ID: 959419593

View in Genome Browser
Species Human (GRCh38)
Location 3:106112653-106112675
Sequence CAGCGGCTGGAGGAGCGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 68, 1: 1, 2: 3, 3: 34, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419593_959419607 7 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG 0: 68
1: 1
2: 3
3: 34
4: 289
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419593_959419601 -1 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG 0: 68
1: 1
2: 3
3: 34
4: 289
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419593_959419605 4 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG 0: 68
1: 1
2: 3
3: 34
4: 289
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419593 Original CRISPR CAGCGGCTGGAGGAGCGGAC GGG (reversed) Intergenic
900589857 1:3454726-3454748 AAGCGGCTGCAGGACAGGACAGG + Exonic
900643063 1:3696499-3696521 CAGCGGCTGGAGCTGAGCACTGG + Intronic
900647269 1:3714605-3714627 CAGAGGCCGGAGGAGAGGCCAGG + Intronic
900956651 1:5890076-5890098 CAGCAGCTGCTGGAGAGGACAGG + Intronic
901234909 1:7662594-7662616 CCGGGGCTGGAGGAGCTGCCAGG + Intronic
901457843 1:9373655-9373677 CAGGGGCTGGGGGAGGGGAATGG - Intergenic
901745407 1:11369813-11369835 GGGCGGGTGGAGGAGCGGACAGG + Intergenic
901817226 1:11801217-11801239 CAGCGCCTGGAGGAGATCACGGG - Exonic
902870784 1:19312434-19312456 CAGCGGCCGGAGGAGAGGGCTGG - Exonic
903257857 1:22114699-22114721 CTGCTGCGGGAGGAGGGGACTGG - Intergenic
903526497 1:23994986-23995008 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
903923422 1:26817426-26817448 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
904300356 1:29549953-29549975 CAGAGGCTGGAGGTGGGGCCTGG + Intergenic
904457868 1:30658103-30658125 CAGAGGCTGGAGGTGGGGCCTGG - Intergenic
904794823 1:33051296-33051318 CAGCGGCTGGAGGAGCGGACGGG + Intronic
905425737 1:37882771-37882793 CAGCTGCTGGAAGAGGGCACAGG + Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906199071 1:43947604-43947626 GAGCGGCGGGAGGAGCAGCCGGG + Exonic
906293043 1:44632169-44632191 GAGCGGCCGGAGGAGCAGAGGGG + Intronic
906436927 1:45804022-45804044 CAGCGGCTGGAGGAGCGGACGGG + Exonic
906477341 1:46178522-46178544 TAGAGGCTGGAGGAGGGGATGGG - Intronic
906486653 1:46240457-46240479 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
907440296 1:54474758-54474780 CAGCGGCCGGAGACCCGGACGGG - Intergenic
907453918 1:54563086-54563108 CAGCGGCTGGAGGAGCGGACGGG - Intronic
912409047 1:109467089-109467111 CGGCGGCTGGAGGAGCCGCTGGG + Exonic
912430598 1:109626533-109626555 CAGCAGCTGGAGGGGCGGAGGGG + Intronic
912659556 1:111515747-111515769 CTGCGGCTGGTGGAGGGGGCGGG + Intronic
912825481 1:112899336-112899358 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
912844663 1:113068769-113068791 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
915341666 1:155179787-155179809 CAGCGGCGGGAGGAGGTGAGGGG + Exonic
915943876 1:160136001-160136023 CAGGAGGTGGAGGAGGGGACAGG + Intronic
917444221 1:175093160-175093182 AAGCGGCTGGAGGGGAGGCCAGG - Intronic
920670245 1:207998602-207998624 CAGAGGCTGGAAGAGCAGCCAGG - Intergenic
920740487 1:208577104-208577126 CAGCATTTGGAGGAGCGGAAGGG + Intergenic
921414443 1:214870442-214870464 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1062932801 10:1363785-1363807 CGGCCGCTGGAGGAGGGGAATGG - Exonic
1063119146 10:3092511-3092533 GAGCAGCTGGGGGAGAGGACTGG + Intronic
1063128311 10:3154835-3154857 CAGCCGCTGGGGGAGCAGCCGGG - Intronic
1063857885 10:10275075-10275097 CAGGGTCTGGAGAAGTGGACAGG - Intergenic
1064950505 10:20843954-20843976 CAGTGGCAGGAGGAGAGGATGGG - Intronic
1065335695 10:24655530-24655552 TCGCGGCTGGAGGAGCGGACGGG + Intronic
1066275311 10:33862930-33862952 CAGCGGCTGGTGCTGCTGACAGG - Intergenic
1066442545 10:35451819-35451841 CAGGGGCAGGGGGAGCGGTCAGG + Intronic
1066491302 10:35897832-35897854 CAGGACCTGGAGGAGCCGACAGG - Intergenic
1067227241 10:44384264-44384286 CAGCGGCTGGACGCGCGCCCAGG + Intronic
1070318252 10:75334217-75334239 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1071455939 10:85851739-85851761 CAGCTGCTAGAGGAGCCGACTGG - Intronic
1072150170 10:92676005-92676027 GTGGGGCTGGAGGAGCGGACGGG - Intergenic
1072950123 10:99840145-99840167 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1073036909 10:100570211-100570233 CAGGCCCTGGAGGAGCGGGCCGG + Intergenic
1075384049 10:122041774-122041796 CAGGGGCTGTGGGAGCAGACAGG - Intronic
1076159801 10:128234943-128234965 CTGGGGCTGCAGGAGAGGACAGG + Intergenic
1076592004 10:131589886-131589908 CAGCTGCTGGGGGAGGGGCCTGG + Intergenic
1077119434 11:899975-899997 CAGAGGCTGGAGCAGCACACAGG + Intronic
1077273859 11:1694218-1694240 ATGCGGCTGGAGGAGCGCAGCGG - Intergenic
1078537631 11:12187663-12187685 CAGCTGCTGGTGGAGGTGACTGG + Intronic
1081470815 11:43368833-43368855 CTGAGGCTGGAGGAGAAGACAGG - Intronic
1081784952 11:45739194-45739216 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083894487 11:65613386-65613408 CTGCGGCTGGAGGAGGTGATCGG - Exonic
1084529200 11:69717158-69717180 CAGAGGGTTGAGGAGCTGACGGG - Intergenic
1084693326 11:70739439-70739461 CAGGGGCAAGAGGAGAGGACGGG - Intronic
1088897809 11:114091393-114091415 CAGGGGGTGGAGGAGAGGAAGGG - Intronic
1089292739 11:117448104-117448126 CATCAGCAGGAGGAGGGGACGGG + Intronic
1089757405 11:120696712-120696734 CAGCGGCAGCAGGGGTGGACCGG + Intronic
1089793583 11:120962339-120962361 CAGCGGGTGGAGAAGCAGAAGGG + Intronic
1090991407 11:131820184-131820206 CAGTGGCTGCAGGAGAGGAGGGG - Intronic
1091596718 12:1883417-1883439 CAGAGGAAGGAGGAGCGGAGAGG - Intronic
1091762442 12:3096015-3096037 CAGCGGCTGGAGGAGCGGACAGG - Intronic
1091973792 12:4809619-4809641 GAGCGGCTGGAGGAGCGCAGTGG + Exonic
1095439346 12:42227155-42227177 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1096022483 12:48333783-48333805 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1096073689 12:48789274-48789296 AAGCGGCCGGAGGAGAGGAGGGG - Intergenic
1096409290 12:51365501-51365523 GTGCGGCAGGAGGAGCGGAAGGG - Exonic
1097070565 12:56351391-56351413 CAGCTGCTGAAGGAGCTGAAGGG - Exonic
1098573195 12:72012248-72012270 CAGGGTCTGGTGGAGAGGACAGG + Intronic
1100452368 12:94719808-94719830 CAGAGGCTGGGGGTGGGGACGGG + Intergenic
1102226370 12:111231204-111231226 CAGGGGCTGGGGGAGAGGAATGG - Intronic
1102578391 12:113871841-113871863 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1102952746 12:117041151-117041173 CAGAGGCTGGAGGAGCCATCAGG + Intronic
1103748312 12:123141374-123141396 CAGTGGCTGGAGGTGCAGAGGGG - Intronic
1103991335 12:124801280-124801302 CAGGGGCTGGGGGAGGGGGCGGG + Intronic
1104450544 12:128864965-128864987 CAGAGGCTGGAGGAGAGGGAAGG + Intronic
1104977307 12:132557928-132557950 CAGGGCCTGGAAGAGGGGACTGG + Intronic
1105964396 13:25371916-25371938 CCGCGGGAGGAGGAGCGGACGGG - Intergenic
1106036700 13:26050910-26050932 CAGCAGCTGCAGGAGCGAAGCGG + Exonic
1106232584 13:27832660-27832682 CAGGGGCTGGAGGAGGTGGCGGG + Intergenic
1106406654 13:29480515-29480537 CAGTGGCTGGAGGAGAAGAGAGG - Intronic
1110269179 13:73574260-73574282 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1110554667 13:76844974-76844996 CAGAGGCTGGAGGATGGGAATGG + Intergenic
1112402103 13:99086433-99086455 GAGCGGCGGGCGGAGCGGGCCGG - Intronic
1113659777 13:112097992-112098014 CCACGGCTTGAGGAGCCGACAGG - Intergenic
1114477442 14:23006898-23006920 GAGCGGCCGGAGGAGCGGCTAGG + Intronic
1115399312 14:32939397-32939419 CGGCGGCGGGAGCAGCGGCCCGG - Intronic
1115609550 14:35038526-35038548 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1115795765 14:36933707-36933729 CTGGGGCTGGAGGAGGGGGCTGG - Intronic
1116949862 14:50869821-50869843 CAGGGGCTGGAGGTGGGGAGGGG - Intronic
1118227029 14:63911210-63911232 CTGCTGCTGGAGGAGGGGCCGGG - Intronic
1119898810 14:78243057-78243079 CAGAGCCCGGAGGAGCAGACAGG - Intronic
1120824866 14:88945860-88945882 CAGAGGGTGGAGGAGAGGCCTGG + Intergenic
1121368078 14:93332820-93332842 CAGCGGCGGGAGGAGCCTCCGGG - Exonic
1121417479 14:93788956-93788978 CAGCGGCGGGAGGCGCCGGCAGG + Intergenic
1121790183 14:96693399-96693421 GAGCGGCTGGAGCAGTGGAGGGG + Intergenic
1121870204 14:97400350-97400372 CATGGCCTGGAGGAGAGGACTGG - Intergenic
1122062865 14:99148375-99148397 GAGCGGCTGGAGAGGCTGACAGG - Intergenic
1122231011 14:100306338-100306360 CCGCGCCAGGAGGAGCGGCCAGG - Exonic
1122323291 14:100868034-100868056 CAGTGGCTGGGGGAGCTGAGGGG - Intergenic
1122538943 14:102485982-102486004 CAGGGGCTGGTGGAGCCAACTGG - Intronic
1122964021 14:105112715-105112737 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1123149536 14:106167532-106167554 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123173043 14:106391879-106391901 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123582010 15:21724198-21724220 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123618657 15:22166794-22166816 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1124781599 15:32641646-32641668 CACCTGCTGGAGGAGGGGCCGGG + Intergenic
1125079041 15:35655546-35655568 GAGCGGCTGGAGGAGCGGACGGG + Intergenic
1125659006 15:41381914-41381936 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1128261607 15:66236741-66236763 CAGGGGCAGGAGGTGGGGACAGG - Intronic
1129428274 15:75480787-75480809 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1130115228 15:81000702-81000724 GAGAGACTGGGGGAGCGGACAGG - Intergenic
1132012722 15:98290231-98290253 CAGTGGCTGGAGGAGGGGGAGGG + Intergenic
1132079295 15:98851266-98851288 CAGATGCTGGAGGAGAGGGCTGG + Intronic
1132566996 16:628120-628142 CAGAGGCCGGGGGAGCAGACAGG + Exonic
1133031357 16:3012776-3012798 CAGCGGATGGATGAGGGGCCTGG - Exonic
1133225514 16:4338620-4338642 CAGTGGCTGGAGGAGGGTGCTGG + Exonic
1133228017 16:4351965-4351987 CAGGGGCTGGGGGAGGGGGCTGG - Intronic
1133253316 16:4499492-4499514 CAGCGGCTGGGGGAAGGGAAGGG + Intronic
1133280839 16:4664345-4664367 CGGGGGCTGGAGGAGGGGATGGG + Intronic
1133771425 16:8868974-8868996 AAGCGGCTGGCGGAGCAGAACGG - Intronic
1136680521 16:31959253-31959275 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1136780862 16:32900799-32900821 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1137235794 16:46616515-46616537 TGGCAGCTGGAGGAGCGGAAAGG + Intronic
1137569741 16:49557628-49557650 CTGGGGCTGGAGGAGCTGCCAGG + Intronic
1139489518 16:67279071-67279093 CCGCGGCTGAATGAGCCGACGGG - Exonic
1140820493 16:78658566-78658588 CAGAGGCTGGAGGAGAGGCACGG - Intronic
1141125391 16:81397384-81397406 CAGAGGCTGGAGCAGGGCACAGG + Intergenic
1142176915 16:88649713-88649735 CGGCAGCTGGAGGAGGGGGCCGG + Intronic
1142272367 16:89096801-89096823 CACGGGCAGGAGGAACGGACGGG - Intronic
1203083514 16_KI270728v1_random:1164828-1164850 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1143712048 17:8741947-8741969 CTGGGGCTGGAGGGGCAGACAGG + Intronic
1144705046 17:17362699-17362721 CAGGGCCTGGGGGAGGGGACAGG - Intergenic
1144775327 17:17782231-17782253 CCTCGGCTGGTGGAGCGGGCGGG + Intronic
1144827733 17:18115795-18115817 AAGCAGGTGGAGGAGCAGACAGG - Intronic
1145205668 17:20983996-20984018 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1146428240 17:32764255-32764277 CAGAGGCTAGAGGAGCGGGGTGG + Intronic
1147686951 17:42291878-42291900 CAGAGGCTGAAGGAGAGGAAGGG + Intronic
1147780073 17:42934823-42934845 CAGGGGCTGGAGGGGCTGAGTGG - Intergenic
1147963185 17:44179998-44180020 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1148069930 17:44902734-44902756 CAGGGTCTGGAGGAGCAGTCTGG + Exonic
1149541583 17:57471857-57471879 CAGCATCTGGAGGAGAGGAGAGG + Intronic
1149908728 17:60550830-60550852 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1150246080 17:63676336-63676358 CAGCTGATGAAGGAGGGGACAGG + Intronic
1151370328 17:73643464-73643486 CAGCGGCTGGCCGAGCAGCCAGG + Intronic
1151715304 17:75828050-75828072 CAGCTGCTGGAGGGCCGGAAGGG - Exonic
1152724114 17:81936913-81936935 CGGCTGCGGGAGGAGCGGCCAGG - Intronic
1153457370 18:5295728-5295750 CGGCGGCTGGCGGGGCGGCCCGG - Intronic
1153480688 18:5543659-5543681 CCGCGGCGGGCGGAGCGGGCGGG + Intronic
1156384793 18:36595289-36595311 CAGGGGATGGAGGAGAGGAAGGG - Intronic
1157225059 18:45855242-45855264 CAGGGGCTGGAGCTGGGGACTGG - Intronic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1158648903 18:59269401-59269423 GAGCGGCTGAAGGAGAGGAGGGG + Exonic
1159204879 18:65236517-65236539 CAGCGTCTTCAGGAGCAGACAGG - Intergenic
1160526186 18:79539526-79539548 CAGCTGCTGGAGGAGGGGGCAGG - Intergenic
1160703604 19:519143-519165 CAGCAGCTGGAAGAGCGCGCCGG - Exonic
1160734481 19:656026-656048 CAGGGCCTGGGGGAGGGGACGGG + Intronic
1160747805 19:720067-720089 CTGCGGCTGGGGGAGGGGAGGGG - Intronic
1160814460 19:1028726-1028748 CAGCGGCTGGGGGTGGGGCCAGG + Intronic
1160966857 19:1750495-1750517 CCGCGGGTGGAGGGGAGGACTGG - Intergenic
1160971523 19:1769873-1769895 CAGAGGCTGGGGGAGGGGCCGGG - Intronic
1161409869 19:4111122-4111144 CGGGGGCTGGAGGAGGGGATGGG + Intronic
1162886692 19:13702756-13702778 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1163280556 19:16314140-16314162 CAGGGGCTGGGGGAGGGGAGTGG + Intergenic
1163285001 19:16341000-16341022 CAGGGGCTGGGGGAGGGGAATGG + Intergenic
1163393599 19:17045818-17045840 CAGGGGCTGGGGTAGAGGACTGG - Intergenic
1163566363 19:18054010-18054032 CAGGGGCTGGGGGAGGGGAACGG + Intergenic
1163690142 19:18734162-18734184 CAGGGGCTGGGGGAGGGGAATGG + Intronic
1163718677 19:18887339-18887361 CAGGGGCTGGGGGAGAGGACTGG + Intronic
1163832621 19:19554334-19554356 CACCGGCTGGCGGTGAGGACGGG + Intergenic
1163906087 19:20150728-20150750 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1164191908 19:22925503-22925525 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1164578111 19:29417876-29417898 CAGCGGCTGGAGGAGGCGAGGGG - Intergenic
1164653340 19:29901721-29901743 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1165595981 19:37011580-37011602 CACCTGCTGGAGGAGCGGAGAGG - Intronic
1165702711 19:37950702-37950724 CAGCGGAGGGAGCAGCAGACGGG - Intronic
1165844991 19:38812514-38812536 CAGCGTCTGGAGAAGAGGCCTGG + Exonic
1166261438 19:41644226-41644248 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1166375449 19:42324720-42324742 CAGGGGCTGAGGGAGGGGACGGG - Exonic
1166768545 19:45266467-45266489 CAGCAGATGGGGGAGCGGATGGG + Intronic
1166836235 19:45669528-45669550 CAGCAGCTGCAGGATCGGAGAGG - Exonic
1166871320 19:45872758-45872780 CAGGGGCTGGAGGCGGGGGCTGG - Exonic
1166988124 19:46674497-46674519 CAGCAGCTGGACGAGGGCACAGG + Exonic
1167212203 19:48140138-48140160 CGGAGCCTGGAGGAGGGGACGGG + Exonic
1167611925 19:50511840-50511862 CAGTGGTGGGAGGAGGGGACAGG + Intronic
1167729839 19:51245697-51245719 CAGGGGCTGGGAGAGGGGACAGG - Intergenic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
1168401082 19:56086774-56086796 CAGGGGCTGGGGGAGAGGGCGGG - Intergenic
925206997 2:2015416-2015438 CAGCTGCGGGAGGAGCTGCCTGG - Intronic
926212196 2:10879296-10879318 CAGCAGCTGGAGGAGCAGGAAGG - Intergenic
927214003 2:20655986-20656008 CAGTGGGTGGAGGAGGGGACAGG + Intergenic
927882753 2:26700213-26700235 CAGAGGCTGGCGGAGGGGTCAGG - Intronic
927990248 2:27442390-27442412 CTGCGGCTGGCGCGGCGGACGGG + Exonic
928033557 2:27801131-27801153 CAGAGGCTGGAGGACGGGGCAGG + Intronic
929614372 2:43296855-43296877 CAGCGGCTGGAGGAGCGGACGGG + Intronic
932749035 2:74359301-74359323 GAGAGGCTGGAGAGGCGGACAGG + Intronic
934588247 2:95525321-95525343 CAGCGGCCGGAGGCGTGGGCTGG - Intergenic
935112313 2:100104783-100104805 CGGCGGCTGCAGCAGCGGGCCGG - Intronic
935590598 2:104843421-104843443 CAGCGGCTGGAGGAGGCCTCGGG + Intergenic
936370454 2:111898513-111898535 CCGGGGCTGGAGGAGAGGAGCGG - Exonic
936545986 2:113393797-113393819 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
937634151 2:124137084-124137106 CATAGGCTGGAGGAGAAGACAGG - Intronic
937919692 2:127120518-127120540 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
938900717 2:135796720-135796742 CAGCAGCTTGAGGAGCCGAATGG + Intronic
941110385 2:161414680-161414702 CCCGGGCTGGAGGAGCGGCCTGG - Intergenic
942125986 2:172826071-172826093 CAACGGCTAGAGGAGTGGAAGGG - Intronic
942292653 2:174487299-174487321 CCGAGGCTGGAGGAGGGGGCGGG - Intergenic
943685872 2:190817693-190817715 CAGAGGCTGGTGGAGAGGATGGG + Intergenic
946027332 2:216679696-216679718 AAGCGGCAGGAGGAGGGGAGGGG + Intronic
946072845 2:217049049-217049071 CAGGGGATGGAGGAGCTGAGAGG - Intergenic
946386687 2:219388020-219388042 CAGCGAGGGGCGGAGCGGACAGG - Intronic
948953953 2:241272770-241272792 CAGCGGCAGGACCAGCGGGCGGG - Exonic
1170425171 20:16228428-16228450 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1172210196 20:33192213-33192235 CAGGGGCTGGAGGAACTGAGAGG + Intergenic
1172350062 20:34231355-34231377 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1172507368 20:35473467-35473489 CAGCGGCTGCAGAAGCTCACTGG + Exonic
1172905168 20:38363908-38363930 CAGCTGCTGGAGGAGGGGCAAGG - Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1174265469 20:49328611-49328633 CCGCTGCTGGAAGAGCGGGCTGG + Intergenic
1174368597 20:50071353-50071375 CTGGGGCTGGAGGAGGGGACAGG - Intergenic
1175072543 20:56346351-56346373 CAGCGGGAGAAGGAGCGCACAGG - Intergenic
1175084065 20:56444415-56444437 CAGGGCCTGGAGGAGAGGACAGG - Intronic
1175875125 20:62225946-62225968 CTGGGGATGGAGGAGGGGACAGG - Intergenic
1176077228 20:63254109-63254131 CAGCGGCTGGATGGGCTGGCCGG - Intronic
1177178639 21:17721132-17721154 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1178418479 21:32423921-32423943 CTGGGGCTGGAGGAGCAGAGAGG + Intronic
1178605546 21:34033665-34033687 CAGAGACTGGAGGAGCGTAGGGG + Intergenic
1178819509 21:35962449-35962471 GAGGGGCTGGAGGTGCGGCCTGG - Intronic
1179449650 21:41459840-41459862 CTGTGGCTGGGGGAGCGGTCTGG + Intergenic
1179505531 21:41837524-41837546 CAGGGGCTGGGGGAGGGGGCTGG + Intronic
1179973183 21:44847586-44847608 CAGCGGCTGAAGGCAAGGACTGG - Intergenic
1180592776 22:16955302-16955324 CAGGGGCTGCAGCAGTGGACTGG + Intergenic
1182140400 22:27951448-27951470 CAGGGGCTGGAGGTGTGGACTGG - Intergenic
1182283889 22:29232792-29232814 CAGGGCCTGGAGGAGGGGCCGGG - Intronic
1182296810 22:29315004-29315026 TAGCGGCTCGAGGAGCGGGCAGG - Intronic
1182670755 22:31993824-31993846 CAGAAGCTGGAGGAGAGGCCAGG - Intergenic
1183299549 22:37052082-37052104 AAGCGGCAGGAGGAGGGGAGGGG + Intronic
1183841638 22:40502732-40502754 CAGCGGCTGGAGAAGCAGACGGG - Intronic
1183845105 22:40536420-40536442 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1184016470 22:41789637-41789659 CAGGGGCTGGGGGAGGGGACTGG - Intronic
1184896102 22:47407743-47407765 CAGCCACTGGAGGGGCGGGCAGG - Intergenic
1185310177 22:50150004-50150026 CAGTGCCTGGAGGGGCGGACAGG + Intronic
1185314103 22:50171355-50171377 CAGGGGCTGGTGGAGCTGCCGGG + Intronic
951013738 3:17705926-17705948 CAGCGGCTGGAGGAGCGGACGGG - Intronic
952384775 3:32832342-32832364 CAGCTACTGGAGGAGTGGAGAGG + Intronic
952955412 3:38554216-38554238 CAGGGGCTGGAGGAGAGGCCTGG + Intronic
954080520 3:48210844-48210866 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
954136040 3:48582648-48582670 CAGCCCCTGGAGGAGAGGAAGGG + Exonic
955297220 3:57746938-57746960 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
956270209 3:67443367-67443389 CAGCGGCTGGAGGAGCGGACGGG + Intronic
956690534 3:71874221-71874243 CAGGGGCTGGAGGAGAGGGAAGG + Intergenic
958165849 3:89877229-89877251 CAGAGGCTGGAGGAGGCCACAGG + Intergenic
959042495 3:101438849-101438871 CAGCGGCTGGAGGAGCGGACGGG + Intronic
959419593 3:106112653-106112675 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
961356568 3:126343430-126343452 CAGCGGCTGCAGCAGAGGCCTGG + Exonic
961825559 3:129597402-129597424 CAGAGGCTGGAGAAGGGCACAGG + Intronic
965080137 3:164023311-164023333 CAGTGGCTGGACTAGCGGAGAGG + Intergenic
965583336 3:170292728-170292750 CAACTGCTGGAGGTGTGGACAGG - Intronic
965757217 3:172039635-172039657 CGGCGGCTGGAGGAGGAGAGCGG + Intronic
966359449 3:179119473-179119495 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
968106009 3:196001594-196001616 CTGCAGCTGGAGGTGCAGACAGG - Intergenic
968514539 4:1010706-1010728 GGGCGGCTGGAGGTGCGGCCTGG + Intronic
969202657 4:5618134-5618156 CTGTGGCTGGAGGAGGGGGCAGG + Intronic
970332902 4:15003317-15003339 CGCCGGCTGGAGGAGCGGGCCGG - Exonic
973230915 4:47837780-47837802 CATCGGGCGGAGGAGAGGACGGG + Intronic
979832045 4:125315664-125315686 CGGCGGCTGCAGGAGGGGAAGGG + Intergenic
980520841 4:133932004-133932026 CAGGGGCTGTGGGAGGGGACAGG - Intergenic
981033659 4:140150972-140150994 CAGCCGCAGGGGGAGCGGAGAGG + Intronic
985472254 5:53541-53563 CGGCGGCGGGAGGAGGGGGCGGG + Intergenic
985658903 5:1146014-1146036 CAGGGGCTGGGGGAGGGGAATGG - Intergenic
985996243 5:3598850-3598872 CAGCGGTTGGTGGTGGGGACAGG + Intronic
991450088 5:66742503-66742525 CAGCAGCTGGAGGAGCGCTCAGG - Intronic
992373714 5:76171056-76171078 CAGCGGCTGGAGGAGCGGACGGG + Intronic
992487422 5:77210363-77210385 GAGCGGCGGGAGGGGCGGAGGGG + Intergenic
992881479 5:81114623-81114645 CAGGGGCTGGAGAGGGGGACAGG - Intronic
995440832 5:112190544-112190566 AAGAGGATGGAGGAGAGGACAGG + Intronic
997044173 5:130293547-130293569 CAGAGGCTGGGGGATAGGACAGG + Intergenic
997229827 5:132234234-132234256 CAGCAGCTGGAGGTGTGGTCAGG + Intronic
998157350 5:139794686-139794708 CAGGGGCTGGAGTAGGGGAGAGG + Intergenic
998400247 5:141844938-141844960 CAGTGGCAGGAGGAGGGGATTGG + Intergenic
998433978 5:142091156-142091178 CAGGGGCTGGAGGGGAGGAATGG + Intergenic
999231113 5:150062423-150062445 CAGGGGCTGGAGGAGGGAAAGGG - Intronic
999273626 5:150313711-150313733 CAGAGGCTGGGGGAGAGGCCCGG + Intronic
1000985241 5:167858826-167858848 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1002320884 5:178375251-178375273 CAGGGGCTGGGGGAGAGGAGGGG + Intronic
1002341418 5:178518822-178518844 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1002401842 5:178995268-178995290 CAGCGGCTGGCGCAGGTGACTGG - Intronic
1002696951 5:181098272-181098294 CCGCGGCTGGGGGAAGGGACTGG + Intergenic
1002797421 6:485799-485821 CACCTGCTGAAGGAGCGGGCAGG + Exonic
1003344948 6:5258173-5258195 CTGAGACTGGAGGAGCAGACAGG + Intronic
1004387942 6:15188443-15188465 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1006362646 6:33595353-33595375 CAGTGGCAGGTGGAGTGGACAGG + Intergenic
1006492124 6:34396976-34396998 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1007367695 6:41406434-41406456 ACGCGGCTGGAGGAGGGGGCCGG + Intergenic
1007424056 6:41735490-41735512 CGGCGGCGGGAAGGGCGGACGGG - Intronic
1007674434 6:43581572-43581594 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1011405429 6:87010827-87010849 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1013366900 6:109443664-109443686 TGGCGGCTGGAGGAGGGGCCGGG + Exonic
1015366342 6:132401447-132401469 CAGCGGCTGGAGGCCGGTACCGG - Exonic
1015476533 6:133664286-133664308 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1018953881 6:168395257-168395279 CTGCGGCTGGAGCAGCAGGCGGG - Intergenic
1019215214 6:170438902-170438924 CTGGGGCTGGAGGAGCAGGCTGG + Intergenic
1020012584 7:4814874-4814896 CTGAGGCTGGAGGAGGGGCCAGG - Intronic
1020140652 7:5609707-5609729 CAGGGGGTGGGGGAGGGGACAGG + Intergenic
1020616634 7:10466447-10466469 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1021872142 7:25017951-25017973 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1022027000 7:26457919-26457941 CAGCTGCTGGAGCTGTGGACAGG - Intergenic
1022230796 7:28410247-28410269 AGGCGGCCGGAGGAGTGGACTGG - Intronic
1022477924 7:30723814-30723836 CAGGGGCTGGAGGGGTGGGCAGG + Intronic
1023965888 7:44962896-44962918 CTGCGGCAGGAGGAGGGGTCAGG + Intronic
1024676002 7:51638424-51638446 ATGGGGCTGGAGGAGCAGACGGG + Intergenic
1027479484 7:78677868-78677890 CAGCGTCTGGGGGAGCTGTCAGG + Intronic
1028600306 7:92593524-92593546 CAGGGGCTGGAGGAGTGGGAAGG - Intergenic
1029101784 7:98136874-98136896 CAGAGACTGGAGGAGCTGAGGGG + Intronic
1029194418 7:98795016-98795038 CAGAGGCTGGAGGAGGGAAATGG + Intergenic
1031984574 7:128155234-128155256 CAGCAGCTGGAGGAGTGCAGGGG + Intergenic
1032196807 7:129794114-129794136 CAGGGGCTTGAGCAGGGGACAGG + Intergenic
1032201307 7:129825117-129825139 CAGGGGCAGGAGGAAGGGACCGG - Intergenic
1033099750 7:138460276-138460298 CGGCGGTTGGCGAAGCGGACGGG + Intergenic
1034196233 7:149250321-149250343 CAGAGCCTGGAGGGGCGCACGGG + Exonic
1035331092 7:158098033-158098055 CACCGGCTCGAGGGACGGACGGG - Intronic
1035508111 8:150609-150631 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1035770097 8:2140068-2140090 CAGGGGCTGGGGGAGGGGAATGG - Intronic
1036536876 8:9658320-9658342 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037771360 8:21801986-21802008 CAGCGTGCTGAGGAGCGGACGGG - Intronic
1037833934 8:22205198-22205220 CAGTGGCTTGAGGAGGGGGCTGG + Intronic
1038008710 8:23457310-23457332 CAGGGGCTGGGGGAGCGCGCCGG + Intronic
1039981029 8:42410207-42410229 CAGCGGCTGCACGGGCGGGCGGG + Intergenic
1042048813 8:64685181-64685203 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1044630943 8:94278246-94278268 CGGCGCCTGGAGCAGCTGACCGG - Intergenic
1044660464 8:94590211-94590233 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1046013915 8:108583334-108583356 AAGCTGCTGGAGGACTGGACAGG + Intergenic
1047848273 8:128827146-128827168 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1049035046 8:140069107-140069129 CAGCGGCTTCAGGAGGGGATCGG - Intronic
1049225074 8:141446517-141446539 CAGCAGGGGGAGGAGCAGACGGG + Intergenic
1049275535 8:141718328-141718350 CATCTGCTGGAGGAGCAGACCGG - Intergenic
1049320911 8:141995786-141995808 CAGAGGCTGGAAGAGAGGCCTGG - Intergenic
1049548522 8:143246048-143246070 CTGCGGCGGGAGGAGCGGCAGGG + Intergenic
1049570699 8:143369064-143369086 CGGCGGCGGGAGGAGGGGCCCGG + Intronic
1049660004 8:143815666-143815688 CAGCGGGCGGACGAGCGGGCGGG - Intergenic
1049676470 8:143891476-143891498 CAGTGGCTGGAGGAGGGGCCCGG - Intergenic
1053256039 9:36616034-36616056 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1053457067 9:38241547-38241569 CAGCGGCTGGAGGAGCGGACGGG + Intergenic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1053571551 9:39314497-39314519 CAGAGGCTGGAGGTGCGGGGTGG - Intergenic
1054093110 9:60873199-60873221 CAGAGGCTGGAGGTGCGGGGTGG - Intergenic
1054114588 9:61149111-61149133 CAGAGGCTGGAGGTGCGGGGTGG - Intergenic
1054125594 9:61304515-61304537 CAGAGGCTGGAGGTGCGGGGTGG + Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054593166 9:67033416-67033438 CAGAGGCTGGAGGTGCGGGGTGG + Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1055530381 9:77177651-77177673 CGGCGGGAGGAGGAGCGCACGGG + Exonic
1055574361 9:77647344-77647366 CTGCGGGCGGAGGAGTGGACGGG + Intronic
1057034708 9:91803389-91803411 CAGAGGCTGGAGGAGGGGACAGG + Intronic
1058684131 9:107465855-107465877 CCGCGCCTGGGAGAGCGGACTGG + Intergenic
1059210859 9:112513707-112513729 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1060064778 9:120495060-120495082 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1060074561 9:120579909-120579931 CAGCGGCTGCAGGTGCGGCCGGG - Exonic
1061089848 9:128420584-128420606 GAGGGGCCGGAGGACCGGACAGG - Exonic
1061089959 9:128420894-128420916 CAGCAGCTGGAGCAGCGGCGCGG - Exonic
1061102555 9:128503348-128503370 CAGGGGCTGGGGGAGGGGAATGG - Intergenic
1061449325 9:130660060-130660082 CAGCGGGCGGAGGAGGGGAGCGG + Intergenic
1061984092 9:134119062-134119084 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1062119576 9:134827135-134827157 CAGAGGCTGCAGGGGCGCACAGG - Intronic
1062214545 9:135382191-135382213 CAGCGGATGGAGGAGGAGAGGGG - Intergenic
1062393729 9:136344184-136344206 GAGCGGGGGGAGGCGCGGACAGG + Intronic
1062504359 9:136865765-136865787 CAGAGGCAGGAGGTGGGGACGGG - Intronic
1062659177 9:137619284-137619306 CGGCGGCTGGGGGAGCGGGCGGG + Intronic
1185494554 X:544530-544552 CAGAGGCTGGAGCAGGTGACTGG + Intergenic
1185644879 X:1609477-1609499 CAGCGGCAGCAGGAGAGGAGGGG - Intergenic
1186393990 X:9189451-9189473 CAGCAGCTGGAGGAGGGCAGTGG - Intergenic
1187976697 X:24710069-24710091 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1188407219 X:29826543-29826565 CAGGGGCTGGAGGTGGGGAGGGG - Intronic
1190102097 X:47529649-47529671 CAGCAGCTGGAGGAGAGGCCTGG - Intergenic
1191618313 X:63190335-63190357 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1192621079 X:72680841-72680863 CAGCGGCTGGAGGAGCGGACGGG + Intronic
1194420600 X:93668799-93668821 GAGCGGGTGGAGGAGCAGTCTGG + Intergenic
1195036322 X:100973393-100973415 CAGCGGCTGGAGGAGCGGACGGG - Intronic
1195964622 X:110418778-110418800 CAGCAGCTGGAGGAGCTGCCAGG - Intronic
1196055138 X:111347651-111347673 TAGTGGCTGGAGGATCAGACGGG - Intronic
1196060407 X:111402296-111402318 CAGAGGCAAGAGGAGGGGACTGG + Intronic
1196404616 X:115348269-115348291 CAGCGGCTGGAGGAGCGGACGGG - Intergenic
1196862444 X:120040829-120040851 CAGGGGCAGGAGGAGGTGACAGG + Intergenic
1196880658 X:120195515-120195537 CAGGGGCAGGAGGAGGTGACAGG - Intergenic
1197770621 X:130086935-130086957 CTGCGGCTGGTGCAGCGCACTGG + Intronic
1200056258 X:153462939-153462961 CAGCTGCCTGAGGAGTGGACAGG + Intronic
1200341238 X:155398591-155398613 CAGGGGCTGGAGTAGGGGAGTGG + Intergenic