 7:75559696-75559718 GGGGGCGGGGGCGGGCCCCGGGG - Intronic
1027320212 7:77005971-77005993 GGAGGAGCGGGTGGGCACCTTGG + Intergenic
1027674436 7:81141750-81141772 AGAGGAGCGGGCGGGAACCGGGG + Intergenic
1027774223 7:82444101-82444123 GGCGGAGCGGACCAGCCCCGCGG + Intergenic
1031008397 7:116499577-116499599 GGAGGGGCGGCGGGGCGCCGGGG + Exonic
1031966554 7:128031660-128031682 GGAGGAGCGCGCGGCGCCCGCGG + Intronic
1032194200 7:129780258-129780280 CGAGGGGCGGGCGGGGCCCGGGG - Intergenic
1033265298 7:139880507-139880529 GAAGGAGCAGATGGGCCCCAGGG - Intronic
1034417975 7:150975135-150975157 GGAGGAGGGGGCGCGCCGCGCGG - Intronic
1035386299 7:158475227-158475249 GGAGGCCCCGAAGGGCCCCGAGG + Intronic
1035508110 8:150601-150623 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1035663527 8:1364196-1364218 GGAGGGGCGGACGGTGCCCCCGG + Intergenic
1036536875 8:9658312-9658334 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1037969707 8:23163590-23163612 GCAGGAGCGACCGGGCCGCGAGG - Intronic
1038296033 8:26291680-26291702 GGGGGAGGGGACGGGGGCCGGGG - Intronic
1039383256 8:37105999-37106021 GGAGGAGCAGCCGGGCACGGTGG - Intergenic
1039608396 8:38901124-38901146 GGGGGTGCGGCCGGGCGCCGGGG - Intergenic
1040065439 8:43140795-43140817 GGTGCTGCGGCCGGGCCCCGCGG + Intronic
1042048814 8:64685189-64685211 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1042213280 8:66403051-66403073 AGAGGAGAGGATGGGCCCCTTGG - Intergenic
1043857149 8:85276154-85276176 GGAGCGGCGGGCCGGCCCCGCGG + Intronic
1044302914 8:90606454-90606476 GGAGGCGCGGGCGGGAGCCGGGG - Intergenic
1044660465 8:94590219-94590241 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1047687119 8:127315885-127315907 GGAGGAGCGGAAGGGCCCCGCGG + Intergenic
1047739612 8:127796005-127796027 GGAGGTGAGGACGTGCCTCGTGG + Intergenic
1047848272 8:128827138-128827160 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1049324942 8:142016962-142016984 GGAGGAGAACAAGGGCCCCGGGG + Intergenic
1049668432 8:143859078-143859100 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049668851 8:143860686-143860708 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049669266 8:143862288-143862310 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049669678 8:143863881-143863903 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049670093 8:143865489-143865511 GGAGCTGCGGCCGGGCCCCGGGG + Exonic
1049745473 8:144261362-144261384 GGCCCAGCGGAGGGGCCCCGTGG - Intronic
1050357108 9:4793396-4793418 GGAGGCGGGGTCGGGGCCCGAGG + Intronic
1052894147 9:33731705-33731727 GGAGGTGTGGAGGGGCCCAGGGG - Intergenic
1053216216 9:36272781-36272803 GGAGAAGGGGCCGGGCCCAGTGG + Intronic
1053256038 9:36616026-36616048 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1053457068 9:38241555-38241577 GGAGGAGCGGACGGGCCCCGCGG + Intergenic
1053586468 9:39464234-39464256 GTAGGGGCTGCCGGGCCCCGCGG - Intergenic
1053749142 9:41235562-41235584 GGAGGACCGGAGGGGACCCCGGG - Intergenic
1054254580 9:62800415-62800437 GGAGGACCGGAGGGGACCCCAGG - Intergenic
1054336723 9:63815187-63815209 GGAGGACCGGAGGGGACCCCAGG + Intergenic
1054579838 9:66900999-66901021 GTAGGGGCTGCCGGGCCCCGCGG + Intronic
1057758087 9:97853119-97853141 GGAGGTGCGCCCGGGCCCCGGGG + Intergenic
1057996716 9:99825745-99825767 GGAGGAGCGGACGTCCGGCGAGG - Exonic
1059210860 9:112513715-112513737 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1060064779 9:120495068-120495090 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1060892090 9:127195393-127195415 GGAGGAGCTGAGGGGCACTGTGG + Intronic
1061129913 9:128702952-128702974 GGAGGGGCGCGCGGGCCCGGGGG + Intronic
1061293530 9:129665590-129665612 GGAGGAGAGGACGGGGGGCGAGG + Intergenic
1061824436 9:133248956-133248978 GGAGCTGCGGAAGGGCCCAGTGG - Intergenic
1061984091 9:134119054-134119076 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1062115432 9:134805804-134805826 GGAGGAGAGGGGGTGCCCCGTGG + Intronic
1062214544 9:135382183-135382205 GGAGGAGGAGAGGGGCCCTGCGG - Intergenic
1062346275 9:136116808-136116830 GGAGGCGCGCACGGGCCCGCAGG + Exonic
1062472422 9:136712394-136712416 TGAGGAGGGGGCGGGCACCGAGG - Intergenic
1062504510 9:136866145-136866167 TGAGGAGCGGCCGGGCCGGGCGG - Intronic
1062526285 9:136979261-136979283 GTAGGAGCCGAGGGACCCCGCGG - Exonic
1062550943 9:137086308-137086330 GGCGCAGCGCTCGGGCCCCGGGG + Intergenic
1203376653 Un_KI270442v1:382612-382634 GGAGGACCGGAGGGGACCCCAGG + Intergenic
1187976696 X:24710061-24710083 GGAGGAGCGGACGGGCCCCACGG - Intronic
1191618312 X:63190327-63190349 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1191866233 X:65706094-65706116 GGAGGAGCAGAATGGCCCCTAGG + Intronic
1192575133 X:72237669-72237691 GGAGGATCGCATGAGCCCCGGGG + Intronic
1192621080 X:72680849-72680871 GGAGGAGCGGACGGGCCCCGCGG + Intronic
1192952506 X:76032189-76032211 GGAGGAGAAGAGGGGCCCAGAGG + Intergenic
1195036321 X:100973385-100973407 GGAGGAGCGGACGGGCCCCGCGG - Intronic
1196031070 X:111096294-111096316 GGGGGAGCGGGCTGGGCCCGGGG + Intronic
1196404615 X:115348261-115348283 GGAGGAGCGGACGGGCCCCGCGG - Intergenic
1196886513 X:120251136-120251158 GAAGGAGGGGACGAGCCGCGAGG + Intronic
1200057607 X:153469914-153469936 GGAGGAGCGAGCGGGCCGAGGGG + Intronic
1200084911 X:153599237-153599259 GGAGGAGCGGCGGGGCGGCGAGG - Intronic
1200101081 X:153689285-153689307 GGAGGGGCGGGAGGGCCGCGAGG - Intronic