ID: 959419594

View in Genome Browser
Species Human (GRCh38)
Location 3:106112654-106112676
Sequence GCAGCGGCTGGAGGAGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 70, 1: 0, 2: 5, 3: 61, 4: 657}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419594_959419605 3 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC 0: 70
1: 0
2: 5
3: 61
4: 657
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419594_959419607 6 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC 0: 70
1: 0
2: 5
3: 61
4: 657
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419594_959419601 -2 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC 0: 70
1: 0
2: 5
3: 61
4: 657
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419594 Original CRISPR GCAGCGGCTGGAGGAGCGGA CGG (reversed) Intergenic
900031416 1:375589-375611 GGAGCGGATGGAGGTGCGGTGGG - Intergenic
900035304 1:402712-402734 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic
900051967 1:603789-603811 GGAGCGGATGGAGGTGCGGTGGG - Intergenic
900056925 1:638465-638487 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic
900370966 1:2331982-2332004 GCAGCGGCGGGAGAGGCGCAGGG - Intronic
900535061 1:3172777-3172799 GCCGGGGCTGGGGGAGGGGATGG + Intronic
900810748 1:4799750-4799772 GTAGCTGCTGGAGGTGAGGAGGG + Intergenic
900932455 1:5745923-5745945 GCTGTGGCCGGAGGAGCGGCAGG - Intergenic
901025617 1:6277334-6277356 GCAGCGGCTGCAGGCGTGGTTGG - Intronic
901061921 1:6475542-6475564 GCAGAGGCTGGAGGTGTGGGTGG + Intronic
901510617 1:9716526-9716548 GCAGCCGCTGGTGGAGCAGCCGG + Exonic
902091140 1:13904159-13904181 GCAGAGGATGGAGGGGCAGAAGG + Intergenic
902467245 1:16625951-16625973 GCAGCGGCAGGCGGAGCAGGAGG - Intergenic
902492550 1:16795149-16795171 GCAGGGGCTGGCGGAGCCCACGG - Intronic
902636250 1:17736770-17736792 GCAGCAGCTGGGGGTGGGGAGGG - Intergenic
902906684 1:19563519-19563541 TCAGAGGATGGAGGAGCAGAGGG - Intergenic
903224102 1:21885192-21885214 GCAAAGGAAGGAGGAGCGGAAGG + Intronic
903251136 1:22053452-22053474 GAGCGGGCTGGAGGAGCGGATGG - Intronic
903332190 1:22601854-22601876 TCAGGTGCTGGAGGAGCTGAAGG + Exonic
903358945 1:22765007-22765029 GCAGAGGCTGGAGGACAGGCAGG + Intronic
903456505 1:23490956-23490978 GCAGCTGCTGGAGGGGCTGCAGG - Intergenic
903499300 1:23792797-23792819 GGAGCAGCTGGAGGACCGGCTGG + Intronic
903526498 1:23994987-23995009 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
903923421 1:26817425-26817447 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
904035422 1:27556225-27556247 GCAGTGGGTGGGGGAGGGGAAGG - Intronic
904496215 1:30888294-30888316 GAAGGGGCTGGAGGAGCACATGG + Intronic
904794822 1:33051295-33051317 GCAGCGGCTGGAGGAGCGGACGG + Intronic
905014992 1:34771770-34771792 GGAGCGGCTGGAGCAGTGGGAGG - Intronic
905167059 1:36088926-36088948 GCAGCGGCAGGTGGAGGGGCTGG + Exonic
905172092 1:36115372-36115394 GCAGCGGCAGCAGGAGGGGCTGG + Intronic
905647238 1:39633163-39633185 GCAGCTGCAGGCGGGGCGGAGGG - Intronic
906003731 1:42449917-42449939 GCAGCAGCTGCAGCAGCGGCAGG - Exonic
906168885 1:43707518-43707540 GCAGCGGCGGGCGGAGCGCGCGG - Exonic
906199070 1:43947603-43947625 GGAGCGGCGGGAGGAGCAGCCGG + Exonic
906293042 1:44632168-44632190 GGAGCGGCCGGAGGAGCAGAGGG + Intronic
906436926 1:45804021-45804043 GCAGCGGCTGGAGGAGCGGACGG + Exonic
906477342 1:46178523-46178545 GTAGAGGCTGGAGGAGGGGATGG - Intronic
906486652 1:46240456-46240478 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
906524256 1:46485388-46485410 GTAGCGGCTGGAGTAAGGGAAGG + Intergenic
906775585 1:48526518-48526540 GCAGCGGCAGGAGGAGGAGGAGG + Intergenic
907195675 1:52684782-52684804 GCAGTGGGTGGGGGAGGGGAGGG - Exonic
907325367 1:53634678-53634700 GCAGTGGCTGGAATAGCGGTGGG - Intronic
907440297 1:54474759-54474781 GCAGCGGCCGGAGACCCGGACGG - Intergenic
907453919 1:54563087-54563109 GCAGCGGCTGGAGGAGCGGACGG - Intronic
907913640 1:58849048-58849070 GCAGCGGGTGCAGGAGAGGTGGG - Intergenic
908006595 1:59734709-59734731 GCAGCCCCTGGGGGAGGGGATGG + Intronic
909895021 1:81058002-81058024 GCAGCATCTGGAGGAGTGAATGG - Intergenic
910104741 1:83619421-83619443 GCAGCAGATGGGGGAGGGGATGG - Intergenic
910210665 1:84789361-84789383 TCAAAGGCTGGAGGAGCAGAAGG - Intergenic
910679113 1:89844099-89844121 GCAGCAGCTGGAGGAGAGGGTGG - Intronic
911219739 1:95234178-95234200 GCGGCGGCTGCGGCAGCGGAAGG + Exonic
912409046 1:109467088-109467110 GCGGCGGCTGGAGGAGCCGCTGG + Exonic
912412167 1:109487048-109487070 GCAGGGGCTGGAGGTGGGGGTGG - Exonic
912430597 1:109626532-109626554 CCAGCAGCTGGAGGGGCGGAGGG + Intronic
912825482 1:112899337-112899359 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
912844662 1:113068768-113068790 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
913957719 1:143319982-143320004 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
914052029 1:144145346-144145368 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
914127168 1:144821195-144821217 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
914847902 1:151292926-151292948 GCAGCTGCTGGTGGAGCAGATGG - Exonic
914919911 1:151839622-151839644 GGAGCGACTCGAGGAGGGGAAGG - Intronic
915034509 1:152910796-152910818 GGAGCAGCTGGAGGAGCAGGAGG + Exonic
915218149 1:154353424-154353446 GCAGTGGTGGGAGGAGGGGAGGG - Intergenic
915296491 1:154925164-154925186 ACAGCGCCTGGAGGAGCAGTTGG - Exonic
915341665 1:155179786-155179808 GCAGCGGCGGGAGGAGGTGAGGG + Exonic
915436564 1:155911192-155911214 GCAGCAGCTGGGGGTGGGGAGGG - Intronic
915901186 1:159847654-159847676 GCAGAGGCTGGGGGAGTGGGAGG - Intronic
916210647 1:162357085-162357107 GCTGCTGCTGGAGGAGCTGCTGG - Exonic
918265769 1:182839996-182840018 GCAGAGCCTGCAGAAGCGGAAGG + Intronic
918388736 1:184036980-184037002 GGAGCCGCTGGAGGGGCGGGGGG - Intronic
919924779 1:202186607-202186629 GCAGCTGGAGGAGGAGCAGATGG + Intergenic
920442266 1:205989126-205989148 GGAGAGGATGGAGGAGAGGATGG - Intronic
920740486 1:208577103-208577125 CCAGCATTTGGAGGAGCGGAAGG + Intergenic
921358905 1:214312567-214312589 GCAGCGGCTGGAGAGGAGGGAGG + Intronic
921414444 1:214870443-214870465 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
922257834 1:223908272-223908294 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic
922513137 1:226186438-226186460 GCGGCGGCTGGAGCAGCGCTGGG - Exonic
923332176 1:232935344-232935366 CCAGGGCCTGGAGGAGCTGAAGG - Intergenic
923689153 1:236176128-236176150 GAAGAGGTTGGAGGTGCGGAGGG + Intronic
924339032 1:243011051-243011073 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic
924941049 1:248812641-248812663 GCAGGAGCTGGTGGAGAGGAAGG - Intronic
1062930660 10:1350371-1350393 GCAGCCTGGGGAGGAGCGGAGGG - Intronic
1062940961 10:1421126-1421148 GCACCGGCTGGAGGAGGGCGGGG + Intronic
1063113955 10:3060161-3060183 GCAGGGTCTGGAGGGGAGGAGGG + Intergenic
1063128312 10:3154836-3154858 GCAGCCGCTGGGGGAGCAGCCGG - Intronic
1063210435 10:3876016-3876038 GCAGAAGCTGGAGGAGCTGGAGG - Intergenic
1064950506 10:20843955-20843977 ACAGTGGCAGGAGGAGAGGATGG - Intronic
1065122403 10:22542645-22542667 GCCACGGCTGGAGGAGGAGAGGG - Intronic
1065335694 10:24655529-24655551 ATCGCGGCTGGAGGAGCGGACGG + Intronic
1066745978 10:38604465-38604487 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1067146058 10:43694733-43694755 AGAGGGGCTGGAGGAGGGGAGGG + Intergenic
1067224174 10:44364579-44364601 GCAGAGGCTGCAGGAAGGGAGGG + Intergenic
1067299112 10:44993296-44993318 GCAGCGCCTGGAGCAGCTGGTGG + Exonic
1067678555 10:48409691-48409713 GCAGGAGTTGGAGGAGGGGATGG - Intronic
1068316542 10:55351046-55351068 GCAGCAGCGGGGGGAGGGGAGGG - Intronic
1068335336 10:55627659-55627681 GCTGCTGCTGAAGGAGCAGAGGG - Intronic
1069596233 10:69672903-69672925 CTGGAGGCTGGAGGAGCGGAGGG + Intergenic
1070318253 10:75334218-75334240 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1070604344 10:77888330-77888352 GCAGGGGCTGCAGGAGAGGTGGG - Intronic
1070747787 10:78945209-78945231 GGAGAGGGTGGTGGAGCGGAGGG + Intergenic
1070800697 10:79243114-79243136 GCCGCGGCGGGGGGAGGGGAGGG - Intronic
1070827385 10:79399151-79399173 GCAGTGGATGGAGGAGAAGAAGG + Intronic
1071350392 10:84734781-84734803 GCAGGGGCAGGAGGTGGGGAGGG + Intergenic
1072150171 10:92676006-92676028 TGTGGGGCTGGAGGAGCGGACGG - Intergenic
1072422918 10:95304516-95304538 GCAGGAGCTGGAGGAGGAGAAGG + Intergenic
1072950124 10:99840146-99840168 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1073010941 10:100359131-100359153 CCAGAGGCTGGAGGTGGGGAAGG - Intronic
1073094089 10:100969490-100969512 GCCGCGGCTGGAGGCGGGGCGGG - Intronic
1073099494 10:100999447-100999469 GCTTCGCCTGGAGAAGCGGAGGG + Intronic
1073547726 10:104365987-104366009 GCAGCAGCTGAAGGAGCAGAAGG + Exonic
1074426719 10:113358093-113358115 GGAGCAGCTGGAGGAGAGGCAGG + Intergenic
1075334484 10:121598435-121598457 GCGGCGGCTGGAGGAGAGCGCGG - Intronic
1075809644 10:125215626-125215648 GAAGATGCTGGAGGAGCAGAGGG + Intergenic
1076501072 10:130936482-130936504 GCAGGGGCTTGAGGAGGGAAGGG - Intergenic
1076507493 10:130987622-130987644 GTTGAGGGTGGAGGAGCGGAGGG - Intergenic
1076782249 10:132730799-132730821 GCAGCCGCTGCAGGGGCAGAGGG - Intronic
1076838025 10:133031037-133031059 GCAGCAGATGGAAGAGTGGAAGG + Intergenic
1077227462 11:1444662-1444684 GCAGGGGCCTGGGGAGCGGAGGG - Intronic
1077231777 11:1461049-1461071 GCAGCAACAGCAGGAGCGGAGGG - Exonic
1077252892 11:1568368-1568390 GCAGGGGCTGGAGGGGCGGGAGG + Intronic
1077299391 11:1840150-1840172 CCAGAGGCTGGGGGAGAGGAGGG - Intronic
1077530709 11:3093543-3093565 GGTGCCGCTGGAGGAGCAGACGG - Exonic
1077661740 11:4074601-4074623 CCAGCGGCTGAAGGAGCTGCGGG + Exonic
1077739540 11:4830176-4830198 GCAGAAGCTGGAGGATCTGAAGG + Intronic
1077896514 11:6457409-6457431 CCAGCAGCTGCAGGAGCGCAAGG - Exonic
1078000585 11:7491799-7491821 GGAGAGGCTGTAGGAGCTGAGGG - Intronic
1078112765 11:8411958-8411980 GGGGCGGCTGGAGGAGTGGGAGG + Intronic
1078405557 11:11067466-11067488 GGAGCGGCTGCAGGAGCTCAGGG + Intergenic
1078447690 11:11416892-11416914 GCAAGGGCTGGGGGAGGGGATGG - Intronic
1079173817 11:18120811-18120833 GCAGCGGCTGGGGAGGTGGAAGG - Intronic
1079505956 11:21152164-21152186 GCAGGGGGTGGAGGGGCTGATGG + Intronic
1079866528 11:25742259-25742281 TCAGGGGCTGGAGGAGGGGGTGG + Intergenic
1081784953 11:45739195-45739217 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1081915949 11:46730373-46730395 GCAGGGACTGGAAGAGGGGAAGG + Intronic
1082824455 11:57567718-57567740 GCGACGGCTGGAGGAGGGGTGGG - Exonic
1083264061 11:61538017-61538039 TCAGCGGATGCTGGAGCGGAAGG - Intronic
1083267910 11:61555391-61555413 GCAGCGGCTCGGGGAGCTGTGGG + Intronic
1083366883 11:62146756-62146778 GCAGCGGGAGCAGGAGCGGCGGG + Exonic
1083448523 11:62727045-62727067 GCAGCGGCTGCAGGAGGCGCTGG - Exonic
1083892680 11:65604454-65604476 GCAGCTGCTGGAGTAGCAAATGG + Intronic
1084086582 11:66857750-66857772 GCAGCAGCAGCAGGAGCGGCGGG - Exonic
1084269431 11:68021200-68021222 GCAGAGGCGGGAGGAGCCAAGGG + Intronic
1084422451 11:69067122-69067144 GGAGGGGCAGGAGGAGCAGAGGG - Intronic
1084504794 11:69558777-69558799 GGAGAGGCTGTGGGAGCGGAAGG - Intergenic
1084529201 11:69717159-69717181 GCAGAGGGTTGAGGAGCTGACGG - Intergenic
1085119370 11:73957388-73957410 CCAGGTGCTGGAGGAGCGGAGGG - Intronic
1085503074 11:77040055-77040077 GGAGCGGCTGGCGGAGCTGGTGG + Exonic
1085882583 11:80485190-80485212 CCAGGGGCAGGAGGAGCAGAAGG + Intergenic
1087594742 11:100238489-100238511 GCAGCAGCAGGAGGAGGAGAAGG + Intronic
1088691814 11:112334819-112334841 GCTGAGGCTGGAGGTGCTGATGG + Intergenic
1088897810 11:114091394-114091416 CCAGGGGGTGGAGGAGAGGAAGG - Intronic
1088937338 11:114416595-114416617 TCAGCAGCTGGAGGAGCTGCTGG + Intronic
1089128272 11:116192772-116192794 GAAGCCACTGGAGGAGGGGAGGG - Intergenic
1089166824 11:116483847-116483869 GCAGGGGCTGGAAGAGAGGTGGG - Intergenic
1089213502 11:116821727-116821749 GAAGGAGCTGGAGGAGCTGAGGG - Exonic
1089322398 11:117635226-117635248 GAAGTGGGAGGAGGAGCGGATGG + Intronic
1089583458 11:119495722-119495744 GCAGGATCTGGAGGAGCTGAGGG - Intergenic
1089603844 11:119630348-119630370 GCAGGGGCTGAGGGAGAGGAGGG + Intronic
1089793582 11:120962338-120962360 TCAGCGGGTGGAGAAGCAGAAGG + Intronic
1089840525 11:121413519-121413541 CCAAGGGCAGGAGGAGCGGAAGG + Intergenic
1090211051 11:124921306-124921328 GTAGCGGCGGGCAGAGCGGATGG + Exonic
1090616768 11:128522269-128522291 GCAGCCGCCGGCGGAGAGGAGGG - Intronic
1090636777 11:128694540-128694562 GCCGGGGCTGCAGGAGGGGACGG + Intronic
1090991408 11:131820185-131820207 CCAGTGGCTGCAGGAGAGGAGGG - Intronic
1091385533 12:92337-92359 TCTGCGGCTGGAGGGGCCGAAGG - Intronic
1091615499 12:2048049-2048071 GCAGGAGCTGGAGGAGCTGTGGG + Intronic
1091697041 12:2634768-2634790 GCAGTGGCTGGAGGAGAAGGTGG - Intronic
1091789328 12:3262629-3262651 GTAGGGGTGGGAGGAGCGGAGGG + Intronic
1091905895 12:4188907-4188929 GCAGGGGTTGGGGGAGGGGAGGG + Intergenic
1092453594 12:8625279-8625301 GGGGCGGCTGGCGGGGCGGAGGG - Intergenic
1092462330 12:8697819-8697841 GCGGCGGCCGGAGGAGCTGGGGG - Intronic
1092853451 12:12651405-12651427 GCAGAGGATGGTGGAGCAGAAGG - Intergenic
1095162862 12:38937239-38937261 GCAGCTGCTTGGGGAGAGGAAGG + Intergenic
1095439345 12:42227154-42227176 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1096022484 12:48333784-48333806 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1096073690 12:48789275-48789297 GAAGCGGCCGGAGGAGAGGAGGG - Intergenic
1096112855 12:49039520-49039542 GCAGCAGCTGCAGGAGCAGTGGG - Exonic
1096409291 12:51365502-51365524 GGTGCGGCAGGAGGAGCGGAAGG - Exonic
1096812759 12:54182281-54182303 GCAGCTGCTGGGGGTGCGGCTGG - Exonic
1097070566 12:56351392-56351414 GCAGCTGCTGAAGGAGCTGAAGG - Exonic
1097231097 12:57511703-57511725 GAAGCGACTGGAGGAGTGGTTGG + Exonic
1098032613 12:66269771-66269793 GCAAGGGCTGGAGGAGAGGGAGG - Intergenic
1098898016 12:76084624-76084646 GCAGCGGCAGCAGCAGCGGGAGG + Exonic
1098898018 12:76084633-76084655 GCAGCAGCGGGAGGAGCAGGAGG + Exonic
1101344958 12:103878495-103878517 GAAGAGGCTTGAGGAGGGGAGGG - Intergenic
1102421686 12:112808352-112808374 GCGGCAGCTGGTGGAGCGGCAGG + Intronic
1102442077 12:112971147-112971169 GGAAAGGCTGGAGGAGCAGAAGG + Exonic
1102548750 12:113675454-113675476 TCTGGGGCTGGAGGAGGGGAGGG - Intergenic
1102578390 12:113871840-113871862 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1103074065 12:117968331-117968353 GCAGTGGTTGGAGAGGCGGAGGG - Intronic
1103119689 12:118371465-118371487 GCATGGGCTGGAGGAGCTGGAGG - Intronic
1103748313 12:123141375-123141397 GCAGTGGCTGGAGGTGCAGAGGG - Intronic
1104029500 12:125054158-125054180 GGAAAGGCTGGAGGAGCAGAGGG - Intergenic
1104462930 12:128969951-128969973 GCAGAGGCAGGGGGAGGGGAGGG - Intronic
1104609797 12:130218820-130218842 GAAGAGGCTGGAGGAGCGGACGG + Intergenic
1104719848 12:131039220-131039242 GCAGTGGCTGGAGGAGCACAGGG - Intronic
1104932506 12:132347321-132347343 GCGGAGGCTGGGGGTGCGGACGG - Intergenic
1105240917 13:18609306-18609328 GCTGCGGCCGGAGGAGCTGGGGG + Intergenic
1105964398 13:25371917-25371939 CCCGCGGGAGGAGGAGCGGACGG - Intergenic
1110269178 13:73574259-73574281 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1112234851 13:97626140-97626162 GCAGGAGATGGAGGAGTGGAGGG - Intergenic
1113877281 13:113602205-113602227 GGAGCTGAGGGAGGAGCGGACGG + Intronic
1113887393 13:113668055-113668077 GAAGCGGCTGAAGAAGAGGAAGG + Exonic
1113981632 13:114281548-114281570 GCCGCGGCTCGAGGAGGGGCGGG + Intergenic
1114265757 14:21071607-21071629 GCCGCGGCAGGAGGGGAGGAGGG - Intronic
1115028273 14:28766938-28766960 GCAGCGGGGGGGGGAGCGGGGGG + Intergenic
1115609549 14:35038525-35038547 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1115813270 14:37133693-37133715 GTAGGGTCTGGAGGAGGGGAAGG - Intronic
1116871641 14:50073940-50073962 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1116945466 14:50831239-50831261 GCAGCGGAGGGAGGAGCGGGCGG + Intergenic
1116949863 14:50869822-50869844 GCAGGGGCTGGAGGTGGGGAGGG - Intronic
1118167809 14:63355403-63355425 GCAGCCGGTGGAGGAGCCGGAGG - Intergenic
1118967404 14:70600779-70600801 GCAGGGGGTGGAGGTGCGGGTGG + Intergenic
1119181017 14:72605288-72605310 GCAGGAGCAGGAGGAGGGGATGG + Intergenic
1119254527 14:73184671-73184693 GGAGCGGCTGGCGGGGCGGGGGG + Intronic
1120924499 14:89784146-89784168 GCAGGGGCTGACGGAGTGGAAGG + Intergenic
1121310414 14:92932626-92932648 GAAGCGGCTGGAGGGGCAGGAGG + Exonic
1121315998 14:92961313-92961335 CCAGGGGCTAGAGGAGTGGATGG - Intronic
1121368079 14:93332821-93332843 GCAGCGGCGGGAGGAGCCTCCGG - Exonic
1121790182 14:96693398-96693420 TGAGCGGCTGGAGCAGTGGAGGG + Intergenic
1121956712 14:98219969-98219991 GCTGCTCCTGGAGGAGAGGATGG + Intergenic
1122081530 14:99270759-99270781 GAGGGGGCTGGGGGAGCGGAGGG - Intronic
1122323292 14:100868035-100868057 GCAGTGGCTGGGGGAGCTGAGGG - Intergenic
1122579830 14:102764594-102764616 GAAGCTGCTGGAGGAGGGTAAGG - Intergenic
1122688203 14:103519896-103519918 GCAGCGGCTGGAGCAGGGCCAGG - Exonic
1122802411 14:104238273-104238295 GCAGCCTCAGGAGGAGAGGACGG + Intergenic
1122964022 14:105112716-105112738 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1122968701 14:105143803-105143825 GTAGCGGGGGGAGGAGTGGAGGG + Intronic
1123216052 14:106810311-106810333 GCAGCGGCTGGTGGTGCTAAAGG - Intergenic
1202930666 14_KI270725v1_random:30108-30130 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1123468658 15:20534228-20534250 GCAGGAGCTGGAGGAGAGGCTGG - Intronic
1123649456 15:22466834-22466856 GCAGGAGCTGGAGGAGAGGCTGG + Intronic
1123681760 15:22768890-22768912 GCAGAAGCAGGAGGAGCAGATGG - Intergenic
1123681983 15:22770102-22770124 GCAGGAGCAGGAGGAGCAGATGG - Intergenic
1123728976 15:23129439-23129461 GCAGGAGCTGGAGGAGAGGCTGG - Intronic
1123747140 15:23326904-23326926 GCAGGAGCTGGAGGAGAGGCTGG - Intergenic
1124081500 15:26502165-26502187 GCTGCGGCTGGGGGATGGGAGGG + Intergenic
1124279409 15:28350220-28350242 GCAGGAGCTGGAGGAGAGGCTGG - Intergenic
1124303289 15:28561388-28561410 GCAGGAGCTGGAGGAGAGGCTGG + Intergenic
1124532189 15:30517828-30517850 GCAGGAGCTGGAGGAGAGGCTGG + Intergenic
1124696865 15:31870712-31870734 GCGGCCGCGGGCGGAGCGGAGGG - Intronic
1124766464 15:32489817-32489839 GCAGGAGCTGGAGGAGAGGCTGG - Intergenic
1125079040 15:35655545-35655567 TGAGCGGCTGGAGGAGCGGACGG + Intergenic
1125300771 15:38252258-38252280 GCAGCGGCTGCGGCGGCGGAAGG + Intergenic
1125300774 15:38252267-38252289 GCGGCGGCGGAAGGAGCGGGCGG + Intergenic
1125659005 15:41381913-41381935 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1127396467 15:58547382-58547404 GCAGGCAGTGGAGGAGCGGAGGG + Intronic
1128565011 15:68695331-68695353 GCAAAGGGTGGAGGAGGGGAGGG - Intronic
1128798075 15:70479343-70479365 GCAGGGGCTGGAGAATGGGAGGG - Intergenic
1129188532 15:73924749-73924771 GCAGCTGCTGCAGCAGAGGAGGG - Intergenic
1129409672 15:75342584-75342606 GCAGAGGCTGGAGGAGAGAGAGG + Intronic
1129428273 15:75480786-75480808 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1129534400 15:76300318-76300340 GAAGGGGCTGGAGGAACAGAGGG - Intronic
1129661704 15:77556403-77556425 GCAGAGCCTGGAGGGGCTGATGG - Intergenic
1130040843 15:80404356-80404378 GCGGCGGCGGGGAGAGCGGAGGG + Exonic
1130224238 15:82045634-82045656 GCGGCGGCGGCAGCAGCGGAGGG - Exonic
1131578265 15:93614024-93614046 ACAAGGGCTGGAGGAGAGGAGGG + Intergenic
1131699225 15:94915928-94915950 GCGGAGGCTGGAGGAGGGAATGG - Intergenic
1131875143 15:96798012-96798034 GCAGCAGATGGAGGAGGAGAAGG + Intergenic
1132012721 15:98290230-98290252 ACAGTGGCTGGAGGAGGGGGAGG + Intergenic
1132359730 15:101202186-101202208 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132359744 15:101202249-101202271 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132359760 15:101202312-101202334 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132359774 15:101202375-101202397 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132359814 15:101202564-101202586 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132359828 15:101202627-101202649 GCAGAGGCTGCAGGGGAGGATGG + Intronic
1132483438 16:177635-177657 GCAGGGGCGGGAGGAGGGGATGG + Intergenic
1132731992 16:1367214-1367236 GCAGCTGCAGGAGGAGCTGGAGG - Intronic
1132733126 16:1372721-1372743 GCAGCGGCTGCAGGAGCTCTGGG + Intronic
1132735479 16:1383896-1383918 GCAGAGGATGTAGGAGAGGAAGG + Intronic
1132886369 16:2184049-2184071 GCTGCAGATGGAGCAGCGGACGG - Intronic
1132934523 16:2473962-2473984 GCCGCGGCTGGGGGCGCGGGGGG + Exonic
1133127287 16:3655267-3655289 GCAGGGGCTGGTGGAGCTCAAGG - Intronic
1133216726 16:4297133-4297155 GCAGCAGCTCCTGGAGCGGAAGG + Intergenic
1133253315 16:4499491-4499513 CCAGCGGCTGGGGGAAGGGAAGG + Intronic
1133280838 16:4664344-4664366 CCGGGGGCTGGAGGAGGGGATGG + Intronic
1133316211 16:4885600-4885622 GCAGCTGCGGGAGGAGCTGGAGG - Exonic
1133802038 16:9092038-9092060 GCGGAGGATGGAGGAGCGGAAGG + Exonic
1134063680 16:11213455-11213477 GCAGCCCCTGGAGGAGTGGGAGG - Intergenic
1136229198 16:28877064-28877086 GCAGCTGCTGGAGGAGCCGAGGG - Intergenic
1136238963 16:28932630-28932652 GCAGGGGCAGGAGGAGAGAAGGG + Intronic
1136371605 16:29840279-29840301 GCAGCCCCTGGAGGAGGGGGAGG + Exonic
1136500795 16:30668926-30668948 GGAGCGGCCTGTGGAGCGGAGGG + Exonic
1136568071 16:31081667-31081689 GCAGCACCAGGAGGAGTGGACGG + Exonic
1136737084 16:32475179-32475201 GCAGCGGCTGGAGCAGCAGCTGG - Intergenic
1137270113 16:46897755-46897777 GCAGAGGCTGCAGGAGGGCAGGG + Intronic
1137293162 16:47065967-47065989 GCAAAGGCTGGAGGAGGAGAGGG + Intergenic
1137557830 16:49483895-49483917 GTAGGGGCTGGTGGAGGGGAGGG + Intergenic
1137637518 16:49999688-49999710 GCATCGGGTGGGGGAGCGGGAGG + Intergenic
1137977201 16:53041959-53041981 GCAGAGCCTGGAGGAGCAGGAGG - Intergenic
1140695159 16:77525373-77525395 GCTGCAGCTGGTGGAGGGGAAGG + Intergenic
1141460433 16:84175700-84175722 CCAGTGGCTGGGGGAGCAGAGGG + Intronic
1142107847 16:88315832-88315854 GCAGCGGCAGGAAGAGCAGCTGG + Intergenic
1142201040 16:88761288-88761310 ACAGAGGCTGCAGGAGGGGAGGG + Intronic
1142259281 16:89035019-89035041 GCAGGGGCAGGAGCAGAGGAGGG - Intergenic
1142273695 16:89104608-89104630 TCAGCGGCAGGAGAAGCAGAGGG - Intronic
1142397435 16:89840176-89840198 GAAGCTGCTGGAGGAGCTGCAGG + Intronic
1203015987 16_KI270728v1_random:354398-354420 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1203034322 16_KI270728v1_random:627556-627578 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1142625150 17:1187108-1187130 GGAGTGGCTGCAGGAGCCGAGGG + Intronic
1143179348 17:4974444-4974466 GGAGCAGATGGAGAAGCGGATGG - Exonic
1143600793 17:7944521-7944543 CCAGCAGCTGGAGGAGCAGCGGG + Exonic
1144676368 17:17164828-17164850 GCACCAGCTGGAGGAGCAGCTGG + Intronic
1145108543 17:20141070-20141092 GCAGTGGCAGGAGGAGAGAAGGG - Intronic
1145205667 17:20983995-20984017 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1145990071 17:29074012-29074034 GTGGGGGCTGGAGGTGCGGATGG + Exonic
1147331285 17:39700743-39700765 GGAGGGGCTGGAGGAGGGGCAGG - Intronic
1147686950 17:42291877-42291899 GCAGAGGCTGAAGGAGAGGAAGG + Intronic
1147845015 17:43398997-43399019 GCAGCGGTTGGAGGCGCGGTGGG + Exonic
1147907590 17:43833040-43833062 GCCGCGGCGGGAGGGGCGGGAGG - Intronic
1147963184 17:44179997-44180019 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1148089712 17:45016005-45016027 GCAGTGGCTGCAGGAGGGGCTGG - Intergenic
1148334841 17:46834301-46834323 GCAGTGGCTGGAGAAGCAGGTGG + Intronic
1148457816 17:47820410-47820432 GGAGGGGCTGGAGGTGGGGAAGG - Intronic
1148463265 17:47850164-47850186 CCAGGGGCTGGAGGATGGGAAGG + Intronic
1148930105 17:51120802-51120824 GCCGGGGCCGGAGGAGGGGAGGG + Exonic
1149626415 17:58083585-58083607 GCAGCTGCAGGAGGAGCCCAGGG + Exonic
1149655808 17:58309045-58309067 GAAGCAGCCGGAGGAGAGGAGGG - Exonic
1149867592 17:60159304-60159326 GCAGCAGCTGGGGCAGCGCACGG + Exonic
1149908727 17:60550829-60550851 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1150286853 17:63959521-63959543 GCAGAGGCTGCGGGGGCGGAGGG + Intronic
1150445573 17:65225078-65225100 GGAGCGGCAGGAGGAGGAGAAGG - Exonic
1150481789 17:65516692-65516714 GCAGAGGGTGGAGGAAGGGAGGG + Intergenic
1150947572 17:69765307-69765329 GGAGCGACTGGGGGAGGGGAGGG - Intergenic
1151414612 17:73953018-73953040 GCGGCGGCAGCAGGAACGGAAGG - Intergenic
1151433652 17:74081187-74081209 GCAGCGGCGGGAAGAGCTGCAGG + Intergenic
1151677439 17:75605887-75605909 GCAGCGGCTGGAGGAGCTCCGGG + Intergenic
1151715305 17:75828051-75828073 GCAGCTGCTGGAGGGCCGGAAGG - Exonic
1151786641 17:76278439-76278461 GCTGTGGGTGGAGGAGCTGAGGG + Intronic
1151832789 17:76565179-76565201 GCAGCAGCTGGGGGGGAGGAGGG - Intronic
1152280056 17:79379910-79379932 GCCGCGGCAGGAGGAGCTGCAGG - Intronic
1152382572 17:79949742-79949764 GCTGCGGCTGCAGAAGCGAAAGG - Exonic
1152599205 17:81253043-81253065 GCACTGGCTGGGGGTGCGGATGG - Intronic
1152948237 17:83210124-83210146 GGAGCGGATGGAGGTGCGGTGGG + Intergenic
1152976692 18:228073-228095 CCAGGGGCTGGAGGAAGGGAAGG - Intronic
1153480686 18:5543658-5543680 GCCGCGGCGGGCGGAGCGGGCGG + Intronic
1153497750 18:5717405-5717427 GCAGTGGCTGGAAGAGCAGATGG + Intergenic
1153779142 18:8478854-8478876 CCAGCAGGTGGAGGGGCGGAGGG + Intergenic
1154448053 18:14450602-14450624 GCTGCGGCCGGAGGAGCTGGGGG - Intergenic
1155505453 18:26528544-26528566 GCAGCAGCTGGAGGAAGGCAGGG - Intronic
1156088814 18:33440770-33440792 GCGGCGGCGTGAGGAGCGGGCGG + Intronic
1156384794 18:36595290-36595312 GCAGGGGATGGAGGAGAGGAAGG - Intronic
1157257698 18:46153253-46153275 GAAGGGGCTGGGGGAGGGGAGGG + Intergenic
1158648902 18:59269400-59269422 GGAGCGGCTGAAGGAGAGGAGGG + Exonic
1160114867 18:76068468-76068490 CCAGAGGCTGGAGGAGGGGCGGG - Intergenic
1160197275 18:76766334-76766356 GCAGGGGCTGAAGGAGAGAAGGG + Intergenic
1160693379 19:470652-470674 GGGGCGGCTGGAGGAGGGGCAGG - Intronic
1160747806 19:720068-720090 GCTGCGGCTGGGGGAGGGGAGGG - Intronic
1160867064 19:1260671-1260693 GCAGCGGGCGGAGGGGCGGCAGG + Intronic
1160930508 19:1567775-1567797 GCGGCGGCGGGGGGCGCGGACGG - Exonic
1160967585 19:1753429-1753451 GCAGCGGTGGCAGGAGCGGGTGG + Exonic
1160971524 19:1769874-1769896 GCAGAGGCTGGGGGAGGGGCCGG - Intronic
1160973432 19:1780460-1780482 ACAGAGGCTGGAGGAGAGGGCGG + Exonic
1161196278 19:2988264-2988286 GCAGCGGCTGTTGGAGAGGATGG - Intronic
1161219394 19:3111323-3111345 GCCGGGGCTGGAGGAGGGGGTGG - Intronic
1161298117 19:3529909-3529931 GGAGCGGATGGGTGAGCGGATGG + Intronic
1161298157 19:3530109-3530131 GGAGCGGATGGGTGAGCGGATGG + Intronic
1161304023 19:3557143-3557165 GCAGCAGCTGGCGGCGCGGTCGG + Exonic
1161409868 19:4111121-4111143 CCGGGGGCTGGAGGAGGGGATGG + Intronic
1161552755 19:4923274-4923296 GAGGCGGCAGGAGGAGCAGACGG - Intronic
1161580426 19:5077748-5077770 GCAGGGGCTGCAGGGGTGGAAGG + Intronic
1162019415 19:7861913-7861935 GCAGCTGCAGGAGGAGCTGAAGG + Exonic
1162134081 19:8544548-8544570 GGAGGGGGTGGAGGAGTGGAGGG + Intronic
1162559176 19:11406150-11406172 GCAGGGGCTGGAGGGGCAGCTGG - Intronic
1162740225 19:12769871-12769893 GCAGCGGCGGCAGGTGCGGCGGG - Exonic
1162799502 19:13103001-13103023 ACAGTGGCTGGGGGAGCGGAAGG - Intronic
1162805297 19:13135184-13135206 GCAGCGGCTGCACGAGGGGCAGG - Exonic
1162886691 19:13702755-13702777 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1162923683 19:13918940-13918962 GGAGGCGCTGGAGCAGCGGATGG + Exonic
1163398094 19:17075787-17075809 GGAGCGGCTCGAGCAGCGGCGGG + Exonic
1163655666 19:18543523-18543545 GCCGCGGCTGGGGGCGGGGAGGG - Exonic
1163697830 19:18772875-18772897 GGAGGGGCTGGAGAAGCGGCAGG + Intronic
1163748825 19:19063651-19063673 GCAGAGGCGAGAGGAACGGAGGG - Intergenic
1163906088 19:20150729-20150751 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1164191907 19:22925502-22925524 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1164578112 19:29417877-29417899 TCAGCGGCTGGAGGAGGCGAGGG - Intergenic
1164617228 19:29674481-29674503 GCAGCGGCAGGAGGAGGCGGAGG + Exonic
1164653341 19:29901722-29901744 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1165100508 19:33435971-33435993 GCAGCTGCTGGAGGAGAATATGG + Intronic
1165245046 19:34493909-34493931 GCAGGGGATGGAGGGGAGGAGGG - Intronic
1165702712 19:37950703-37950725 GCAGCGGAGGGAGCAGCAGACGG - Intronic
1165946009 19:39442756-39442778 GCACCGGCTGGTGGACTGGATGG + Intronic
1166261437 19:41644225-41644247 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1166375450 19:42324721-42324743 GCAGGGGCTGAGGGAGGGGACGG - Exonic
1166547186 19:43640408-43640430 GCTGCAGCTGGAGGTCCGGAGGG + Intergenic
1166768544 19:45266466-45266488 CCAGCAGATGGGGGAGCGGATGG + Intronic
1166852836 19:45768657-45768679 GCAGCGGCTGCGGGAGCTGAGGG - Exonic
1167097000 19:47379892-47379914 GCAGCAGCTGGAGGAGGAGGAGG + Exonic
1167240950 19:48342694-48342716 GCAGCTGCTGCCGGAGCTGAAGG - Exonic
1167432512 19:49462617-49462639 GAGACGGCTGCAGGAGCGGATGG + Exonic
1167436227 19:49480368-49480390 GCAGCAGTAGGAGGAGCAGAGGG - Exonic
1167578940 19:50330902-50330924 GCTGCGGCTGGGGCTGCGGAGGG + Intronic
1167604852 19:50476220-50476242 GGAGCGGACGGAGGAGCAGAGGG + Exonic
1168274935 19:55272466-55272488 GCAGGGGCTGCGGGAGAGGACGG + Intronic
1202691428 1_KI270712v1_random:97770-97792 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
925852647 2:8097905-8097927 CCAGGGACTGGAGGAGGGGATGG + Intergenic
926216812 2:10911133-10911155 GCAAAGGCTGGAAGAGAGGAGGG + Intergenic
926383553 2:12314580-12314602 GCAGCAGCAGGAGGAGGGAAGGG - Intergenic
926964661 2:18396635-18396657 AGAATGGCTGGAGGAGCGGAGGG + Intergenic
927099752 2:19779012-19779034 GCAGGGGAAGGAGGAGCTGAAGG - Intergenic
927139138 2:20118026-20118048 GGAGCAGCTGGAGGAGCAGGAGG + Intergenic
927139151 2:20118068-20118090 GGAGCAGCTGGAGGAGCAGGGGG + Intergenic
927139162 2:20118110-20118132 GGAGCAGCTGGAGGAGCAGGAGG + Intergenic
927474513 2:23402145-23402167 GGACCGGCAGGAGGAGGGGATGG + Intronic
927651888 2:24918333-24918355 GCAGCAGCAGGAGGAGCTCAAGG - Exonic
927786808 2:25980501-25980523 GGAGCGGCTGGAGGAGGAGAAGG - Exonic
928375614 2:30770861-30770883 GCAGAGCCTGCAGGAGCTGAGGG + Intronic
929569474 2:43011752-43011774 CCAGGGGCTGGAGGAGTGGAGGG - Intergenic
929614371 2:43296854-43296876 GCAGCGGCTGGAGGAGCGGACGG + Intronic
931289555 2:60860549-60860571 GCAGGGGCTGGGGGAGCAGGAGG - Intergenic
931348854 2:61470878-61470900 GCAGCGGGAGGGGGAGAGGAGGG + Intergenic
931428400 2:62191406-62191428 GCAGCGGCTGGTGGAATGAAGGG - Intergenic
931442748 2:62302990-62303012 GCAGCGGCTGGAGGAGTGGCTGG - Intergenic
932397218 2:71456321-71456343 CCAGGGGCTGGGGGAGGGGAGGG - Intronic
932578227 2:72974429-72974451 GGAGGGGCTGGATGAGGGGAAGG - Intronic
933954963 2:87356180-87356202 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
934188224 2:89764297-89764319 GCAGCAGCTGGAGCAGCAGCTGG - Intergenic
934239152 2:90252394-90252416 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
934274031 2:91564304-91564326 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
934308382 2:91843657-91843679 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
934760994 2:96857144-96857166 ACAGCGGTAGGAGGGGCGGAGGG + Intronic
934775464 2:96934361-96934383 CCAGGGGCTGGAGGTGAGGATGG + Intronic
934856494 2:97733281-97733303 GCAGCCCCTGGGGGAGCAGAAGG - Exonic
935353874 2:102179995-102180017 GGAGGAGCTGGAGGAGGGGAGGG + Intergenic
935708285 2:105875328-105875350 GCAGCTGCTGGAGGTGCTGGCGG + Intronic
935804875 2:106735408-106735430 TAAGCGGCTGGAGGTGCAGAGGG - Intergenic
936378964 2:111967544-111967566 GCATCTGCTGGGGGAGGGGAAGG - Intronic
936452665 2:112645532-112645554 AGTGCGGCTGGAGGCGCGGACGG + Intergenic
936545985 2:113393796-113393818 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
937872155 2:126793616-126793638 ACAGAGGCAGGAGGAGAGGAGGG + Intergenic
937919693 2:127120519-127120541 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
938066018 2:128282498-128282520 GCTGCGGCCTGAGGAGCTGAGGG + Intronic
938774521 2:134529897-134529919 GCAGAAGCTGGAGGCGTGGAAGG + Intronic
940040878 2:149359285-149359307 GAAGCAGCTGGAGGAGAGTATGG + Intronic
941670118 2:168284035-168284057 GCAGCTGCAGGGGGAGGGGAAGG - Intergenic
942083985 2:172427672-172427694 GCAGCGGCGAGAGGAGGCGAAGG + Intronic
942125987 2:172826072-172826094 CCAACGGCTAGAGGAGTGGAAGG - Intronic
942241119 2:173964708-173964730 GCAGCAGCAGGAGGGGAGGAGGG - Intronic
943685871 2:190817692-190817714 CCAGAGGCTGGTGGAGAGGATGG + Intergenic
945379736 2:209126102-209126124 GCAGAGGCTGGAGGATGGGTGGG - Intergenic
946027331 2:216679695-216679717 TAAGCGGCAGGAGGAGGGGAGGG + Intronic
946169829 2:217888292-217888314 GGAGCAGATGGAGGAGAGGAGGG - Intronic
946240761 2:218354051-218354073 GCTGCGGCTGCAGCAGCGAAAGG - Intergenic
946243371 2:218370580-218370602 GCAGCGGTTGGAGGAGGCCAAGG + Intergenic
947380804 2:229543682-229543704 GCAGGGGGTGGAGGAGGGGCAGG - Intronic
947494002 2:230619663-230619685 GCTGTAGCTGGACGAGCGGAGGG + Intergenic
948526825 2:238575964-238575986 GCAGCGGCTGAAGGGACGCAGGG - Intergenic
948628589 2:239285786-239285808 GCAGCGGGTGGAGGACTGCATGG + Intronic
948716903 2:239871016-239871038 GGGGGGGCTGAAGGAGCGGAGGG + Intergenic
948741725 2:240052658-240052680 GGAGAGGCTGGAGGACCGGCAGG - Intergenic
948782341 2:240329515-240329537 GCAGAGGGTGGAGGAGGGGCTGG + Intergenic
948801373 2:240435125-240435147 GCGGCGGCTCGAGGCGCGGCCGG + Intergenic
948897855 2:240935510-240935532 GCAGCGGCAGGAGCAGCTGGAGG + Intronic
948995468 2:241576133-241576155 GCAGCGGGAGGAGGAGAGGGAGG - Intergenic
1169326584 20:4681707-4681729 GCAGGAGCTGGAGGAGAGGGTGG - Intergenic
1169506031 20:6212975-6212997 GCAGCCGCTGCCAGAGCGGAAGG + Intergenic
1170425172 20:16228429-16228451 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1171011862 20:21513353-21513375 GCTGCGGCTGCAGGAATGGAGGG + Intronic
1172117386 20:32581157-32581179 GCAGGGTATGGAGGAGAGGAGGG - Intronic
1172234167 20:33358673-33358695 GCAGAGACTGAAGGAGAGGAAGG - Intergenic
1172293316 20:33791262-33791284 GCTGGGGCTGGAGGAGCTGAAGG + Exonic
1172350063 20:34231356-34231378 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1172510520 20:35497778-35497800 ACAGCTGCTGGAGGAGCTGGAGG + Exonic
1173537249 20:43824890-43824912 ACAGCGGCTGGAGCTGCTGATGG + Intergenic
1173785948 20:45792700-45792722 GCACCGGCAGGTGCAGCGGAGGG + Exonic
1174199301 20:48795863-48795885 GCAGAGGCTGGTGGAGCAGGTGG - Intronic
1175620940 20:60446974-60446996 GCAGAGGCTGGAGGACTTGAGGG + Intergenic
1175900968 20:62359810-62359832 GCAGGGGCTGGCGCAGGGGAGGG - Intronic
1176135833 20:63521614-63521636 CCAGCTCCTGGAGGAGCGGGGGG - Intronic
1176231823 20:64036814-64036836 GCAATGGCTGGAAGAGCAGATGG - Intronic
1176378986 21:6102270-6102292 GCAGCGGGTGGATGAGCAGCCGG + Intergenic
1176592686 21:8658731-8658753 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1177178640 21:17721133-17721155 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1178045762 21:28692981-28693003 CCAGCAGCTGGAGGAGGGGGAGG + Intergenic
1178297711 21:31424623-31424645 CCAGGGGCTGGGGGAGCAGAGGG + Intronic
1178551524 21:33543320-33543342 GGAGCGGCTGGGGGGGCGGTTGG - Intronic
1178605545 21:34033664-34033686 GCAGAGACTGGAGGAGCGTAGGG + Intergenic
1178948458 21:36966804-36966826 GCTGCGGCGGGAGGGGCGGGGGG + Intronic
1179209616 21:39313830-39313852 GCAGCGAGTGGGGGAGGGGAGGG + Intronic
1179273392 21:39868877-39868899 GCAGAGGTTGGAGGAGGAGAGGG + Intronic
1179744488 21:43435967-43435989 GCAGCGGGTGGATGAGCAGCCGG - Intergenic
1180535468 22:16390737-16390759 ACAGCGGCTGGAGCAGCAGCTGG + Intergenic
1180593318 22:16958259-16958281 GCAGTGGGTGGAGCAGTGGAGGG + Intergenic
1180914885 22:19479143-19479165 GCGGCGGCTGGGAGAGCGGTCGG - Exonic
1180919872 22:19516161-19516183 GCAGCTGCTGCAGGACCTGAAGG + Intronic
1181354655 22:22291008-22291030 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
1181601124 22:23952410-23952432 ACTGAGGCTGGAGGAGGGGAGGG + Intergenic
1181607385 22:23988916-23988938 ACTGAGGCTGGAGGAGGGGAGGG - Intergenic
1181878023 22:25955283-25955305 GCGGCGCCTGGAAGAGCTGAAGG + Exonic
1182567686 22:31212315-31212337 GCGGCGGCGGCAGGAGCTGAGGG + Intronic
1183079673 22:35448406-35448428 CCAGCTGCTGGAAGAGGGGAGGG - Intergenic
1183280113 22:36927507-36927529 GCAGAGGCTGGGGGATCAGAAGG + Intronic
1183299548 22:37052081-37052103 GAAGCGGCAGGAGGAGGGGAGGG + Intronic
1183317607 22:37145555-37145577 GCAGGGGCTGGGTGTGCGGAGGG + Intronic
1183352955 22:37343953-37343975 GCAGTGGGTGGAGGGGCCGAGGG + Intergenic
1183358933 22:37373465-37373487 GCAGCGGCGGGGGCAGCGGCGGG - Exonic
1183440299 22:37819091-37819113 GAAGCGGCAGTAGGAGTGGATGG + Intergenic
1183841639 22:40502733-40502755 GCAGCGGCTGGAGAAGCAGACGG - Intronic
1183845104 22:40536419-40536441 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1184265362 22:43343318-43343340 GCAGCGCCTGCGGGAGCGGCCGG - Exonic
1184420982 22:44382789-44382811 GCAGGGGGTGGAGGAGCAGGAGG - Intergenic
1184422827 22:44391736-44391758 GCAGGGAGTGGAGGAGAGGAAGG - Intergenic
1184450078 22:44577536-44577558 GCAGGGGCTGGAGGACTAGAGGG - Intergenic
1184536211 22:45088835-45088857 GCTGCAGCTGCAGGAGAGGAGGG + Intergenic
1184660604 22:45963938-45963960 GCAGCTCCTGGAGGTGCGGGGGG - Intronic
1184763776 22:46561115-46561137 GGAGGGGCTCCAGGAGCGGAGGG + Intergenic
1184866154 22:47202763-47202785 GCAGCGGTGGGAGCAGCGGTGGG - Intergenic
1185015686 22:48341255-48341277 GCAGAGGCAGGTGGAGCGGATGG + Intergenic
1185226769 22:49657855-49657877 GCAGGGGCTGGAGGAAGGGCGGG - Intergenic
1185233027 22:49694143-49694165 GCAGGGGCTGGAGGGCTGGATGG - Intergenic
1185375772 22:50482036-50482058 GCAGCAGGTGGAGGCGTGGAGGG - Intronic
1185412820 22:50694938-50694960 GCAGCCGCTGGAGCAGCAGCTGG - Intergenic
949248923 3:1959205-1959227 GGAGGAGCTGGAGGAGCTGAGGG + Intergenic
950020945 3:9787274-9787296 GGACCTGCTGGAGGAGCAGAAGG - Exonic
950253870 3:11488326-11488348 GCAGCGGCTGGAGGAGCGGACGG - Intronic
950404646 3:12797002-12797024 GCAGGGACTGGAGTCGCGGAGGG - Intronic
950484122 3:13262877-13262899 GAAGTGGCTGGGGGAGGGGAGGG + Intergenic
950717728 3:14861749-14861771 GCAGCAGCAGCAGGAGCTGAGGG + Intronic
950854505 3:16092418-16092440 GCAGCGGCAGGTGGAGCTGGAGG - Intergenic
951013739 3:17705927-17705949 GCAGCGGCTGGAGGAGCGGACGG - Intronic
951055751 3:18144877-18144899 CCAGAGGCTGGAGGGGTGGAAGG - Intronic
951907901 3:27721930-27721952 GCGGCGGCTGCAGCGGCGGAGGG + Exonic
952302985 3:32120929-32120951 GCTGGGGCTGGAGGCGGGGAGGG + Intronic
952533447 3:34286128-34286150 GCAGCAGCAGCAGGAGTGGAAGG - Intergenic
954080519 3:48210843-48210865 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
954136039 3:48582647-48582669 GCAGCCCCTGGAGGAGAGGAAGG + Exonic
954222797 3:49164944-49164966 GCAGCAGCTGGAGAAACAGATGG - Intronic
954247044 3:49340141-49340163 ACAGCGGCTGCAGGAGCCGAAGG - Intronic
954671768 3:52294801-52294823 GCAGGGGCTGCAGGAGCTGAGGG + Intergenic
955297219 3:57746937-57746959 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
956217947 3:66869718-66869740 CCAAAGGCAGGAGGAGCGGAAGG - Intergenic
956270208 3:67443366-67443388 GCAGCGGCTGGAGGAGCGGACGG + Intronic
956964524 3:74443463-74443485 GCAGCCACTGAAGGAGGGGAGGG - Intronic
959042494 3:101438848-101438870 GCAGCGGCTGGAGGAGCGGACGG + Intronic
959419594 3:106112654-106112676 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
959808036 3:110581602-110581624 GGGACGGCTGGAGGAGTGGAGGG - Intergenic
960925686 3:122793616-122793638 GCTGGGGCTGGAGGGGAGGAAGG - Exonic
961743100 3:129046272-129046294 GGACCAGCTGGAGGAGCGGAAGG - Intergenic
961775332 3:129279810-129279832 GCAGCGGCTCCCGGAGTGGAGGG + Exonic
961869155 3:129975653-129975675 GCAGGGGCGGGAGCAGCGGCGGG - Intronic
962089770 3:132230845-132230867 TAAGCGTCTGGAGGAGCTGATGG - Intronic
965066098 3:163850637-163850659 GCAGGGGGTGGAGGGGAGGAGGG + Intergenic
965757223 3:172039657-172039679 GCGGCGGCGGGAGCAGCGAAGGG + Intronic
966304250 3:178513127-178513149 GGAGCAGGAGGAGGAGCGGAGGG - Intronic
966359448 3:179119472-179119494 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
967883185 3:194315773-194315795 CCAGCGGCTGGAGGAGCTCCGGG - Intergenic
968268134 3:197378353-197378375 TCAGCGACAGGAGGAGCAGACGG - Intergenic
968479869 4:828563-828585 GCATCTGCTGGAGGAGTTGAGGG + Intergenic
968489728 4:883567-883589 GCAGTGGCTGGTGGAGCTGCCGG - Intronic
968583701 4:1406342-1406364 GCAGCGGCGGCGGGAGCGGGCGG + Intergenic
968727605 4:2255599-2255621 GCAGCGGCTTCAGGAGGGGAGGG - Intronic
968763079 4:2452319-2452341 GCAGAGGGTGGAGCAGCAGAAGG + Exonic
968893618 4:3385722-3385744 GAAGGGGCTGGAGGAGAGCAGGG - Intronic
968903852 4:3442977-3442999 GCTGCGGCTGGAGGTCCTGAGGG + Intronic
969021789 4:4143886-4143908 GGAGCGGCTGGAGAAGTTGAGGG - Intergenic
969602670 4:8186158-8186180 GCAGCTGCTGGCGGAGGGGCTGG + Intronic
969606074 4:8202907-8202929 GCAGGGGCGGGAGGAGCCCACGG - Intronic
969732079 4:8963529-8963551 GGAGCGGCTGGAGAAGTTGAGGG + Intergenic
969791672 4:9497614-9497636 GGAGCGGCTGGAGAAGTTGAGGG + Intergenic
970369428 4:15392638-15392660 GCACCGGCAGAAGGAGCAGAGGG + Intronic
973230914 4:47837779-47837801 GCATCGGGCGGAGGAGAGGACGG + Intronic
973345727 4:49052941-49052963 GCAGGGGCTGGGGGAGATGAGGG - Intronic
975530837 4:75397510-75397532 GGAGAGGCTGGAGGAGAGGTTGG - Intergenic
975814708 4:78205727-78205749 GCAGCAGCAGGAAGAGGGGAGGG + Intronic
976002143 4:80386410-80386432 GCTGGGGCTGGAGGAGATGAAGG - Intronic
979238088 4:118424183-118424205 GCTGGGGCTGGAGGTGTGGAGGG - Intergenic
979832044 4:125315663-125315685 GCGGCGGCTGCAGGAGGGGAAGG + Intergenic
981093489 4:140756358-140756380 ACGGCGGCGGGAGGAGCGGGAGG + Intergenic
981550459 4:145937225-145937247 GGCGCGGGTGGAGGAGGGGAAGG + Intronic
982202597 4:152974859-152974881 GGAGGGGCTGGAGGGGCTGATGG - Exonic
982616106 4:157637774-157637796 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
985747684 5:1656400-1656422 GGAGGGGATGGAGGAGCTGAGGG - Intergenic
985814429 5:2116088-2116110 GCAGCTGCTGGAGGCACAGAGGG - Intergenic
985876873 5:2606667-2606689 GCAGCCGCTGGAGGAGCACCTGG - Intergenic
985896340 5:2751769-2751791 GCAGCGGGCGGAGCAGGGGAGGG - Intergenic
985897417 5:2757018-2757040 GGAGCTGCTGGAGGGACGGAGGG - Intergenic
986165919 5:5271396-5271418 GGAGGAGCGGGAGGAGCGGAAGG - Intronic
987096973 5:14558892-14558914 GGAGCAGCTGGAGCAGCAGAAGG + Intergenic
987313397 5:16701625-16701647 GCAGAAGCTGCAGGAGCGGCGGG - Exonic
989138361 5:38177499-38177521 GCAGAGGCTGGAGGATCGCTTGG - Intergenic
990214410 5:53514383-53514405 GCAGCGGCTGGAGGGGAAGGGGG + Intergenic
992349154 5:75911473-75911495 CCAGAGGCTGGAGGACTGGAGGG - Intergenic
992373713 5:76171055-76171077 GCAGCGGCTGGAGGAGCGGACGG + Intronic
992487421 5:77210362-77210384 GGAGCGGCGGGAGGGGCGGAGGG + Intergenic
994330261 5:98496626-98496648 GCAGAGGCGGGAGGAGGGAAAGG + Intergenic
995525695 5:113049114-113049136 GCCGCTGCTGGTGGAGCTGAGGG + Exonic
996814577 5:127560542-127560564 CCAGGGGCTGGGGGAGCGGGAGG + Intergenic
997013375 5:129904526-129904548 GCGGCAGCTGGAGGAGCTGCAGG - Exonic
997215852 5:132110117-132110139 GCAGAAGCTGGAGTAGGGGATGG + Intergenic
997575383 5:134971681-134971703 GAAGGGGCTAGAGGAGCAGATGG + Intronic
998038648 5:138937121-138937143 GCAGAGGATGGAGGAGCCCAGGG - Intergenic
998160727 5:139811407-139811429 GCAGGGGCTGGGGGAACGTAGGG + Intronic
998517337 5:142768489-142768511 ACAGGAGCTGGAGGAGTGGATGG - Intergenic
998799603 5:145856146-145856168 GCACCGACTGGAGCAGAGGAGGG - Intergenic
998874692 5:146587363-146587385 GCAGGGGATGGAGGAGAGGATGG + Intronic
999231114 5:150062424-150062446 CCAGGGGCTGGAGGAGGGAAAGG - Intronic
999322663 5:150624895-150624917 GCAGCGGCTGGAGGTGAGTGAGG + Intronic
1000343426 5:160294894-160294916 GCAGGAGCTGGAGGTGTGGAGGG - Intronic
1000679765 5:164168748-164168770 GCAAGGGCAGGAGGAGCGGGAGG + Intergenic
1000985240 5:167858825-167858847 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1001035128 5:168291932-168291954 CCGGCGGCGGGAGGAGCGGGCGG + Intronic
1001093775 5:168760760-168760782 GCAGAGGCTGGGGGAGAGGCCGG + Intronic
1001493128 5:172169415-172169437 GTAGGGGCTGGAGGAATGGATGG + Intronic
1001914651 5:175549453-175549475 GCAGAGGCTGGGGGAGTTGAGGG + Intergenic
1001960725 5:175879002-175879024 GCAGCAGGAGGAGGAGCGTAAGG + Exonic
1002320883 5:178375250-178375272 GCAGGGGCTGGGGGAGAGGAGGG + Intronic
1002341419 5:178518823-178518845 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1002661182 5:180792074-180792096 GCGGCGGCCGGAGCAGCGGCAGG - Exonic
1002738515 5:181416159-181416181 GCTGGGGCTGGAGGTGTGGAGGG - Intergenic
1002742404 5:181443279-181443301 GGAGCGGATGGAGGTGCGGTGGG + Intergenic
1003507607 6:6752442-6752464 GCAGGGGCTGGGGGATGGGAGGG + Intergenic
1004387941 6:15188442-15188464 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1005134853 6:22556322-22556344 GCATCTGCTGGAGTAGAGGAAGG - Intergenic
1005898061 6:30195244-30195266 GCAGGGGCGTGAGGAGAGGAAGG + Intronic
1006333981 6:33411010-33411032 GCAGCGGCAGGAGGAGGAGGCGG - Exonic
1006492123 6:34396975-34396997 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1006614675 6:35318306-35318328 GCAGCAGCTGCAGGAGGAGAAGG + Exonic
1007636830 6:43304763-43304785 GCAGGGGCTGGGAGAGCAGAAGG + Exonic
1007674435 6:43581573-43581595 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1010002024 6:70957267-70957289 ACCGCGGGTGGAGGAGCGGGAGG + Intergenic
1011405430 6:87010828-87010850 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1012981000 6:105830875-105830897 GAGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981008 6:105830896-105830918 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981016 6:105830917-105830939 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981024 6:105830938-105830960 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981046 6:105831000-105831022 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981079 6:105831085-105831107 GGGGAGGCTGGAGGAGGGGAAGG + Intergenic
1012981107 6:105831154-105831176 GGGGCAGCTGGAGGAGGGGAGGG + Intergenic
1012981115 6:105831175-105831197 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981123 6:105831196-105831218 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1012981145 6:105831260-105831282 GGGGCAGCTGGAGGAGGGGAAGG + Intergenic
1013078623 6:106793023-106793045 GCAGGAGCTGGAGGAGCTGTGGG - Intergenic
1013273562 6:108562239-108562261 GCAGTGTCTGGAGGAGGGGTTGG + Intronic
1014549925 6:122778744-122778766 GCAGGAACTGGAGGAGCGGTAGG - Intergenic
1014913842 6:127121046-127121068 GCACGGGCTGGAAGAGCGGATGG - Intronic
1015476532 6:133664285-133664307 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1015952641 6:138569091-138569113 GCAGCAGCTGCTGGAGGGGAGGG + Intronic
1017652472 6:156595994-156596016 GCAAAGGCTGGAGGAGCTGGAGG + Intergenic
1017807024 6:157954875-157954897 GAAGCGCCTGGAGCAGCCGAGGG + Intergenic
1017946568 6:159100914-159100936 GCAGTGGCTGGTGGAGCAAATGG + Intergenic
1018635267 6:165854774-165854796 AGAGCGACTGGAGGAGCGCAGGG + Intronic
1018801477 6:167226040-167226062 GTAGAGGCTGGGGGAGGGGAAGG - Intergenic
1018808500 6:167280282-167280304 GTAGAGGCTGGGGGAGGGGAAGG + Intronic
1018953882 6:168395258-168395280 GCTGCGGCTGGAGCAGCAGGCGG - Intergenic
1019083456 6:169452622-169452644 GCAGCCGCAGGAGGAGGGCAAGG + Intergenic
1019243618 6:170691711-170691733 GCTGGGGCTGGAGGTGTGGAGGG - Intergenic
1019247540 6:170719018-170719040 GGAGCGGATGGAGGTGCGGTGGG + Intergenic
1019473380 7:1232931-1232953 CCAGCGGCGGGAGGCGCGGGCGG - Exonic
1019496954 7:1345279-1345301 CCAGCGCCTGGAGGTGCGAATGG + Intergenic
1019688150 7:2393936-2393958 GCAGAAGCTGGAGGAGTTGAAGG - Intergenic
1019703233 7:2484674-2484696 GCAGCGGCTGTTGGATAGGACGG - Intergenic
1019803405 7:3105145-3105167 GCTGCAGTGGGAGGAGCGGAGGG - Intergenic
1019935994 7:4258328-4258350 GCAGCTGCAGGAGGAGGGGTGGG + Intronic
1020275460 7:6622119-6622141 GCAGCAGCTGGAGCAGCAGGAGG + Exonic
1020616635 7:10466448-10466470 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1021698990 7:23299544-23299566 GCCTGGGCTGGAGGAGCGGGCGG + Exonic
1021827923 7:24573289-24573311 GCGGCGGCTGGAGGAGGAGGAGG + Intronic
1021872141 7:25017950-25017972 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1022410274 7:30134847-30134869 GGGGCGGCGGGAGGAGCGGCCGG - Exonic
1022675434 7:32495331-32495353 GGAGCGGGGGGAGGAGCGGGGGG - Intergenic
1023287110 7:38631413-38631435 GGAGCGGGAGGAGGAGCGGGAGG + Exonic
1023529179 7:41135848-41135870 CCCGCGTCTGGAGGAGGGGAAGG + Intergenic
1023883493 7:44334910-44334932 CCAGTGGATGGAGGAGGGGACGG + Intergenic
1024644963 7:51363278-51363300 GCAGTGGCTGGGGGAGTGGTGGG + Intergenic
1025803513 7:64809289-64809311 GGGGCGGCTGGAGGGGCGGGGGG + Intronic
1027259899 7:76457377-76457399 GCAGTGGCAGGAGCAGCGGCAGG - Intergenic
1027282573 7:76619513-76619535 GCAGTGGCAGGAGCAGCGGCAGG + Intronic
1027311271 7:76955481-76955503 GCAGTGGCAGGAGCAGCGGCAGG - Intergenic
1027421233 7:78019740-78019762 GCAGCGCCTCGGGGAGCAGAGGG - Exonic
1029101783 7:98136873-98136895 TCAGAGACTGGAGGAGCTGAGGG + Intronic
1029216245 7:98952461-98952483 GCAGGGGCTGGAGGAGGGTGAGG - Intronic
1029494890 7:100891232-100891254 GCGGCCGCTGGAGGTGCGGCGGG - Exonic
1029701323 7:102248622-102248644 GCCGCGGCCGGCGGAGCAGACGG + Exonic
1031629706 7:124032397-124032419 GCAGCAGCAGCAGCAGCGGAGGG - Exonic
1031984573 7:128155233-128155255 TCAGCAGCTGGAGGAGTGCAGGG + Intergenic
1032078792 7:128848545-128848567 GAAGGGGCTTGAGGAGCAGAAGG - Exonic
1032819345 7:135510149-135510171 GGAGGGGCGGGAGGAGCGGCGGG + Intergenic
1033300025 7:140177066-140177088 GCGGCGGCTGGCGGAGGGGGAGG + Intergenic
1033582763 7:142751958-142751980 CCAGTGGCTGGAGGGGCGGTGGG - Exonic
1033584320 7:142762878-142762900 CCAGCAGCTGGAGGGGCGGTGGG - Intronic
1033705641 7:143882868-143882890 GCTGGAGCTGGAGGAGAGGAGGG + Intronic
1033899345 7:146116478-146116500 GCAGAGGCTGCAGAAGAGGAAGG - Exonic
1034275126 7:149820689-149820711 GCAGCGGCGGGGGCAGCGGTTGG - Intergenic
1034446661 7:151117216-151117238 GCAGGAGCTGGAGGAGTGGCCGG - Intronic
1034680383 7:152923932-152923954 GTGGCGGCTGGAGGAGCTGCTGG - Intergenic
1035045515 7:155963044-155963066 GCAGAGGGTGGATGAGCAGAGGG + Exonic
1035331093 7:158098034-158098056 GCACCGGCTCGAGGGACGGACGG - Intronic
1035500597 8:88918-88940 GGAGCGGATGGAGGTGCGGTGGG - Intergenic
1035504504 8:116449-116471 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic
1035508112 8:150610-150632 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1035667391 8:1389108-1389130 GCAGAGGCTGCAGGTGGGGAGGG + Intergenic
1036471690 8:9058133-9058155 GCAGGAGCTGGAGGAGAGGGCGG + Intronic
1036536877 8:9658321-9658343 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1037771361 8:21801987-21802009 GCAGCGTGCTGAGGAGCGGACGG - Intronic
1037886662 8:22599410-22599432 GGAGCGGCGAGAGGAGGGGAGGG - Intronic
1038410154 8:27352133-27352155 GCAGCGCTTGGAAGAGCAGAAGG - Intronic
1038450053 8:27634016-27634038 GAGGCGGCGGGAGGAGTGGAGGG - Intronic
1041453278 8:58030771-58030793 GCAGATGCTGGAGGAGAAGACGG + Intronic
1042048812 8:64685180-64685202 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1042902835 8:73746365-73746387 GTAGCGGCCGGAAGAGAGGACGG - Intronic
1043415737 8:80046944-80046966 GCAGCAGCGGGAGGAGGAGAAGG + Intronic
1043526061 8:81097538-81097560 GCAGAGGCTGGAGGAGGAGGTGG + Intronic
1044660463 8:94590210-94590232 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1045277764 8:100722428-100722450 GCAGGGGCGGGCGGGGCGGAAGG - Exonic
1045426980 8:102077128-102077150 GCAGAGGCTGGTGGAGGGGGTGG + Intronic
1045519025 8:102887093-102887115 GCAGCAGCTGGAGGAAGGCATGG - Intronic
1047285811 8:123486325-123486347 GCAGGCGGTGGAGGAGAGGAGGG + Intergenic
1047848274 8:128827147-128827169 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1048337650 8:133514929-133514951 GCATCTGCTGGGGGAGCGGGGGG - Intronic
1048426586 8:134329151-134329173 GTAGCTGCTGGAGGAGGGGTAGG - Intergenic
1049018377 8:139937501-139937523 GCAGCGGCTTCAGGAGCAGGCGG + Intronic
1049427913 8:142545509-142545531 GCAGAGGCAGGAGCAGAGGAGGG - Intergenic
1049464808 8:142746180-142746202 GGAGAGGCAGGAGGAGGGGAGGG - Intergenic
1049548521 8:143246047-143246069 CCTGCGGCGGGAGGAGCGGCAGG + Intergenic
1049580735 8:143409425-143409447 CCTGGGGCTGGAGGAGCTGATGG - Intergenic
1049681811 8:143922197-143922219 GCAGCGGCAGCAGCAGCAGATGG - Exonic
1049682267 8:143924720-143924742 GCAGCTGCTGGAGGAGGAGCTGG - Exonic
1049744481 8:144257441-144257463 ACAGGGGCTGTAGGAGCTGAGGG - Intronic
1049858892 8:144883668-144883690 GCAGTGGCAGGAGGAGGGGAGGG + Intronic
1051431788 9:16987018-16987040 GCAGCAGCAGGAGGAGAGGGTGG - Intergenic
1052059778 9:23946031-23946053 TCCTCGGCTGGAGGAGGGGAAGG + Intergenic
1052647338 9:31253860-31253882 GGAGCGGGTGGCGGAGCGGGCGG - Intergenic
1053146410 9:35715049-35715071 GCAGCGCCTGGAGGTGAGGCTGG - Exonic
1053256040 9:36616035-36616057 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1053457066 9:38241546-38241568 GCAGCGGCTGGAGGAGCGGACGG + Intergenic
1053692066 9:40591401-40591423 GCAGCGGCTGGACCAGGGAATGG + Intergenic
1053850773 9:42288054-42288076 GCAGTGGCGGGAGGTGCGTACGG + Intergenic
1054272733 9:63046084-63046106 GCAGCGGCTGGATCAGGGAAGGG - Intergenic
1054303324 9:63392367-63392389 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1054402103 9:64718877-64718899 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1054435709 9:65203192-65203214 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1054494684 9:65818495-65818517 GCAGCGGCTGGACCAGGGAAGGG - Intergenic
1055480006 9:76700220-76700242 GCTGAGGCTGAAGGAGGGGAGGG + Intronic
1055530380 9:77177650-77177672 GCGGCGGGAGGAGGAGCGCACGG + Exonic
1055574360 9:77647343-77647365 GCTGCGGGCGGAGGAGTGGACGG + Intronic
1056453503 9:86738917-86738939 GCAGAGACTCTAGGAGCGGAAGG - Intergenic
1056456535 9:86766168-86766190 GCAGCTGCAGGAGGAGGGGCAGG + Intergenic
1056712354 9:89001215-89001237 GCACCGGCTGGAGACGCGGCGGG - Exonic
1057075408 9:92135809-92135831 GCAGCTGGAGGAGGAGCAGATGG + Intergenic
1057869897 9:98709315-98709337 GCGGCAGCTGGCGCAGCGGAGGG - Intergenic
1058288227 9:103206382-103206404 GCAGCAGCTGGGGGGGAGGAGGG - Intergenic
1059104653 9:111501218-111501240 GCAGCGGAGGGAGGTGCGGTGGG + Intergenic
1059210858 9:112513706-112513728 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1060022852 9:120147174-120147196 GCAGGGGGTGGAGGAGCAGATGG - Intergenic
1060064777 9:120495059-120495081 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1060074562 9:120579910-120579932 TCAGCGGCTGCAGGTGCGGCCGG - Exonic
1060656949 9:125378488-125378510 GCAGCTGTGGGAGGAGCAGAGGG + Intergenic
1060856049 9:126915306-126915328 GCCGCGGCTGCAGGTGCGGGGGG + Intronic
1061035089 9:128108970-128108992 GCGGGGGCTGGAGGAGAGGGTGG + Exonic
1061045392 9:128162287-128162309 GCAGCCGGTGGAGGAGCTGGAGG - Intronic
1061431358 9:130533360-130533382 TCAGGGGCTGGAGGACAGGAGGG - Intergenic
1061447906 9:130651775-130651797 GCTGCGGCTGCAGCAGCGAAAGG - Intergenic
1061627279 9:131848506-131848528 GCTGCCGCTGGAGATGCGGATGG + Intergenic
1061761505 9:132855047-132855069 GCAGCGGGTGGAGGAAGGGCGGG - Intronic
1061800942 9:133113124-133113146 GCAGCGGGTAGAGGAGCCGGGGG + Intronic
1061858423 9:133455631-133455653 GCAGCTGCTGCAGGAGGGGTGGG + Intronic
1061958949 9:133978257-133978279 GCAGTGGCTGGAGTAGGAGAGGG - Intronic
1061984093 9:134119063-134119085 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1062122176 9:134839680-134839702 GCAGAGGCCGGAGGAGAGGCAGG + Intronic
1062214546 9:135382192-135382214 ACAGCGGATGGAGGAGGAGAGGG - Intergenic
1062475984 9:136727800-136727822 GAAGCAGCGGCAGGAGCGGAAGG + Intergenic
1062623669 9:137433663-137433685 GCAGCTGCTGGAAGAGGGGGTGG + Intronic
1062659176 9:137619283-137619305 GCGGCGGCTGGGGGAGCGGGCGG + Intronic
1203603807 Un_KI270748v1:40934-40956 GCTGGGGCTGGAGGTGTGGAGGG - Intergenic
1203608313 Un_KI270748v1:74498-74520 GGAGCGGATGGAGGTGCGGTGGG + Intergenic
1203622731 Un_KI270749v1:137537-137559 GCAGCGGCTGGACCAGGGAAGGG + Intergenic
1185644880 X:1609478-1609500 GCAGCGGCAGCAGGAGAGGAGGG - Intergenic
1186393995 X:9189499-9189521 GCAGCAGCTGGAGGAAGGCAGGG - Intergenic
1186655826 X:11610818-11610840 GGAGAGGTTGGAGGAGGGGATGG - Intronic
1186917954 X:14244130-14244152 GCAGCTGTTGGGGGAGGGGAGGG - Intergenic
1187172935 X:16869786-16869808 GCAGCCGCTGGAGGAGGGAAGGG + Exonic
1187976698 X:24710070-24710092 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1188308335 X:28586421-28586443 GGAGTGGGAGGAGGAGCGGAGGG - Intergenic
1188407220 X:29826544-29826566 CCAGGGGCTGGAGGTGGGGAGGG - Intronic
1189723946 X:43949916-43949938 GCAGTGACAGGAGGAACGGAAGG + Exonic
1190274110 X:48889427-48889449 GCAGAGGCAGGAGGAGCAAAAGG - Intergenic
1191618314 X:63190336-63190358 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1192205466 X:69093149-69093171 GCAGAAGCTGGAGGAGTGCATGG + Intergenic
1192621078 X:72680840-72680862 GCAGCGGCTGGAGGAGCGGACGG + Intronic
1195036323 X:100973394-100973416 GCAGCGGCTGGAGGAGCGGACGG - Intronic
1195884537 X:109625164-109625186 GCAGTGGCTGGGGGCGCCGACGG + Exonic
1196404617 X:115348270-115348292 GCAGCGGCTGGAGGAGCGGACGG - Intergenic
1197749121 X:129953038-129953060 GGAGAGGCTGGAGGGGTGGAGGG - Intergenic
1199772495 X:150983735-150983757 GCGGCGGCTGGGCGAGCAGAGGG + Intronic
1200111601 X:153743585-153743607 GCAGCGGCTGGAGCAGCAGCTGG + Exonic
1200136756 X:153879015-153879037 GCAGCAGTGGGAGGAGAGGAGGG - Intronic
1200181179 X:154151547-154151569 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1200186824 X:154188661-154188683 GCAGGTGGTGGAGGAGCGGCTGG + Intergenic
1200192475 X:154225799-154225821 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1200198230 X:154263603-154263625 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1201565856 Y:15364839-15364861 CCAGGGGCTGGGGGAGGGGATGG - Intergenic
1202385868 Y:24325979-24326001 GCTGGGGCTGGAGGTGTGGAGGG - Intergenic
1202484918 Y:25344149-25344171 GCTGGGGCTGGAGGTGTGGAGGG + Intergenic