ID: 959419595

View in Genome Browser
Species Human (GRCh38)
Location 3:106112658-106112680
Sequence GGAGGCAGCGGCTGGAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1821
Summary {0: 69, 1: 2, 2: 12, 3: 180, 4: 1558}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419595_959419605 -1 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC 0: 69
1: 2
2: 12
3: 180
4: 1558
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419595_959419607 2 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC 0: 69
1: 2
2: 12
3: 180
4: 1558
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309
959419595_959419601 -6 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC 0: 69
1: 2
2: 12
3: 180
4: 1558
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419595 Original CRISPR GGAGGCAGCGGCTGGAGGAG CGG (reversed) Intergenic
900112524 1:1014565-1014587 TGAGGCGGACGCTGGAGGAGGGG - Intergenic
900366318 1:2313294-2313316 GGAGGTAGGGGCTGGAGGCAGGG + Intergenic
900372413 1:2337822-2337844 GGAGGCAGGGGCTGGGGCGGTGG + Intronic
900521114 1:3106000-3106022 GGAAGCTGGGGCTGGAGGACAGG - Intronic
900604231 1:3516682-3516704 GCAGGCAGCGGCTGGAGCAGCGG + Intronic
900725839 1:4215972-4215994 AGAGGCAGGGGGTGGTGGAGAGG - Intergenic
900744353 1:4351145-4351167 GAAGGCAGCGGCAGGAGGCTTGG + Intergenic
900932456 1:5745927-5745949 GGATGCTGTGGCCGGAGGAGCGG - Intergenic
901025618 1:6277338-6277360 GTTGGCAGCGGCTGCAGGCGTGG - Intronic
901040685 1:6361310-6361332 GGGGGCAGGGGCTGGAGGAGGGG + Intronic
901061919 1:6475538-6475560 GAGGGCAGAGGCTGGAGGTGTGG + Intronic
901130412 1:6959302-6959324 GGAGGCTGGGGCAGGTGGAGGGG + Intronic
901142128 1:7042132-7042154 GAAGTCAGAGGCTGGAGGAGGGG - Intronic
901145457 1:7061751-7061773 GGAGAGAGAGGCTGGAGTAGGGG + Intronic
901642967 1:10702370-10702392 GGAGGCAGGTGGTGGATGAGAGG - Intronic
901643027 1:10702626-10702648 GGAGGCAGTGCTGGGAGGAGAGG + Intronic
901689083 1:10960903-10960925 GGGGGAAGGGGCTGGAGGGGAGG + Intronic
901696469 1:11011819-11011841 GGGGGGAGGGGCTGGAGGACAGG + Intergenic
901819335 1:11816685-11816707 GGAGGCAGGGCCTGGAGGGATGG + Intronic
902410038 1:16207061-16207083 GGAAGGAGCTGCTGGGGGAGAGG + Exonic
902764857 1:18607276-18607298 GGAGGGAAAGGCTGGAGAAGGGG + Intergenic
902953547 1:19907610-19907632 AGAAGAAGCGGCAGGAGGAGAGG + Exonic
902973265 1:20070520-20070542 GGAGGGAGAGACTGGAGAAGGGG + Intronic
903241783 1:21987521-21987543 GGAGGCTGAGGCAGGAGGATCGG + Intronic
903245292 1:22010690-22010712 GGAGGCTGAGGCAGGAGGATCGG + Intronic
903281216 1:22251035-22251057 GGAGGGACCGGCGGGAGGGGAGG - Intergenic
903328728 1:22586147-22586169 GGAGACAGGGCCTGGGGGAGGGG + Intronic
903358944 1:22765003-22765025 GAGGGCAGAGGCTGGAGGACAGG + Intronic
903475990 1:23619558-23619580 GGCGGCGGCGGCTGGCGGGGAGG - Intronic
903514861 1:23903334-23903356 GGAGGCTGAGGTGGGAGGAGCGG + Intronic
903526499 1:23994991-23995013 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
903596785 1:24501775-24501797 GGAGGCAGAGGTGGGAGGATCGG - Intergenic
903923420 1:26817421-26817443 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
903977696 1:27161970-27161992 GGAGGGCGAGGCTGGAGGATCGG - Intronic
903996183 1:27306748-27306770 GCTGGCAGCAGCAGGAGGAGTGG + Exonic
904035423 1:27556229-27556251 GGAGGCAGTGGGTGGGGGAGGGG - Intronic
904415745 1:30360162-30360184 GGAGGAACAGGCTGGAGGATGGG - Intergenic
904610975 1:31726156-31726178 TCAGGCAGCAGCTGGAGCAGAGG - Intergenic
904794821 1:33051291-33051313 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
904892481 1:33789586-33789608 GGAGGCAGGGGGTTGTGGAGTGG + Intronic
905014994 1:34771774-34771796 AAAGGGAGCGGCTGGAGCAGTGG - Intronic
905036716 1:34923479-34923501 GGAAGCAGCTGCTGGAACAGTGG + Intronic
905167058 1:36088922-36088944 GGCGGCAGCGGCAGGTGGAGGGG + Exonic
905172091 1:36115368-36115390 GGCAGCAGCGGCAGCAGGAGGGG + Intronic
905275539 1:36815450-36815472 GGAGGCAGCGGCTGGGAGATGGG + Intronic
905295694 1:36953187-36953209 TGAGGCAGGGGCAGGGGGAGGGG - Intronic
905394989 1:37661197-37661219 GGAGGCAGAGGCGGGAGGCCTGG - Intergenic
905553076 1:38859517-38859539 GGCGGCGGCGGCGGGCGGAGGGG - Exonic
905647241 1:39633170-39633192 GGAGGCGGCAGCTGCAGGCGGGG - Intronic
905779067 1:40691907-40691929 GGAAGCGGCGGCGGGGGGAGGGG + Intronic
905991103 1:42337440-42337462 GGAGGCTGAGGCAGGAGGATAGG + Intergenic
906034095 1:42740210-42740232 GGCGGCAGCGGCTGGAGCAAAGG + Exonic
906193184 1:43912103-43912125 GGTGGCAGTGGCTGGAGATGAGG + Intronic
906436925 1:45804017-45804039 GGAGGCAGCGGCTGGAGGAGCGG + Exonic
906486651 1:46240452-46240474 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
906524255 1:46485384-46485406 GCAGGTAGCGGCTGGAGTAAGGG + Intergenic
906814836 1:48868013-48868035 GGAGGCTGCAGCTGGTGAAGTGG + Intronic
906948685 1:50316923-50316945 GGTGGCAGGGGCTGGCGGGGGGG + Intergenic
907066048 1:51484005-51484027 GGAGGCTGAGGCAGGAGGATTGG + Intronic
907069290 1:51519299-51519321 GGAGGGAGCGGCCGCAGGCGAGG + Exonic
907429996 1:54406161-54406183 GGAGCCAGCGCCTGGGGGGGAGG - Exonic
907453920 1:54563091-54563113 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
907517823 1:55004442-55004464 GGAGGCAGTGGGTGAGGGAGAGG - Intronic
907732072 1:57076261-57076283 GGAGGCAGAGGGTGAAGGAAAGG + Intronic
907809349 1:57852716-57852738 GGATGCTGGGGCAGGAGGAGAGG - Intronic
907913642 1:58849052-58849074 GAAGGCAGCGGGTGCAGGAGAGG - Intergenic
908995413 1:70146722-70146744 GGAGGCAGGGGGTGGAGCAGTGG - Intronic
909801360 1:79812671-79812693 GGAGGCAGGGGCAGAAGCAGTGG + Intergenic
909824618 1:80111592-80111614 GGAGGGAGTGGCTGGAGCCGTGG - Intergenic
909837052 1:80269034-80269056 GGAGGCAGAGGTGGGAGGATTGG + Intergenic
910288639 1:85579919-85579941 AGAGGGAAGGGCTGGAGGAGTGG + Intergenic
910558389 1:88562796-88562818 GGAGGCAAGGGCTGGAGAATAGG - Intergenic
910679115 1:89844103-89844125 GGCAGCAGCAGCTGGAGGAGAGG - Intronic
910993985 1:93084750-93084772 GGAGGCTGAGGCAGGAGGATTGG + Intronic
911219738 1:95234174-95234196 GGAGGCGGCGGCTGCGGCAGCGG + Exonic
911678159 1:100683018-100683040 GGGGGCAGAGGGTGGAGGATGGG - Intergenic
911721199 1:101193146-101193168 GGAGGCTGAGGCAGGAGGACTGG + Intergenic
912204436 1:107494585-107494607 GCAGGTAGGGGCTGGAGGAGGGG - Intergenic
912412169 1:109487052-109487074 GCTGGCAGGGGCTGGAGGTGGGG - Exonic
912413629 1:109494051-109494073 GGCGGTGGCGGCTGCAGGAGAGG - Intronic
912468874 1:109892942-109892964 GGAGCCGGCTGCTGGAGGAGAGG - Intergenic
912776773 1:112510436-112510458 GGAGGCACTGCCTGGTGGAGAGG - Intronic
912825483 1:112899341-112899363 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
912844661 1:113068764-113068786 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
912878364 1:113385652-113385674 GGTGGCAGAGGGTGGAGAAGAGG - Intergenic
912961140 1:114196927-114196949 AGAGGCAGAGATTGGAGGAGGGG + Intergenic
912974470 1:114315439-114315461 GGAGGCAGAGGTGGGAGGATAGG - Intergenic
913104048 1:115595465-115595487 GAAAGCAGCGGGTGGAGGAAGGG + Intergenic
913972332 1:143424298-143424320 GGAGGCTGCAGACGGAGGAGTGG - Intergenic
914066714 1:144249911-144249933 GGAGGCTGCAGACGGAGGAGTGG - Intergenic
914112439 1:144716443-144716465 GGAGGCTGCAGACGGAGGAGTGG + Intergenic
914798875 1:150945132-150945154 GGAGGCAGAGGTTGGTGGGGGGG + Intronic
914802287 1:150970597-150970619 GGAGGCTGAGGCAGGAGGGGAGG - Intronic
914842351 1:151258809-151258831 GGAGGCTGAGGCAGGAGAAGGGG + Intronic
914919205 1:151836336-151836358 GGAGGCAGCAGCTGGCAGTGGGG + Intergenic
915083847 1:153370935-153370957 GGAGTCAGGGGTTGGAGGACAGG + Intergenic
915140528 1:153765114-153765136 GGAGTCAGCGTGTGGAAGAGAGG - Intronic
915286863 1:154858807-154858829 GGAGGCTGAGGCGGGAGGATCGG - Intronic
915379871 1:155430859-155430881 GGAGGCTGAGGCTGGAGGATTGG - Intronic
915556742 1:156665008-156665030 GGTGGCAGTGGCGGCAGGAGCGG + Intergenic
915589122 1:156860758-156860780 GTAGGAAGCGGGTGGAGAAGAGG + Intronic
915997158 1:160575146-160575168 GGAGGCAGTGGGTGGAGAAGAGG - Intronic
916049145 1:161022933-161022955 GGAGGCTGAGGCAGGAGGGGAGG + Intronic
916108193 1:161445628-161445650 GGAGGGAGCGGCTGGAGCTGCGG + Intergenic
916109779 1:161453008-161453030 GGAGGGAGCGGCTGGAGCTGCGG + Intergenic
916111366 1:161460419-161460441 GGAGGGAGCGGCTGGAGCTGCGG + Intergenic
916112952 1:161467799-161467821 GGAGGGAGCGGCTGGAGCTGCGG + Intergenic
916179319 1:162070128-162070150 GGAGGCGGCGGCTGCAGGAAGGG - Exonic
916220293 1:162437350-162437372 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
916332067 1:163628324-163628346 GGAGGGAGGGGGAGGAGGAGGGG - Intergenic
916507238 1:165439303-165439325 GGAGGAGGGGGGTGGAGGAGAGG + Intronic
916725455 1:167518493-167518515 GGAGGCAGAGGCTGAGGCAGCGG + Exonic
917205454 1:172566383-172566405 GATGGCAGTGACTGGAGGAGAGG - Intronic
917818572 1:178736795-178736817 GGAGGCTGAGGCTGGAGAATTGG + Intronic
917951284 1:180039292-180039314 GGAGGGAGGGGAGGGAGGAGAGG + Intronic
918006130 1:180543772-180543794 GGAGGCTGAGGCTGGAGAATCGG - Intergenic
918086021 1:181246022-181246044 GGAGGGACCGGCTGGAGCTGCGG + Intergenic
918265678 1:182839556-182839578 GGCGGCGGCGGCTGGGGGTGGGG + Intronic
918388740 1:184036984-184037006 CGAGGGAGCCGCTGGAGGGGCGG - Intronic
918453276 1:184681536-184681558 GGAGGGACCGGCTGGAGGTGAGG - Intergenic
918536226 1:185577809-185577831 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
918600062 1:186347801-186347823 GGAGGGAGCAGCTGGAGCCGTGG + Intronic
918849942 1:189674877-189674899 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
919464358 1:197912171-197912193 GGAGGCGGCGGCCAGAGGTGCGG - Intronic
919680750 1:200432153-200432175 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
920016797 1:202917541-202917563 GGATGCAGCGGTTGGAAGGGAGG - Intronic
920150852 1:203906225-203906247 GGAGGCTGAGGCAGGAGGATGGG - Intergenic
920223991 1:204424796-204424818 GGTGGCAGGAGCTGGGGGAGAGG - Exonic
920273147 1:204782217-204782239 GGAGGCTGAGGCAGGAGGACTGG + Intergenic
921023742 1:211259322-211259344 GGCGGCGGCGGAGGGAGGAGGGG + Intronic
921298682 1:213728711-213728733 GGAGGTAGTGGTGGGAGGAGGGG + Intergenic
921414445 1:214870447-214870469 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
922098793 1:222465269-222465291 GCAGGCAAGGGCAGGAGGAGGGG + Intergenic
922340526 1:224651466-224651488 GGGGACAGTGGCTGGAGGAAAGG - Intronic
922449162 1:225722859-225722881 GGAGGCTGAGGCAGGAGGACTGG + Intergenic
922513145 1:226186471-226186493 GGAGGCGGCGGCTGGGGGCGCGG - Exonic
922562396 1:226578737-226578759 GGAAGCAGCCGCTGCAGGGGTGG - Intronic
922664930 1:227460543-227460565 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
922765879 1:228156641-228156663 GGAGGCAGCAGCGGCAGGTGTGG - Intronic
922816714 1:228454293-228454315 GCTGCCAGGGGCTGGAGGAGAGG - Intergenic
922934152 1:229410921-229410943 GGTGGTAGCAGCTGCAGGAGGGG - Intergenic
922989804 1:229896981-229897003 GGAGGAAGCCTCTGGAGAAGGGG + Intergenic
923017866 1:230140578-230140600 GGAAGCACAGGCTGGAGGAAGGG - Intronic
923380714 1:233415059-233415081 GGAGGCTGAAGCTGGAGGATGGG + Intergenic
923549917 1:234955379-234955401 GTTGGGAGCAGCTGGAGGAGGGG + Intergenic
924441883 1:244093024-244093046 GGAGGTTTCGGCTGAAGGAGCGG - Intergenic
924539897 1:244970760-244970782 GGAGGACGGGGCGGGAGGAGGGG - Exonic
924650246 1:245919409-245919431 GGAGGCTGAGTGTGGAGGAGAGG - Intronic
924800331 1:247325152-247325174 GGAAACAGCAGCTGCAGGAGTGG + Intronic
924941050 1:248812645-248812667 GGAAGCAGGAGCTGGTGGAGAGG - Intronic
1062797248 10:353762-353784 GGAAGCAGCGGCTGGGGGGCTGG + Intronic
1062932802 10:1363790-1363812 GGAAGCGGCCGCTGGAGGAGGGG - Exonic
1062950859 10:1502204-1502226 GGGGGCAGCAGGTGCAGGAGGGG - Intronic
1063115010 10:3067160-3067182 AGGGGCAGCGTCCGGAGGAGGGG - Intronic
1063455728 10:6181579-6181601 GGAGGCTGAGGCGGGAGGATTGG + Intronic
1063905623 10:10777540-10777562 CAAGGCAGAGGCAGGAGGAGAGG - Intergenic
1063938948 10:11107821-11107843 GGGGGCAGAGGAGGGAGGAGGGG - Intronic
1063958646 10:11287970-11287992 TGTGGCAGCAGCTGGAGGAAGGG - Intronic
1064047805 10:12033785-12033807 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1064319405 10:14288785-14288807 GGTTGCAGGGGCTGGAGGAGAGG - Intronic
1064619531 10:17201381-17201403 GGAGTCAGCGTCTGGAGGGGTGG + Intronic
1064950507 10:20843959-20843981 GGACACAGTGGCAGGAGGAGAGG - Intronic
1065011510 10:21425177-21425199 GGAGGCCGAGGCTTGAGGATGGG - Intergenic
1065099084 10:22316245-22316267 GTAGGCGGCGGCTGGGGGCGCGG + Exonic
1065112870 10:22457066-22457088 GGAGGCTGAGGCAGGAGGATAGG - Intergenic
1065114888 10:22475952-22475974 TGGGGCAGAGGCTGGTGGAGAGG + Intergenic
1065377889 10:25061306-25061328 AGAGCAGGCGGCTGGAGGAGCGG - Intronic
1065436383 10:25707486-25707508 GGAGGCAGCATCAAGAGGAGAGG - Intergenic
1065497847 10:26348458-26348480 GGAGGGACCGGCTGGAGCTGCGG + Intergenic
1065712756 10:28533221-28533243 GGCGGCGGCGGGGGGAGGAGGGG + Intronic
1065902312 10:30219720-30219742 GGAGGGAGTGGCCGGGGGAGAGG + Intergenic
1066037896 10:31512206-31512228 GGTGGCAGCAGCTGCAGGATGGG - Intronic
1066290855 10:34013208-34013230 GGAGGCAGCTGCAGGAGCAGGGG - Intergenic
1066399272 10:35058954-35058976 GGAGGAAGTGACTGGAGGTGTGG + Intronic
1067018706 10:42776464-42776486 GGAGGCAGGGTCTGGGTGAGAGG - Intergenic
1067200992 10:44171950-44171972 GCAGGCAGCGCAAGGAGGAGGGG + Intergenic
1067443481 10:46326405-46326427 GGTGGCAGTGCCAGGAGGAGGGG + Intronic
1067689780 10:48494364-48494386 GGCGACTGCTGCTGGAGGAGAGG - Intronic
1068316544 10:55351050-55351072 GGAGGCAGCAGCGGGGGGAGGGG - Intronic
1069639528 10:69945749-69945771 GGGGGCAGGGGTGGGAGGAGAGG - Intronic
1069677128 10:70256180-70256202 GGAGGCTGAGGTGGGAGGAGAGG - Intronic
1069712385 10:70498086-70498108 GGTGCCAGGGCCTGGAGGAGAGG - Intronic
1069792201 10:71029973-71029995 GGGGGCAGGGGGTGGGGGAGTGG + Intergenic
1069817586 10:71208414-71208436 GGTGCCAGGGGCTGGGGGAGGGG + Intergenic
1069849669 10:71396835-71396857 GGAGGGAGCTGCGGGAGGCGGGG + Intergenic
1070114350 10:73514456-73514478 GGAGGCTGAGGCAGGAGAAGTGG + Intronic
1070239338 10:74662517-74662539 GGAGGCTGAGGCGGGAGGACTGG - Intronic
1070318254 10:75334222-75334244 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1070333336 10:75433119-75433141 GGAGGGAGGGGCTGGACAAGAGG + Intronic
1070427659 10:76304922-76304944 GAAGGCAGGGGCTGGGGCAGAGG + Intronic
1070608081 10:77913690-77913712 GGAGGCTGAGGCGGGAGGATTGG - Intronic
1070608907 10:77919868-77919890 GGTGGCAGAGGCTGTGGGAGAGG - Intronic
1070747785 10:78945205-78945227 GGAGGGAGAGGGTGGTGGAGCGG + Intergenic
1070751430 10:78966215-78966237 GGAGACAGTGTCTGGAGCAGTGG - Intergenic
1070757362 10:79001662-79001684 GGTGGCAGTGGCTGGCGGTGGGG + Intergenic
1070815232 10:79318598-79318620 GGTGTCAGGGGCTGGGGGAGGGG - Intergenic
1070823741 10:79379235-79379257 GGAGGCAGCCCCTGGAAGGGTGG + Intergenic
1071490701 10:86134619-86134641 GGAGGGAGTGGCTGGAGCTGAGG - Intronic
1071520444 10:86328890-86328912 GGAGGTAGAGGCTGGGGGTGGGG - Intronic
1071974063 10:90937479-90937501 GGAGTCTGAGGCTGGAGGATTGG + Intergenic
1072161354 10:92770308-92770330 GGAAGCAGAGGCGGGAGGATTGG - Intergenic
1072563581 10:96599040-96599062 GGAGGGAGTGACTGGAGGAAGGG + Intronic
1072628879 10:97132188-97132210 GGAGGCTGTGGCTGGCAGAGGGG - Intronic
1072710631 10:97713767-97713789 GGAGGCCGCGGCGGGCGCAGCGG + Exonic
1072726639 10:97818053-97818075 GGGGTCAGCTGGTGGAGGAGAGG + Intergenic
1072805166 10:98419401-98419423 GGAGGGAGAGACAGGAGGAGAGG + Intronic
1072870712 10:99116802-99116824 GAAGGTAGGGGCTGCAGGAGAGG + Intronic
1072931132 10:99663697-99663719 GGAGGCCGAGGCAGGAGGATAGG - Intronic
1072950125 10:99840150-99840172 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1073051160 10:100668228-100668250 GGGGGGAGGGGCGGGAGGAGGGG - Intergenic
1073079015 10:100845462-100845484 GGAGGCTGAGGCGGGAGGATGGG - Intergenic
1073094091 10:100969494-100969516 AGGGGCCGCGGCTGGAGGCGGGG - Intronic
1073137689 10:101228900-101228922 GCAGGCAGCGGCGGGTGGAAAGG + Exonic
1073212651 10:101817854-101817876 GGTGGCCGGGGCTGCAGGAGGGG - Exonic
1073364979 10:102932286-102932308 GGAGGCCAAGGCTGGAGGATCGG - Intronic
1073373048 10:103007959-103007981 GGAGGGACCGGCTGGAGCCGCGG - Intronic
1073531014 10:104232101-104232123 GGAGGGAGAGGAGGGAGGAGGGG + Intronic
1073563450 10:104516334-104516356 GGAGGCAGCTGTTGGAGGAGGGG - Intergenic
1073739622 10:106392155-106392177 GGAGGCAGAGGCAGGTGCAGTGG + Intergenic
1074574903 10:114659411-114659433 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1074748491 10:116559708-116559730 GGAATTAGAGGCTGGAGGAGTGG + Intronic
1074893616 10:117755944-117755966 GGGGGTGGGGGCTGGAGGAGTGG - Intergenic
1075047837 10:119159936-119159958 GTAGGCTGAGGCTGGAGGATGGG + Intronic
1075058494 10:119237931-119237953 GGAGGAAGGGGCTGGAGTTGAGG + Intronic
1075237443 10:120743754-120743776 GGAGGCAGAGGCTGGGGGGTGGG + Intergenic
1075417803 10:122278228-122278250 GGAGGCAGTGGCCTGAGGGGTGG + Intronic
1075697596 10:124448044-124448066 GGAGGCCGCGGCTGCGGGAGCGG - Exonic
1076031704 10:127164468-127164490 GGAGGCAGGGCCGGGAGCAGTGG - Intronic
1076146483 10:128126282-128126304 AGAGGCGGCGGCGGGAGCAGCGG - Exonic
1076374054 10:129971888-129971910 GGCGGCGGCGGGAGGAGGAGCGG - Intergenic
1076655886 10:132023009-132023031 GGAGGCCGTGGCTGGAGGACCGG + Intergenic
1076719123 10:132385426-132385448 AGAGGGAGCAGGTGGAGGAGAGG - Intergenic
1076760915 10:132605363-132605385 GGGGGAAGCGGCTGGGGGATGGG + Intronic
1076873565 10:133205156-133205178 GGGCGTAGAGGCTGGAGGAGGGG - Intronic
1077015986 11:399392-399414 GGAGGGGGCAGGTGGAGGAGTGG - Intronic
1077026170 11:441009-441031 GGAGGAAGGGGCTGGCAGAGGGG + Intronic
1077221651 11:1420656-1420678 GGAGGAAGAGGCTGGAGCTGGGG - Intronic
1077251923 11:1564530-1564552 GGAGGCAGCAGCTGGAAGCTGGG + Intronic
1077252890 11:1568364-1568386 GTGGGCAGGGGCTGGAGGGGCGG + Intronic
1077307525 11:1874734-1874756 GGAGGCTGCAGACGGAGGAGTGG + Intronic
1077377823 11:2213626-2213648 GGTGTCAGGGGCTGGGGGAGGGG - Intergenic
1077499998 11:2905044-2905066 GGAGGCATGGACAGGAGGAGAGG + Intronic
1077602393 11:3582453-3582475 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
1077678534 11:4219037-4219059 GGAGTCAGAGGCTGGAGGTCAGG - Intergenic
1077682096 11:4251295-4251317 GGAGTCAGAGGCTGGAGGTCAGG + Intergenic
1077687937 11:4315440-4315462 GGAGTCAGAGGCTGGAGGTCAGG - Intergenic
1077874675 11:6294106-6294128 GGAGGCAGGGGCAGGGGAAGGGG + Intergenic
1078535946 11:12174359-12174381 GTAGGCAGGGGCTGGGGGTGGGG - Intronic
1078804598 11:14685244-14685266 GGAGGGACCGGCTGGAGCTGCGG - Intronic
1078844629 11:15110107-15110129 GGAGGCTGAGGCAGGAGGATAGG - Intergenic
1079129342 11:17738323-17738345 GTGGGGAGGGGCTGGAGGAGGGG + Intronic
1079443505 11:20538396-20538418 GGAGGCACCGGCTGGAGCCGAGG + Intergenic
1079634948 11:22725660-22725682 GGAGGCCGAGGCAGGAGGATTGG - Intronic
1080237890 11:30092847-30092869 GGAGGGAGGGGAGGGAGGAGAGG - Intergenic
1080361208 11:31516005-31516027 GGAGGCAGAGGCAGGAGAATGGG + Intronic
1080418742 11:32092055-32092077 GGAGGCCGAGGCGGGGGGAGGGG + Intronic
1080478321 11:32619567-32619589 GGAAGCGGGGGCAGGAGGAGTGG + Intronic
1080740785 11:35062752-35062774 GGAGGCAGAGGATGGAAGAAAGG - Intergenic
1080994906 11:37587759-37587781 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
1081459309 11:43256862-43256884 GCAGGCAGAGGCGGGTGGAGGGG + Intergenic
1081623762 11:44634721-44634743 GGAGGGAGGGGAAGGAGGAGGGG - Intergenic
1081758627 11:45561763-45561785 GGAGGCTGAGGCAGGAGGATGGG - Intergenic
1081784954 11:45739199-45739221 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1081810940 11:45913881-45913903 GGAGGGAGCGGCGGGAGCTGCGG - Exonic
1082096817 11:48137719-48137741 GGAGGCAAGGGTGGGAGGAGTGG + Intronic
1082635929 11:55593677-55593699 GGATGCTGAGGCTGGAGGATGGG + Intergenic
1082716617 11:56621596-56621618 GGTTGCAGCGGCTGGAGGAAAGG + Intergenic
1082774268 11:57233913-57233935 GGGGGCAGAGGGAGGAGGAGAGG - Exonic
1083261417 11:61525056-61525078 GGAAGCACAGGCAGGAGGAGAGG - Intronic
1083275378 11:61594224-61594246 GGAGGCCGAGGCAGGAGGATTGG - Intergenic
1083467673 11:62859587-62859609 GGAGGCTGAGGCAGGAGAAGTGG + Intronic
1083472216 11:62891493-62891515 GGAGGCAGAGGAAGGAGGAAAGG - Intergenic
1083595597 11:63917207-63917229 GGAGGCATCGGCTGGGGGAGGGG - Intergenic
1083616092 11:64027366-64027388 GGAGGCAGGGGCTGCAGGGATGG + Intronic
1083660235 11:64248715-64248737 GGAGGCTGAGGCCGGAGGAGGGG - Intergenic
1083678362 11:64340338-64340360 GGTGGCAGCGGGTTGGGGAGGGG + Intronic
1083692485 11:64418807-64418829 GGTGCCAGGGGCTGGGGGAGGGG + Intergenic
1083729088 11:64643344-64643366 GGAGGGAGCGGCCGGGGGAGGGG + Intronic
1083768626 11:64854270-64854292 GGAGGCAGAGACGGGGGGAGGGG - Exonic
1083849074 11:65354921-65354943 GGGGGCAGGGGCTGGAGCCGCGG + Exonic
1083883457 11:65559178-65559200 GCTGGCAGCGGCTGGGGGTGGGG + Intergenic
1083950606 11:65953587-65953609 AGCGGCAGCGGCAGGAGGAGCGG + Exonic
1084155000 11:67308362-67308384 AGGAGCAGAGGCTGGAGGAGAGG + Intronic
1084163723 11:67365323-67365345 CCAGGCAGCGGCTGGGGCAGTGG + Exonic
1084258287 11:67957000-67957022 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
1084267067 11:68010554-68010576 GGAGAAAGCGGAAGGAGGAGAGG + Intronic
1084274466 11:68044408-68044430 GGAGCCAGAGGCTGGAAGTGAGG - Intronic
1084501021 11:69535386-69535408 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
1084736394 11:71108382-71108404 GCAGGCAGTGGGAGGAGGAGAGG - Intronic
1084789292 11:71463351-71463373 GGAGGCAGCGGCTGCAGCTCTGG - Intronic
1084814459 11:71638210-71638232 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
1084860284 11:72013699-72013721 AGAGCCAGAAGCTGGAGGAGAGG - Exonic
1084950997 11:72665398-72665420 GGAGGCAGGGGCTGGATGGGAGG - Intronic
1084960838 11:72715489-72715511 GGAGGCAACAGCAGGAGGAAAGG - Intronic
1084970296 11:72767921-72767943 GGGGCCTGGGGCTGGAGGAGGGG - Intronic
1085272446 11:75278314-75278336 GCAGGCAGCTGGTGGAGGTGTGG + Intronic
1085304463 11:75477265-75477287 ACAGGCAGGTGCTGGAGGAGAGG - Intronic
1085535037 11:77212516-77212538 TCAGGCTGCGGGTGGAGGAGGGG + Intronic
1087207466 11:95412114-95412136 GGGGGCTGGGGCTGGAGGTGGGG - Intergenic
1088456085 11:110034376-110034398 GGAGGCAACAGCTGGTGCAGAGG - Intergenic
1088481866 11:110302070-110302092 GGAGGCTGAGGCTGGAGAATTGG - Intergenic
1088484280 11:110325681-110325703 GGAGGCAGCAGCTGCTGGTGCGG + Intergenic
1088539216 11:110895814-110895836 GGAGGAATCGGTTGAAGGAGAGG - Intergenic
1088548273 11:110984009-110984031 GGAGGCAGAGGCTGGTGGATTGG + Intergenic
1088558524 11:111088304-111088326 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1088582726 11:111331301-111331323 GGAGGGAGGGGCAGGAGGAGGGG - Intergenic
1089507717 11:118975221-118975243 GGAGGGAGGGGTTGGATGAGTGG + Intronic
1089646043 11:119879807-119879829 AAAGGCAGGGGCTGGAGAAGAGG + Intergenic
1089648105 11:119893615-119893637 GGAAGCTGCGGCTGGAGAAGTGG + Intergenic
1089692815 11:120197460-120197482 GGAGCTAAAGGCTGGAGGAGGGG - Intergenic
1089768947 11:120788859-120788881 GATGGCAGCAGGTGGAGGAGCGG - Intronic
1089850102 11:121488277-121488299 GGAGGGAGAGGCAGGAGGCGAGG - Intronic
1090032661 11:123220580-123220602 GGAGGCAGTGGAGCGAGGAGAGG - Intergenic
1090096269 11:123744303-123744325 GGAGGCTGAGGCTGGTGGATCGG - Intergenic
1090616770 11:128522273-128522295 CGAGGCAGCCGCCGGCGGAGAGG - Intronic
1090660220 11:128876852-128876874 GGAAGCAGCTGCTTGGGGAGTGG - Intergenic
1090991411 11:131820189-131820211 GGATCCAGTGGCTGCAGGAGAGG - Intronic
1091301584 11:134511212-134511234 GGAGGCATCAGCTGTAGCAGTGG + Intergenic
1091356589 11:134942276-134942298 GGAGGCAGTGGGAGGAGAAGGGG - Intergenic
1091387267 12:103307-103329 GGAGGAGGCGGCTGTGGGAGAGG + Intronic
1091410393 12:235281-235303 GGAGGCAGGGGCAGGAGGCAGGG + Intronic
1091453024 12:585459-585481 GCAGGCAACGGTTGGAGGAAGGG + Intronic
1091601081 12:1918143-1918165 GAGGGCAGGGGCGGGAGGAGTGG + Intronic
1091601211 12:1918640-1918662 GGAGACAGGGACTGGGGGAGAGG + Exonic
1091636134 12:2198288-2198310 GGAGGCAGAGGCGGGGAGAGAGG - Intronic
1091664786 12:2411375-2411397 GGAGTGAGGGGCTGGAGGTGGGG + Intronic
1091695157 12:2623396-2623418 GGAGACAAGGGCTGGAGGACGGG - Intronic
1091718542 12:2795927-2795949 GGAGGCGGCGGAGGGGGGAGGGG - Intronic
1091762443 12:3096020-3096042 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1091768624 12:3137649-3137671 GGAGGACGCAGCTGGAGCAGGGG - Intronic
1091794095 12:3287513-3287535 GGACACAGCAGCTGCAGGAGGGG - Intergenic
1091974242 12:4811637-4811659 GCAGGCAGGGCCTGCAGGAGGGG + Exonic
1092098144 12:5861304-5861326 GGAGGCAGGGGAAGGAGGAATGG + Intronic
1092162614 12:6324288-6324310 GGAGGCGGCGGGGGGGGGAGGGG - Intronic
1092210459 12:6643011-6643033 GGAGGCCGAGGCAGGAGGATTGG + Intronic
1092256392 12:6928478-6928500 GGAGGCGGCGGCGGCAGGAGGGG - Intronic
1092284512 12:7121122-7121144 GCAGGGAGCCGCTGGAGGGGTGG + Intergenic
1092428538 12:8391805-8391827 GGAGGCAGAGGAGGCAGGAGAGG + Intergenic
1092429624 12:8397957-8397979 GGAGGCAGAGGAGGCAGGAGAGG + Intergenic
1092664385 12:10779237-10779259 GGAGGCAGAGGGAGCAGGAGAGG + Intergenic
1092864185 12:12745424-12745446 GGAGGCTGAGGCTGGAGAATCGG + Intronic
1092878746 12:12871462-12871484 GGAGGCTGAGGCTGGAGAATTGG + Intergenic
1092931018 12:13315837-13315859 GGAGGCAACAGGAGGAGGAGTGG - Intergenic
1093438921 12:19170495-19170517 GGAGGCAGAGGTTGCAGGAGTGG - Intronic
1093703062 12:22244688-22244710 GGAGGCCGAGGCTGGTGGACTGG - Intronic
1093863164 12:24192809-24192831 GGGGGAAGAGGCTGGAGGACAGG - Intergenic
1094155436 12:27333087-27333109 GGAGGCTGCGGCGGGAGGTGAGG + Exonic
1095095133 12:38143268-38143290 GGAGGTGGCGGCAGGAGAAGTGG - Intergenic
1095119766 12:38403596-38403618 GGAGGCTGAGGCAGGAGGACTGG - Intergenic
1095162861 12:38937235-38937257 GGTGGCAGCTGCTTGGGGAGAGG + Intergenic
1095439344 12:42227150-42227172 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1096022485 12:48333788-48333810 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1096073692 12:48789279-48789301 GGAGGAAGCGGCCGGAGGAGAGG - Intergenic
1096098787 12:48956667-48956689 GGAGGCAGGAGAAGGAGGAGGGG - Intronic
1096148613 12:49295314-49295336 GCAGGCGGCTGCTGGAGAAGCGG - Exonic
1096221000 12:49828133-49828155 GGAGGGTGCGGCTGGAGGGAGGG + Intronic
1096337072 12:50764439-50764461 GGGCGCAGCGGCAGGGGGAGGGG + Intronic
1096524496 12:52202518-52202540 GGAGGCTGGAGTTGGAGGAGCGG - Intergenic
1096731381 12:53615773-53615795 GGAGGCTGAGGCAGGAGGACTGG + Intronic
1096796777 12:54082625-54082647 GGAGGCGGGGGCGGGAGGGGAGG + Intergenic
1096812645 12:54181577-54181599 GGAGGCTGCAGCTGGATCAGAGG - Exonic
1097035031 12:56118343-56118365 GGAGGCCGCGCCCGGAGGGGAGG + Intronic
1097207526 12:57335599-57335621 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1097233720 12:57526569-57526591 GGAGGCAGCTGGTGGGGCAGGGG - Exonic
1098146526 12:67503259-67503281 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1098483354 12:70991891-70991913 GGAGGCAGGGGAAGGAGGAATGG - Intergenic
1098649876 12:72951927-72951949 GAAAGCAGCCGGTGGAGGAGAGG - Intergenic
1098898014 12:76084620-76084642 GGCGGCAGCGGCAGCAGCAGCGG + Exonic
1098968691 12:76824737-76824759 GGAGGCAGAGGCAGGAGGATTGG + Intronic
1099202187 12:79690287-79690309 GGAGGCAGCGGCCGGAGCCCTGG - Exonic
1099203456 12:79701907-79701929 GGAGGCTGAGGCAGGAGGACTGG - Intergenic
1099433733 12:82619417-82619439 GGAGGCAGGGCCTGGAACAGGGG - Intergenic
1099956087 12:89353630-89353652 GGAGGAGGCGGCGGCAGGAGAGG - Intergenic
1100396200 12:94188425-94188447 GGAGGCTGCGGCAGGAGAATCGG - Intronic
1100494881 12:95115339-95115361 GGAGGCAGAGGCAGGATGATTGG - Intronic
1100869361 12:98894717-98894739 AGAGGCAACGGCTAGGGGAGCGG - Intronic
1100921618 12:99494627-99494649 GGAGGCTGAGGCAGGAGGATGGG + Intronic
1101111380 12:101489887-101489909 GGTGACAGAAGCTGGAGGAGGGG + Intergenic
1101344960 12:103878499-103878521 GGAAGAAGAGGCTTGAGGAGGGG - Intergenic
1101635358 12:106535860-106535882 GAAGGCAGCAGCCAGAGGAGTGG - Intronic
1101650618 12:106674084-106674106 CGAGGGAGTGGCAGGAGGAGAGG - Intronic
1101870660 12:108562776-108562798 GGAGGCCTGGGCTGGAGGGGCGG + Intronic
1102226372 12:111231209-111231231 GGTGCCAGGGGCTGGGGGAGAGG - Intronic
1102280853 12:111617797-111617819 GGAGGCGGAGGTTGCAGGAGCGG - Intergenic
1102310659 12:111842248-111842270 TGAGGCGGCGGCGGGAGCAGCGG + Intronic
1102450006 12:113034645-113034667 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1102468162 12:113142635-113142657 GGAGGCAGCGGTGGCAGGAGTGG + Intergenic
1102578389 12:113871836-113871858 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1102645467 12:114400875-114400897 GGAGGCTTCGGCTGGAGAACGGG + Intronic
1102646181 12:114405441-114405463 GGCCGCCGCGGCTGGCGGAGCGG - Intronic
1102909193 12:116699705-116699727 GGTGGTGGCGGCTGGAGAAGGGG - Intergenic
1103377908 12:120470673-120470695 GGAGGCCAAGGCTGGAGGATCGG - Intronic
1103573331 12:121858980-121859002 TGAGGCTGCGGCTGGATCAGAGG - Intronic
1103621440 12:122189662-122189684 GGAGCCAGAGGCTGGAGGGCTGG - Intronic
1103910603 12:124349984-124350006 GGCGGAAGTGGATGGAGGAGAGG + Intronic
1103953454 12:124564582-124564604 TCAGACAGCGGCAGGAGGAGGGG + Intronic
1103997380 12:124839218-124839240 GGTGCCAGGGGCTGGGGGAGAGG - Intronic
1104003392 12:124874897-124874919 GGTGCCAGGGGCTGGGGGAGAGG + Intronic
1104006271 12:124894876-124894898 GCTGCCAGAGGCTGGAGGAGGGG - Intergenic
1104140725 12:125983915-125983937 GGCGGCAGCTCCTGTAGGAGGGG + Intergenic
1104388724 12:128373902-128373924 GCAGGCAGCTGCTGCAGGAATGG - Intronic
1104421175 12:128636769-128636791 GGTGCCAGCGACTGGGGGAGGGG - Intronic
1104432810 12:128730380-128730402 GGAGGCAGAGGCAGGAGAATCGG + Intergenic
1104535339 12:129613348-129613370 GGAGACAGTGGATAGAGGAGCGG - Intronic
1104609796 12:130218816-130218838 AGACGAAGAGGCTGGAGGAGCGG + Intergenic
1104686578 12:130788792-130788814 GCGGGCAGGGGCGGGAGGAGGGG + Intergenic
1104710443 12:130982086-130982108 GGAGGCTCTGCCTGGAGGAGTGG + Intronic
1104755259 12:131265147-131265169 GGTGCCAGGGGCTGGGGGAGTGG + Intergenic
1104853457 12:131890324-131890346 GGTGCCAGGGGCTGAAGGAGGGG + Intergenic
1104886142 12:132109756-132109778 GGTGCCAGGGGCTGGGGGAGGGG - Intronic
1104989568 12:132618330-132618352 GGAGGCAGGAGCTGGAAGCGAGG + Intergenic
1105541286 13:21319542-21319564 GCACCCAGCGGCTGGAGCAGGGG + Intergenic
1105561824 13:21499512-21499534 GGAGGCAGAGGCAGGAGAATTGG - Intronic
1106102645 13:26708057-26708079 GGAGGCAGTGGCAGGGGCAGGGG - Intergenic
1106105169 13:26726619-26726641 GGAGGCAGTGGCTGGAAAGGAGG - Intergenic
1106303975 13:28494573-28494595 CGAGGGAGCGCCTCGAGGAGTGG - Intronic
1106366937 13:29090657-29090679 GTAGGCAGGGACTGCAGGAGAGG + Intronic
1107133471 13:36920169-36920191 CGAGACAGCGGCTGCAGCAGCGG + Exonic
1107283735 13:38765812-38765834 GGAAGCAGAGGCTGGGGGTGAGG - Intronic
1107321978 13:39199428-39199450 GGAGGCTGAGGCAGGAGAAGGGG + Intergenic
1107344165 13:39441222-39441244 GGAGGGAGAGGCAGGAGGATAGG - Intronic
1108010574 13:46004294-46004316 GGAGGCAGAGGAGGGAGGGGTGG + Intronic
1108318699 13:49264617-49264639 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1108375179 13:49807747-49807769 GATGGCAGTGGCTGGAGAAGGGG - Intergenic
1108538051 13:51406628-51406650 AGAGGTAGGGGGTGGAGGAGAGG - Intronic
1108861291 13:54862520-54862542 GAAGGCAGTGGCAGGAGGAGAGG + Intergenic
1108916870 13:55624674-55624696 GGAGGGACCGACTGGAGGCGAGG - Intergenic
1108954243 13:56132500-56132522 AGAGGCAGAGGCTGAGGGAGGGG + Intergenic
1109302236 13:60601127-60601149 GGAGGCAGCGGAGGCAGGAGAGG - Intergenic
1109606327 13:64702857-64702879 GGAGGCAGAGGCTGAGGCAGGGG - Intergenic
1110119751 13:71866501-71866523 GGAGGCGGCGGCGGCAGCAGCGG - Exonic
1110212952 13:72994142-72994164 GGAGGTAGAGGCCGGAGGCGGGG + Intronic
1110229082 13:73149703-73149725 GGAGGCTGAGGCAGGAGGGGAGG + Intergenic
1110269177 13:73574255-73574277 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1110752974 13:79137212-79137234 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1110782394 13:79481357-79481379 GGAGACCGCGGCTGCAGGAACGG + Exonic
1112441853 13:99430137-99430159 GGTGCCAGGGGCTGGGGGAGGGG - Intergenic
1112740484 13:102467493-102467515 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1112917752 13:104572199-104572221 AGAGGCAGGTGCTGGGGGAGAGG - Intergenic
1113078538 13:106492429-106492451 GTTGCCAGCGGCTGGAGGAGGGG + Exonic
1113335301 13:109371084-109371106 GGAGGCTGCAGCTCCAGGAGAGG + Intergenic
1113618011 13:111694753-111694775 GGAGACAGCGGAGAGAGGAGAGG - Intergenic
1113618022 13:111694812-111694834 GGAGACAGCGGAGAGAGGAGAGG - Intergenic
1113623544 13:111780014-111780036 GGAGACAGCGGAGAGAGGAGAGG - Intergenic
1113623555 13:111780073-111780095 GGAGACAGCGGAGAGAGGAGAGG - Intergenic
1113660868 13:112105587-112105609 GGAGGCGGAGGGAGGAGGAGGGG + Intergenic
1113745228 13:112739956-112739978 GTTGGCAGGGGCTGGGGGAGGGG + Intronic
1113868213 13:113543048-113543070 GGAGGCAGGGGGAGGAGGTGGGG - Intronic
1113970456 13:114185037-114185059 GGTGGAAGCAGCTGCAGGAGTGG + Intergenic
1114866039 14:26597243-26597265 GGAGGCAGGGGCGGGCGGCGGGG + Intronic
1115028269 14:28766934-28766956 GGAAGCAGCGGGGGGGGGAGCGG + Intergenic
1115320812 14:32077334-32077356 GGAGGCGGCGGCGGCGGGAGCGG + Exonic
1115399313 14:32939402-32939424 GGCGGCGGCGGCGGGAGCAGCGG - Intronic
1115548393 14:34483654-34483676 GGAGGCTGAGGCAGGAGGTGAGG - Intergenic
1115592178 14:34874871-34874893 TGAGGCGGCGGCAGGACGAGAGG - Intronic
1115609548 14:35038521-35038543 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1115886756 14:37980779-37980801 GGAGGGAGCAGCTGGAGCTGTGG + Intronic
1116478670 14:45371024-45371046 GGAGAGAGAGGCTGGGGGAGAGG - Intergenic
1116871640 14:50073936-50073958 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1116945464 14:50831235-50831257 TCAGGCAGCGGAGGGAGGAGCGG + Intergenic
1117737049 14:58778103-58778125 GGAGGGAGGTGCTGAAGGAGGGG - Intergenic
1117981655 14:61347915-61347937 GGAGGCAGTGGGGTGAGGAGAGG + Intronic
1118183143 14:63513584-63513606 GGAGGCAGGGGATAGAGGTGGGG + Intronic
1118371890 14:65144440-65144462 AGAGGCATCGGGTGGAGGGGAGG + Intergenic
1118493321 14:66283182-66283204 GGAGGCAGAGGCAGGAGAATTGG - Intergenic
1118766686 14:68914660-68914682 GGAGGCAGAGGCAGGAGGACTGG + Intronic
1118967402 14:70600775-70600797 AGAGGCAGGGGGTGGAGGTGCGG + Intergenic
1119254523 14:73184667-73184689 GGACGGAGCGGCTGGCGGGGCGG + Intronic
1119286412 14:73458401-73458423 GGAGGCGGAGGCCGGAGGAAGGG - Intronic
1119299761 14:73562213-73562235 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
1119519991 14:75278409-75278431 GGGGGCCGCGGCTGGGGGAGGGG - Intergenic
1119706423 14:76785532-76785554 GAAGGCAGAGGCTGGTGGTGGGG - Intergenic
1119728263 14:76935390-76935412 GGAGACAGGGGCTGGAGTGGAGG - Intergenic
1119732032 14:76957128-76957150 GGAGGCTGGGGCTGAGGGAGGGG - Intergenic
1119735242 14:76977451-76977473 TGAGGCAGACCCTGGAGGAGTGG - Intergenic
1119736308 14:76984941-76984963 GGAGGAAGCTGATGGAGGAGGGG - Intergenic
1119748279 14:77059793-77059815 GTGGGGAGCAGCTGGAGGAGCGG + Intergenic
1120598904 14:86475941-86475963 GGAGGCAGAGGCGGGTGGGGTGG + Intergenic
1120697184 14:87657639-87657661 GGAGGAAGGGGCTTCAGGAGAGG + Intergenic
1120924498 14:89784142-89784164 GGAAGCAGGGGCTGACGGAGTGG + Intergenic
1121051703 14:90823137-90823159 GGAGGGACCGGCTGGAGCTGCGG + Intergenic
1121075623 14:91065897-91065919 GGATGCAGCAGCTGGAAGTGAGG + Intronic
1121270193 14:92632697-92632719 GGAGGGAGCGGCTGGAGTGGGGG - Intronic
1121310186 14:92931599-92931621 GGAGGCTGAGGCTGGAGAGGAGG + Exonic
1121346953 14:93143274-93143296 GGAGGCAGAGGCAGGAGGATTGG + Intergenic
1121432134 14:93895114-93895136 GGAGGCAGCCCCATGAGGAGGGG - Intergenic
1121570012 14:94940449-94940471 TGAGGCAGGGGCTGGGGGTGGGG + Intergenic
1121755246 14:96396991-96397013 GGAGGCTGAGGCCGGAGGATTGG + Intronic
1121798558 14:96755080-96755102 GGGAGCAGCTGCTGCAGGAGTGG + Intergenic
1122010327 14:98741266-98741288 GGAGAGAGCGGCGGTAGGAGGGG + Intergenic
1122077501 14:99245768-99245790 GGAGGCGACTGGTGGAGGAGGGG + Intronic
1122140432 14:99660018-99660040 GGAGGCTCCGGGTGGAGGCGGGG - Intronic
1122483882 14:102065495-102065517 GGAGGCTGAGGCTGGAGGATTGG - Intergenic
1122610838 14:102982346-102982368 GGAGGCCCTGGCTGGAGGACAGG + Intronic
1122622743 14:103068975-103068997 TGACGCAGGGGATGGAGGAGAGG - Intergenic
1122964023 14:105112720-105112742 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1123016334 14:105377331-105377353 GGAGGCAGAGGCAGGTGGGGAGG + Intronic
1123430781 15:20214269-20214291 GGAGGCTGGGGCAAGAGGAGAGG + Intergenic
1123468659 15:20534232-20534254 GGCTGCAGGAGCTGGAGGAGAGG - Intronic
1123649455 15:22466830-22466852 GGCTGCAGGAGCTGGAGGAGAGG + Intronic
1123662961 15:22581464-22581486 GGAGGCTGAGGCGGGAGGAATGG - Intergenic
1123722383 15:23070903-23070925 GGAGGCTGAGGCTGGAGAATTGG + Intergenic
1123728977 15:23129443-23129465 GGCTGCAGGAGCTGGAGGAGAGG - Intronic
1123747141 15:23326908-23326930 GGCTGCAGGAGCTGGAGGAGAGG - Intergenic
1123806257 15:23877143-23877165 GGATGGAGAGGCTGGAGAAGAGG + Intergenic
1123892233 15:24793439-24793461 GGATGGAGAGGCTGGAGAAGAGG + Intergenic
1123975884 15:25554197-25554219 GGAGGCAGTGGCTGGAGTGACGG + Intergenic
1124034886 15:26045924-26045946 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1124225726 15:27893131-27893153 GGAGGGACCGGCTGGAGCCGTGG + Intronic
1124279410 15:28350224-28350246 GGCTGCAGGAGCTGGAGGAGAGG - Intergenic
1124303288 15:28561384-28561406 GGCTGCAGGAGCTGGAGGAGAGG + Intergenic
1124316763 15:28675767-28675789 GGAGGCTGAGGCGGGAGGAATGG - Intergenic
1124322347 15:28724559-28724581 GGAGGCAGAGCCTGGAGTGGTGG - Intronic
1124347779 15:28933969-28933991 GGGGGCATGGGCTGGAGGTGGGG + Intronic
1124420600 15:29517996-29518018 GGAGGCTGAGGCAGGAGGATGGG + Intronic
1124458121 15:29863351-29863373 GGAGGTAGAGGCTGGAGGAAGGG + Intronic
1124532188 15:30517824-30517846 GGCTGCAGGAGCTGGAGGAGAGG + Intergenic
1124595176 15:31086227-31086249 GGAGGAAGGGACGGGAGGAGAGG + Intronic
1124658217 15:31525452-31525474 GGAGGCCCCGGCTGGAAAAGAGG - Intronic
1124766465 15:32489821-32489843 GGCTGCAGGAGCTGGAGGAGAGG - Intergenic
1124962393 15:34408752-34408774 GAAGGCAGCCACTGGAGCAGAGG - Intronic
1124971186 15:34490710-34490732 GGCGTCGGCGGCTGGAGCAGAGG - Intergenic
1124979017 15:34554974-34554996 GAAGGCAGCCACTGGAGCAGAGG - Intronic
1125180868 15:36880197-36880219 AAAGGAGGCGGCTGGAGGAGGGG - Intergenic
1125301030 15:38253087-38253109 GGAGGCAGCGGCGGCCGGGGGGG - Exonic
1125509044 15:40283056-40283078 GGCGCCAGCAGCTTGAGGAGCGG - Intronic
1125659004 15:41381909-41381931 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1125808776 15:42518521-42518543 GGAGGCTGACGCTGGAGGATAGG - Intronic
1125852814 15:42920716-42920738 GGCGGCGGCGGCGGCAGGAGGGG - Intronic
1125853070 15:42922638-42922660 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
1125874019 15:43128151-43128173 GGAGGGACCGGCTGGAGCCGTGG + Intronic
1125953441 15:43773579-43773601 GGAGGCTGCGGCAGGAGAATGGG + Intronic
1126600253 15:50421244-50421266 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1126697911 15:51341460-51341482 GGAGGCAGCCTGCGGAGGAGGGG - Intergenic
1127269389 15:57387091-57387113 GGAGGGAGTGGCTGGGGGAAGGG - Intronic
1127291630 15:57576176-57576198 GGAGCCAGCGGCTTGAGTGGAGG - Intergenic
1127456251 15:59158558-59158580 GGTGGGAGGGGCTGGAGGACAGG + Intronic
1127811364 15:62568211-62568233 GGAGGGAGCGGCAGGAGGGGAGG + Intronic
1128119296 15:65133717-65133739 GGAGGCGGCGGCTGCGGGGGCGG + Exonic
1128256325 15:66199683-66199705 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1128551051 15:68598189-68598211 GTAGGCAGCCCCTGGAGAAGAGG + Intronic
1128704705 15:69830353-69830375 TGAGGCAGGGGCTGCAGGTGGGG + Intergenic
1128736658 15:70057489-70057511 ATAGGCAGCGGCTGCAGCAGCGG + Exonic
1128830433 15:70763473-70763495 GACGGCAGCGGCTGCAGCAGAGG + Exonic
1128937860 15:71763470-71763492 GGAGGCCGAGGCAGGAGGATTGG + Intronic
1128982954 15:72199615-72199637 TGGGACAGGGGCTGGAGGAGGGG + Exonic
1129043191 15:72708327-72708349 GGAGGGACCGGCTGGAGCTGTGG + Intronic
1129232132 15:74202819-74202841 GCAGGCTGAGGCTGGGGGAGGGG - Exonic
1129253864 15:74323017-74323039 GGAGGTATGGGCTGGAGCAGGGG - Intronic
1129265675 15:74391995-74392017 GAGGGCAGAGGCTGGAGGTGTGG - Intergenic
1129288054 15:74541373-74541395 GGAGGCTGCGACAGGTGGAGGGG + Intronic
1129325196 15:74796488-74796510 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1129327553 15:74809141-74809163 GGATGAAGGGGCTGGAGAAGAGG + Intergenic
1129421651 15:75432613-75432635 GGAGGCAGAGGTTGCATGAGGGG + Intronic
1129428272 15:75480782-75480804 CGAGGCAGCGGCTGGAGGAGCGG + Intronic
1129447028 15:75625747-75625769 TGAGGCAGCAGCTGGGGGCGGGG - Intronic
1129672110 15:77613233-77613255 AGAGCCAGGGGCTGGAGGTGGGG - Exonic
1129770978 15:78203516-78203538 GGAGGAAGCGGCAGAGGGAGAGG - Intronic
1129903450 15:79169477-79169499 GGAGGCAGGGGCTGGAGCTAGGG + Intergenic
1129918060 15:79292447-79292469 GGAGGCAGAGAATGGAGAAGAGG - Intergenic
1130064095 15:80590636-80590658 GGAGGCTGAGGCTGGAGGATTGG + Intronic
1130192534 15:81750427-81750449 GGAGGCAGAGGCGGAAGCAGAGG + Intergenic
1130920115 15:88336687-88336709 GCACGGAGAGGCTGGAGGAGGGG + Intergenic
1131014155 15:89043514-89043536 GGAGGAAGAGGAGGGAGGAGGGG + Intergenic
1131076288 15:89496744-89496766 GGGGACAGCGGCAGGAGCAGAGG + Intergenic
1131181175 15:90241108-90241130 GGAAGCAGCGGGTGGAGCTGGGG + Exonic
1131455250 15:92578601-92578623 GGAGGCTGGGGCTGGAGGGCTGG - Intergenic
1131478553 15:92762626-92762648 GGAGTCAGAGGCTGGAAGATAGG - Intronic
1131657449 15:94476415-94476437 GGAAGCAGGGGCTGGTGAAGAGG - Intronic
1131969940 15:97881767-97881789 AGAGGCAGAGGCAGCAGGAGAGG + Intergenic
1132079292 15:98851261-98851283 GGGGCCAGATGCTGGAGGAGAGG + Intronic
1132243551 15:100278124-100278146 GTTGGCAGGGGCTGGGGGAGAGG + Intronic
1132392295 15:101447823-101447845 TCAGGCACCGGCTGGAGAAGCGG - Intronic
1132483437 16:177631-177653 AAAGGCAGGGGCGGGAGGAGGGG + Intergenic
1132554164 16:565355-565377 AGGGGCAGGGGCTGCAGGAGAGG - Exonic
1132561264 16:595322-595344 GGAGGCGGCAGCTGTAGGGGTGG + Intronic
1132579820 16:679823-679845 GGAGGCGGCGGCTGGGGGCGGGG + Intronic
1132599697 16:768040-768062 GGAGGGGGCGCGTGGAGGAGGGG + Intronic
1132627126 16:896602-896624 GTGGGCAGCGCCTTGAGGAGTGG - Intronic
1132670109 16:1099048-1099070 GGTGGCAGCTGCAGGAGGGGTGG - Intergenic
1132709169 16:1258869-1258891 GGAGGCTCAGGATGGAGGAGGGG - Exonic
1132771576 16:1566688-1566710 GGAGGCAGGGGCTGGCAGAAGGG - Intronic
1132915203 16:2340377-2340399 CGAGGCCGCGGCAGGAGGGGCGG + Intronic
1132989903 16:2787182-2787204 GGGGGCTGAGGATGGAGGAGGGG - Intronic
1133031358 16:3012781-3012803 GTGGGCAGCGGATGGATGAGGGG - Exonic
1133113384 16:3562971-3562993 GGGGGCAGGGGCTGGGGAAGGGG - Intronic
1133200022 16:4198373-4198395 GGAGCCCCAGGCTGGAGGAGAGG - Intronic
1133213737 16:4277875-4277897 GGAGGCAGAGGTTGCAGTAGTGG + Intergenic
1133231617 16:4369699-4369721 GGAGGGATGGGCTGGAGGGGAGG - Intronic
1133234468 16:4381485-4381507 GGCTGCAGCAGCTGGACGAGGGG + Exonic
1133292941 16:4734682-4734704 GGAGGCAGAGGCCTGAGGTGAGG + Exonic
1133340226 16:5031171-5031193 GGAGGCCGAGGCGGGAGGATCGG - Intronic
1133392831 16:5423021-5423043 GGAGGAAGGGGAGGGAGGAGTGG + Intergenic
1133441970 16:5828593-5828615 GGAGGCCGAGGCAGGAGGATCGG + Intergenic
1133507429 16:6425955-6425977 GTAGCCAGGGGCTGGGGGAGGGG - Intronic
1133593949 16:7272823-7272845 GGAGGGAGGGGAGGGAGGAGAGG - Intronic
1133800923 16:9084695-9084717 GGAGGCTGAGGCAGGAGGAAGGG + Intergenic
1134005829 16:10818450-10818472 GGATGCTGGGGCTGGAGGCGGGG - Intronic
1134063682 16:11213459-11213481 TGAGGCAGCCCCTGGAGGAGTGG - Intergenic
1134523159 16:14927724-14927746 GGAGGCAGGGGCTAGGGGAGGGG - Intronic
1134549471 16:15132334-15132356 GGGGGCAGGGGCTAGGGGAGGGG + Intronic
1134710826 16:16326375-16326397 GGAGGCAGGGGCTAGGGGAGGGG - Intergenic
1134948775 16:18342270-18342292 GGAGGCAGGGGCTAGGGGAGGGG + Intergenic
1134955758 16:18381495-18381517 GGAGGCAGGGGCTAGGTGAGGGG + Intergenic
1135382872 16:22008556-22008578 GGAGGAAAGGGATGGAGGAGAGG + Intronic
1135642708 16:24134806-24134828 GGAGGCTGGGGCAGGAAGAGAGG + Intronic
1135889168 16:26341858-26341880 GGAGGCAGCATCTGTAGGAAAGG + Intergenic
1135890304 16:26350931-26350953 AGAGGCAATGGCTGGAGCAGTGG - Intergenic
1135985430 16:27180371-27180393 GAAGGTAGGGTCTGGAGGAGGGG + Intergenic
1136022636 16:27449749-27449771 GGAGGCAGACGCTGGAGGGCTGG - Exonic
1136146392 16:28319077-28319099 TGATGAAGGGGCTGGAGGAGAGG - Exonic
1136220165 16:28823405-28823427 GGAGGCGGCCGCTGGAGGCCCGG - Exonic
1136399738 16:30010890-30010912 GGAGGCAGAGGCAGGTGCAGGGG - Exonic
1136403538 16:30030848-30030870 GGAGGATGCGGATGGGGGAGGGG + Exonic
1136475588 16:30511164-30511186 GGAGGCTGCGGTGGGAGGAGAGG - Intronic
1136576089 16:31126252-31126274 GGAGGCTGGGGCTGGAGGCAGGG + Intronic
1136651823 16:31679532-31679554 GGAGGCAGTGGCTGAACTAGAGG - Intergenic
1136778294 16:32882970-32882992 CTAGGGGGCGGCTGGAGGAGAGG - Intergenic
1136779085 16:32885906-32885928 GCAAGCGGCGGCTGGAGCAGGGG + Intergenic
1136891533 16:33975612-33975634 GCAAGCGGCGGCTGGAGCAGGGG - Intergenic
1136892326 16:33978544-33978566 CTAGGGGGCGGCTGGAGGAGAGG + Intergenic
1137399089 16:48138726-48138748 GGAGGCTGAGGCAGGAGGATGGG + Intronic
1137443630 16:48517831-48517853 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1137498146 16:48987001-48987023 GGAGGGACCGGCTGGAGCTGCGG - Intergenic
1137706568 16:50539677-50539699 GCAGGCTGCTGCTGGCGGAGGGG - Intergenic
1137999813 16:53265160-53265182 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1138042708 16:53690962-53690984 GGAGGCAGCTGCAGGATGAAAGG - Intronic
1138320245 16:56105468-56105490 AGAGGAAGCGGCTAGAGGTGAGG - Intergenic
1138540690 16:57685631-57685653 GGAACCAGCATCTGGAGGAGGGG - Exonic
1138542155 16:57695005-57695027 GGAGGAAGTTGCTGGTGGAGAGG + Intronic
1138579971 16:57934328-57934350 GGAGGCTGAGGTTGGAGGATAGG + Intronic
1138844526 16:60549338-60549360 GGAAGTAGGGGTTGGAGGAGAGG - Intergenic
1138969390 16:62126643-62126665 AGAGGGAGGGGCTGGGGGAGAGG + Intergenic
1139390557 16:66604631-66604653 GGAGGGGCGGGCTGGAGGAGCGG + Intronic
1139417957 16:66829987-66830009 GGAGGCTGAGGCTGGAGAATCGG - Intronic
1139526800 16:67521677-67521699 GGAGGCCGAGGCTGGACTAGCGG + Intronic
1139547556 16:67656739-67656761 GGAGGCAAGGGCTGGAGTGGGGG + Intronic
1139633282 16:68243510-68243532 GGAGGCAGGGGCTTTGGGAGTGG + Intergenic
1139675154 16:68518537-68518559 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1139768015 16:69248719-69248741 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1139794103 16:69468202-69468224 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1139870920 16:70108091-70108113 GGAGGTAGAGGCTGGAGCACAGG + Intergenic
1140032534 16:71349967-71349989 GGAGCCAGAGTTTGGAGGAGAGG - Intergenic
1140042525 16:71417998-71418020 AGGGGCAGCAGCTGCAGGAGAGG - Intergenic
1140229185 16:73103409-73103431 GGAGGGAACTGCTGGAGGACAGG - Intergenic
1140317808 16:73916011-73916033 AGAGGCAGAGGAGGGAGGAGGGG - Intergenic
1140375956 16:74445782-74445804 GGAGGTAGGGGCTGGAGCACAGG - Intergenic
1140416083 16:74774726-74774748 GGAGGCGGCGGGGGGCGGAGCGG + Exonic
1140479562 16:75255232-75255254 GGAGGCCGAGGCTTCAGGAGGGG - Intronic
1141199334 16:81884989-81885011 GGAGGCTGAGGCAGGAGGATCGG - Intronic
1141372463 16:83500526-83500548 GGAGGGAGAGGGAGGAGGAGGGG - Intronic
1141602188 16:85133681-85133703 GGAGACTGAGGCTGGAGGAGGGG + Intergenic
1141627941 16:85271282-85271304 GGAGGAAGAGGCTGGGAGAGAGG - Intergenic
1141662905 16:85451261-85451283 GGGTGCAGGGGCTGGAGGTGGGG - Intergenic
1141710563 16:85696571-85696593 GGAGGCTGAGGCAGGAGGACGGG - Intronic
1141971698 16:87488647-87488669 GGAGGTAGAGGCTGTAGGTGAGG - Intronic
1142047037 16:87932193-87932215 GGAGGCAGCGGCCGTGGGAGGGG - Intronic
1142144214 16:88486067-88486089 GGAGGCCCCGGCTGGAGGCGCGG - Intronic
1142177479 16:88651691-88651713 GGAGGCAGGGGCTGGCGTGGGGG + Intergenic
1142228704 16:88889395-88889417 GGAGGCAGGGGCGGGAGGGAGGG + Intronic
1142334471 16:89478646-89478668 GTAGCCGGCTGCTGGAGGAGAGG - Intronic
1142373157 16:89694114-89694136 GGAGGCCTGGGCTGGGGGAGAGG + Intronic
1142374814 16:89701457-89701479 GGAGGGAGGGGCTGGAGGTGCGG - Intronic
1203080716 16_KI270728v1_random:1145079-1145101 CTAGGGGGCGGCTGGAGGAGAGG - Intergenic
1203081499 16_KI270728v1_random:1147994-1148016 GCAAGCGGCGGCTGGAGCAGGGG + Intergenic
1142509362 17:384823-384845 GGAGGGGGCGGCTGGAGGGGAGG + Intronic
1142680240 17:1543380-1543402 GGAGGTAGAGGCTGGGGTAGGGG - Intronic
1142704556 17:1686286-1686308 GGAGGCAGCGGCGAGAGGATTGG + Intergenic
1142707351 17:1704334-1704356 GGAGGCCGAGGTAGGAGGAGTGG - Exonic
1142764073 17:2056098-2056120 GGAGGCAGCGGCTGCCGTGGCGG - Intronic
1142783020 17:2196316-2196338 GGAGGCTGAGGCAGGAGCAGGGG + Intronic
1142795540 17:2303980-2304002 GGAGGCTGGAGCTGGAGGCGCGG + Exonic
1142982154 17:3678570-3678592 AGAGGCAGGGGCTGCAGCAGTGG - Intronic
1143324008 17:6086766-6086788 CAGGGCAGCGGCTGGGGGAGTGG - Intronic
1143338045 17:6188298-6188320 GGTAGCAGCAGCTCGAGGAGAGG - Intergenic
1143454606 17:7058394-7058416 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1143465129 17:7131398-7131420 GGAGGCAGGGGCTGGATCACGGG + Intergenic
1143477662 17:7211810-7211832 GGAGGCTGCGGCGGGGGGGGGGG + Intronic
1143550462 17:7627488-7627510 GGAGGCGGGGGCAGGGGGAGGGG - Intronic
1143614970 17:8044316-8044338 GGAGGCTGAGGCAGGAGGATCGG + Intronic
1143712674 17:8745048-8745070 AGGGGCATCGGGTGGAGGAGCGG + Intronic
1144095527 17:11896984-11897006 GGAGGCTGAGGCTGGAGAATGGG + Intronic
1144672591 17:17141377-17141399 GGAGGCAGGCGCTGGGGTAGGGG - Intronic
1144855098 17:18263170-18263192 GGAGGCCGGGGCTGCAGGTGTGG - Exonic
1144961174 17:19044965-19044987 GGAGGCCTGGGCTGGAGGAGGGG + Intronic
1144973987 17:19129559-19129581 GGAGGCCTGGGCTGGAGGAGGGG - Intronic
1145181324 17:20755374-20755396 GGAGGCTGAGGCAGGAGAAGGGG - Intergenic
1145205666 17:20983991-20984013 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1145916652 17:28577836-28577858 GGAGGCAGCCGCTGAATTAGAGG + Intronic
1145992749 17:29088932-29088954 GGAGGCTGAGGCAGGAGGATGGG + Intronic
1146173966 17:30653025-30653047 GGTGGGAGCGGCGGGTGGAGAGG + Intergenic
1146313300 17:31787779-31787801 GAAGGCAGAGGCTGGGGAAGAGG + Intergenic
1146347421 17:32069047-32069069 GGTGGGAGCGGCAGGTGGAGAGG + Intergenic
1146429908 17:32782829-32782851 GGAGGCTGAGGCGGGAGGATCGG + Intronic
1146438971 17:32877093-32877115 GGCAGCCGCGGCGGGAGGAGCGG - Exonic
1146616394 17:34360305-34360327 GGAGCCAGGGGCTGAAGGATGGG - Intergenic
1146918001 17:36690446-36690468 AGAGGCAGCGGCTGGAGAGGAGG + Intergenic
1147110339 17:38257041-38257063 GGAGGCGGCGGCGAGAGGAGCGG + Intergenic
1147150086 17:38509473-38509495 GGTGGCAGCGGGTGGAGAGGAGG + Intronic
1147162596 17:38576860-38576882 GGAGGCAGGGGAAGGAGAAGAGG - Intronic
1147240196 17:39085840-39085862 GGAAGCAGCTGGTGAAGGAGGGG - Intronic
1147331286 17:39700747-39700769 GCGGGGAGGGGCTGGAGGAGGGG - Intronic
1147396959 17:40151129-40151151 GGAGGCTGAGGCAGGAGGAATGG + Intronic
1147675807 17:42204716-42204738 GAAGGCAGAGGCTGGAAGATTGG - Intronic
1147686949 17:42291873-42291895 TGAGGCAGAGGCTGAAGGAGAGG + Intronic
1147720494 17:42536698-42536720 GGTGGCAGCGGCTCCGGGAGGGG - Intronic
1147743656 17:42682548-42682570 GGAGACAGAGGCTGGGGAAGGGG + Intronic
1147830362 17:43294745-43294767 GGAGGCTGAGGCAGGAGGATGGG - Intergenic
1147845013 17:43398993-43399015 AGAGGCAGCGGTTGGAGGCGCGG + Exonic
1147914570 17:43878822-43878844 GCAGGCAGCGCCTGGAGGAGAGG - Intronic
1147963183 17:44179993-44180015 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1147969255 17:44210864-44210886 GGCGGCAGCTGCAGGAGGAGCGG - Exonic
1147970762 17:44218471-44218493 GGCTGCAGGGGCTGGGGGAGGGG - Intronic
1147986095 17:44308570-44308592 GGGGCGGGCGGCTGGAGGAGGGG + Exonic
1147994552 17:44353760-44353782 CGTGGCAGCGGCGGGAGGAGCGG - Exonic
1148089713 17:45016009-45016031 GGGGGCAGTGGCTGCAGGAGGGG - Intergenic
1148200552 17:45747359-45747381 GGAGGCCGAGGCAGGAGGATTGG - Intergenic
1148217535 17:45841305-45841327 GCGGGCAGGGGCTGGGGGAGGGG - Intergenic
1148346590 17:46907596-46907618 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
1148419171 17:47531390-47531412 GGAGGCGGCGGCGAGAGGAGCGG - Exonic
1148551968 17:48555786-48555808 GGAGGGAGGGGGTGGGGGAGCGG + Intronic
1148930103 17:51120798-51120820 GGGGGCCGGGGCCGGAGGAGGGG + Exonic
1149655810 17:58309049-58309071 GGTGGAAGCAGCCGGAGGAGAGG - Exonic
1149660796 17:58333074-58333096 GCAGGCTGAGGCTGCAGGAGGGG - Intergenic
1149857269 17:60093753-60093775 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
1149908726 17:60550825-60550847 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1149994498 17:61399625-61399647 GGGGGCCGGGGCAGGAGGAGGGG + Intergenic
1150223007 17:63507809-63507831 GGAGGCAGGGAGTGGAGGAAGGG + Intronic
1150700007 17:67438385-67438407 GGAGGCAGAGGTTGCAGTAGCGG - Intronic
1150796807 17:68245339-68245361 GGAGGCAGAGGTGGGAGGATGGG - Intergenic
1151265880 17:72954539-72954561 GGAGGCAGAGGCTGGGGAATGGG - Intronic
1151342510 17:73481062-73481084 GGAGGCAGCAGCCTCAGGAGGGG + Intronic
1151437484 17:74106948-74106970 GGAGGGAGCAGCTAGAGGGGTGG - Intergenic
1151498388 17:74473419-74473441 GGAGGCAGCGGCAGGCAGAGAGG - Intronic
1151518424 17:74612330-74612352 GGAGGCTGAGGCAGGAGGATCGG - Exonic
1151732636 17:75920419-75920441 GGGAGCAGGGGCTGGAGGAGAGG + Exonic
1151903658 17:77034204-77034226 GGAGGCAGTGGGTGGCTGAGTGG - Intergenic
1151903955 17:77035724-77035746 GGTGGCAGCGGCTGGGCGAGGGG - Intergenic
1152147002 17:78574397-78574419 GGAGGCTGAGGCTGGAGGATTGG + Intronic
1152535302 17:80947380-80947402 GAAGCCAGGGTCTGGAGGAGTGG + Intronic
1152535473 17:80948313-80948335 GGGGGCAGCGCTCGGAGGAGGGG - Intronic
1152565138 17:81096992-81097014 GGAGGCAGCGGCAGTGGGGGTGG + Intronic
1152663984 17:81556727-81556749 GGAGGGATCGGCTGGGGAAGTGG + Intergenic
1152698454 17:81807539-81807561 GAAGGCTGCAGCTGGAGCAGAGG - Intronic
1152753463 17:82077297-82077319 GGTGGGAGTGGCCGGAGGAGGGG + Intergenic
1152775826 17:82201415-82201437 GGAATCAGCAGCGGGAGGAGGGG + Intronic
1153287580 18:3470552-3470574 GGAGACAGAGGCAGGAAGAGAGG + Intergenic
1153315823 18:3720811-3720833 GGAGGCTGAGGCAGGAGGACTGG + Intronic
1153550713 18:6258812-6258834 GGTGGGAGAGGGTGGAGGAGGGG + Intronic
1154204671 18:12326774-12326796 GGTGGCTGCGGATGGAGGAGGGG - Intronic
1154388946 18:13920079-13920101 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1155144533 18:23072153-23072175 GGTGGTAGCAGCTGGAAGAGAGG + Intergenic
1155160877 18:23194582-23194604 GGAGACAGGGACTGGAGGAGGGG + Intronic
1155180233 18:23338989-23339011 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1155238266 18:23842974-23842996 GGAAGCAGGGGCTGGTGGAGAGG - Intronic
1155314861 18:24561599-24561621 GCAGGCAGCTGCTGGAAGAGAGG - Intergenic
1155928711 18:31684752-31684774 CCAAGCAGCGGCGGGAGGAGGGG + Intronic
1155983632 18:32206713-32206735 GGAGGCAGAGGCAGGAGAATTGG - Intronic
1156084580 18:33382982-33383004 GGAGGCAGGGGCAGGGGGAGGGG + Intronic
1156088812 18:33440766-33440788 GGCGGCGGCGGCGTGAGGAGCGG + Intronic
1156144421 18:34159082-34159104 AGCGGCGGCGGCTGGAGCAGCGG + Intronic
1156317088 18:35980017-35980039 GGAGGCTGTGGTTGGGGGAGGGG + Intergenic
1156333423 18:36147659-36147681 GGAGGCTGAGGCGGGGGGAGGGG - Intronic
1156371927 18:36478831-36478853 GGAGTCAGGGGGTGGAGGTGGGG - Intronic
1156448895 18:37255346-37255368 GGAGGCAGCATCTGGGGCAGAGG - Intronic
1156493094 18:37507986-37508008 TGGGGCAGGGGCTGGTGGAGAGG - Intronic
1156654827 18:39272644-39272666 GGAGGCAGAGGCTTGCTGAGAGG + Intergenic
1157257696 18:46153249-46153271 TGAGGAAGGGGCTGGGGGAGGGG + Intergenic
1157462931 18:47917789-47917811 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1157479235 18:48042531-48042553 GAAGGCAGAGGCAGGGGGAGGGG + Intronic
1157574561 18:48734764-48734786 GGAAGCAGGGGCTGGAGAGGAGG + Intronic
1157831550 18:50861103-50861125 GGAGGCCGAGGCAGGAGGATTGG + Intergenic
1158648900 18:59269396-59269418 GCGGGGAGCGGCTGAAGGAGAGG + Exonic
1159943306 18:74425600-74425622 GGAGGCAGCGTCAGGAGCTGAGG + Intergenic
1160114870 18:76068472-76068494 GTTGCCAGAGGCTGGAGGAGGGG - Intergenic
1160342505 18:78101865-78101887 GGAGTCTGCGGCTGGACGAATGG - Intergenic
1160526188 18:79539531-79539553 AGCTGCAGCTGCTGGAGGAGGGG - Intergenic
1160693380 19:470656-470678 GGGAGGGGCGGCTGGAGGAGGGG - Intronic
1160696008 19:484853-484875 GGAGGCCTCTGCTGGAGCAGAGG + Intergenic
1160710439 19:548839-548861 GGCGGCAGCGGGGGGAGGGGTGG - Intronic
1160722445 19:603427-603449 GGAGGCACTGGCTCGAGGTGTGG + Intronic
1160722473 19:603505-603527 GGAGGCACCGGCCTGAGGTGTGG + Intronic
1160814459 19:1028721-1028743 GACGGCAGCGGCTGGGGGTGGGG + Intronic
1160824311 19:1072491-1072513 GGAGGCTGAGGCAGGAGGACGGG - Intronic
1160829836 19:1098593-1098615 GGAGGCAGCAGCAGGAGGGGAGG + Intergenic
1160860847 19:1236786-1236808 GCAGGCCGCGGCTGGGGGGGCGG + Intronic
1160967583 19:1753425-1753447 GGAGGCAGCGGTGGCAGGAGCGG + Exonic
1160971525 19:1769878-1769900 AGAGGCAGAGGCTGGGGGAGGGG - Intronic
1160973430 19:1780456-1780478 GGGAACAGAGGCTGGAGGAGAGG + Exonic
1161069659 19:2253730-2253752 GGCGGCGGCGGCTGCAGGGGCGG + Exonic
1161128012 19:2570899-2570921 GGAGGCTGAGGCAGGAGGATCGG - Intronic
1161219396 19:3111327-3111349 GGGTGCCGGGGCTGGAGGAGGGG - Intronic
1161223546 19:3131031-3131053 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1161235590 19:3196539-3196561 GGAGGCAGCGGCTTGGTGTGTGG - Intronic
1161262332 19:3344948-3344970 GGCTGCAGCGGAGGGAGGAGAGG + Intergenic
1161409866 19:4111117-4111139 GGTGCCGGGGGCTGGAGGAGGGG + Intronic
1161455813 19:4369311-4369333 AGAGCCAGCGGCTGCCGGAGAGG + Intronic
1161492061 19:4567578-4567600 GAAGGCAGAGGCCGCAGGAGTGG - Intergenic
1161687050 19:5708086-5708108 GGTGGCATTGGCTGGGGGAGTGG - Intronic
1161751664 19:6102140-6102162 GCAGGCAGCAGATGGGGGAGAGG - Intronic
1161769098 19:6221810-6221832 GCAGGGGGCTGCTGGAGGAGGGG + Intronic
1161819610 19:6521712-6521734 GGAGGCTGGGGCAGGAGGATTGG + Intergenic
1162018970 19:7860182-7860204 CGAGGCAGGGGGTGGGGGAGAGG - Intronic
1162033055 19:7925633-7925655 GGCGGCGGCGGCGGCAGGAGGGG - Intronic
1162076697 19:8192675-8192697 GGAGGGAGGGTCTGAAGGAGAGG - Intronic
1162134079 19:8544544-8544566 GGAGGGAGGGGGTGGAGGAGTGG + Intronic
1162181541 19:8872391-8872413 GGTGCCAGAGGCTTGAGGAGGGG + Intronic
1162536447 19:11265302-11265324 GGAGGCAGGGGCAGCTGGAGTGG - Intergenic
1162559258 19:11406434-11406456 GGGCGCAGCGGCTGGAGAAGTGG - Exonic
1162786123 19:13036100-13036122 GGGGGCTGCGGCTGGAGGGAGGG + Intronic
1162850810 19:13429946-13429968 GGTGCCAGGGGCTGGGGGAGTGG + Intronic
1162886690 19:13702751-13702773 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1162904682 19:13816754-13816776 GGAGGACGAGGCTGGAGGATTGG + Intronic
1162988448 19:14287011-14287033 GGTGGGAGCGGCAGGTGGAGAGG - Intergenic
1163144961 19:15373816-15373838 GGAGGCAGGGGCGGGAGCGGCGG - Exonic
1163197523 19:15733464-15733486 TGAGACAGGGGCTTGAGGAGAGG + Intergenic
1163367722 19:16885267-16885289 GGTGCCAGAGGCTGGGGGAGGGG - Intergenic
1163486829 19:17592853-17592875 GGTGCCAGGGGCTGGGGGAGAGG - Intergenic
1163609308 19:18292793-18292815 GGAGTGAGCGACGGGAGGAGAGG - Intergenic
1163655668 19:18543527-18543549 GGCGGCCGCGGCTGGGGGCGGGG - Exonic
1163666550 19:18606463-18606485 GGGGGCAGCCGCGGGGGGAGGGG - Intronic
1163906089 19:20150733-20150755 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1164091956 19:21962177-21962199 GGAGGGACCGGCTGGAGCTGTGG - Intronic
1164179633 19:22807465-22807487 GGAACCAGCGGGCGGAGGAGGGG - Intergenic
1164191906 19:22925498-22925520 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1164418434 19:28066185-28066207 GGAGGTAGGGGCTGGCAGAGAGG - Intergenic
1164609822 19:29624348-29624370 GGAGGCAGGGGCTGCAGCTGAGG + Intergenic
1164653342 19:29901726-29901748 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1164672024 19:30077674-30077696 AGGGGCAGAGGCTGGAGAAGTGG - Intergenic
1164739227 19:30564368-30564390 GGAGGTTGCATCTGGAGGAGAGG + Intronic
1164833471 19:31340766-31340788 GTAAGCAGGGGCTGGAGGAGAGG - Intronic
1164871718 19:31651035-31651057 GTTGCCAGGGGCTGGAGGAGGGG + Intergenic
1165349616 19:35268858-35268880 GGCTGCAGCGGCTGCAGGAGCGG + Intergenic
1165370467 19:35402482-35402504 AGGGGCAGCAGCTGGTGGAGGGG + Intergenic
1165423806 19:35734739-35734761 GAGGGCAGTGGCTGGGGGAGTGG + Intronic
1165429922 19:35766801-35766823 GGAGGCTGGGGCTGGAGCAGGGG - Exonic
1165562218 19:36689573-36689595 TGGGGCAGCAGCTGGAGAAGAGG - Intronic
1165724018 19:38100152-38100174 TGAGTCAGGGGCTGGAGGTGGGG + Intronic
1165844990 19:38812509-38812531 TAAGGCAGCGTCTGGAGAAGAGG + Exonic
1165850916 19:38849910-38849932 GGCGTCGGCGGCTGGAGCAGAGG - Exonic
1165863024 19:38918919-38918941 TGAGGCAGGGGCTGGCGCAGTGG + Intronic
1165866995 19:38945465-38945487 GGAGCCAGAGCCTGGGGGAGGGG + Intronic
1165906432 19:39197191-39197213 GGCAGCTGCTGCTGGAGGAGTGG + Exonic
1166261436 19:41644221-41644243 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1166301231 19:41913147-41913169 GGAGGAGGCTGCGGGAGGAGAGG - Intronic
1166546046 19:43635469-43635491 GGAGGAAGGGGCTGGAGGCGGGG - Intronic
1166547184 19:43640404-43640426 GGAGGCTGCAGCTGGAGGTCCGG + Intergenic
1166746877 19:45145825-45145847 GGAGGGAGGGGGTGGGGGAGAGG - Exonic
1166751501 19:45165878-45165900 GGAGGGCATGGCTGGAGGAGAGG + Intronic
1167011864 19:46813794-46813816 AGAGGCAGTGGGAGGAGGAGGGG - Intergenic
1167158416 19:47752865-47752887 CGAGGCAGAGGCTGAGGGAGGGG + Intronic
1167277165 19:48545517-48545539 GGGGGCAGGGGCTGGGGGCGGGG - Intergenic
1167310566 19:48735349-48735371 GGCGGCGGCGGCAGCAGGAGCGG - Exonic
1167357615 19:49013808-49013830 GGAGGCTGAGGCAGGAGGATCGG + Intronic
1167377661 19:49120229-49120251 GGTGGCGGCGGCAGGAGGTGGGG - Intronic
1167379993 19:49133209-49133231 GGAGGGAGAGGCAGGGGGAGGGG - Intronic
1167417882 19:49386711-49386733 GGAGGAAGGGGAGGGAGGAGGGG + Intergenic
1167495450 19:49815581-49815603 GGAGGCAGAGGCAGGAGAATCGG + Intronic
1167611924 19:50511835-50511857 GGAGGCAGTGGTGGGAGGAGGGG + Intronic
1167619936 19:50555156-50555178 GAAGCCAGCAGCTTGAGGAGTGG - Intronic
1167739671 19:51316935-51316957 GGAGGTAGGGGGTGGAGGGGCGG - Intronic
1167773803 19:51541738-51541760 GGAGGCAGAGGAGGGAGCAGCGG - Intergenic
1168301557 19:55407706-55407728 GGAGGCAGCGGGGAGCGGAGCGG - Exonic
1168315263 19:55482227-55482249 GGGGGCGGCGGCGGGAGGAGGGG - Exonic
1168376846 19:55887045-55887067 GGAGGCCAAGGCTGGAGGATCGG + Intergenic
924960487 2:30116-30138 GGAGACAGTGGTTGGGGGAGGGG - Intergenic
925134320 2:1515787-1515809 AGAGGCAGCGGCTGGGGGAATGG - Intronic
925340710 2:3133580-3133602 GGTGCCAGGGGCTGGGGGAGGGG + Intergenic
925380121 2:3418963-3418985 GGAGGGAGGCGGTGGAGGAGGGG - Intronic
925523705 2:4776434-4776456 GGAAGGAGAGGCTGAAGGAGAGG + Intergenic
925947361 2:8878078-8878100 GGTGACAATGGCTGGAGGAGGGG + Intronic
925974771 2:9134399-9134421 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
926089987 2:10043505-10043527 GGAGGGAGCGGCTGGCGGGGCGG - Intronic
926112753 2:10193355-10193377 AGAAGGAGGGGCTGGAGGAGAGG - Intronic
926118715 2:10229340-10229362 GGGGTCAGGGGCTGGAGGATTGG + Intergenic
926217819 2:10915946-10915968 GGAGGCAGGGGCTGGGGCAGCGG + Intergenic
926266824 2:11330829-11330851 GGAGGAAGAGGGAGGAGGAGGGG + Intronic
926373364 2:12202933-12202955 GCAGACAGCAGCAGGAGGAGAGG + Intergenic
926715855 2:15922880-15922902 GGAGGCAGGGGCTGAAGTGGTGG + Intergenic
927069896 2:19517174-19517196 GGAGGCAGTGGCAGAAGCAGTGG - Intergenic
927187170 2:20490219-20490241 GGATGCTGCTGCTGGAGGTGTGG + Intergenic
927314008 2:21661229-21661251 GGAGGCAGGGGCTGGTGTAGTGG - Intergenic
927576859 2:24207763-24207785 GGAGGCAGGGGCAGAAGGATGGG + Intronic
927651337 2:24915380-24915402 GGGGGCAAGGGCTGGAGGACAGG - Intronic
927844073 2:26462303-26462325 CCAGGCTGGGGCTGGAGGAGTGG + Intronic
927845026 2:26466998-26467020 GGAGGCAGTGGCCGGGGCAGTGG + Intronic
927881530 2:26692985-26693007 AGCGGCAGCGGCTGGAGCTGCGG + Exonic
927952826 2:27184940-27184962 GGAGGCAGTGGTTGGGGGTGGGG - Intergenic
928410179 2:31048594-31048616 GGAGGCAGGGGAGGCAGGAGTGG - Intronic
928510689 2:32000332-32000354 GGAGGCTGCGGCGAGAAGAGTGG - Intronic
928511834 2:32010294-32010316 GGCGGCGGCGGCGGCAGGAGCGG + Exonic
928554233 2:32406290-32406312 GGAGGCTGAGGCAGGAGGATTGG + Intronic
928757934 2:34547815-34547837 GGTGGCAGCAGCTGCAGGTGAGG + Intergenic
929242540 2:39666618-39666640 GGAGACAGAGGCGGGAGGTGCGG - Intronic
929514267 2:42592156-42592178 GGAGGCTGAGGCAGGAGGATTGG + Intronic
929545907 2:42855146-42855168 AGTGGAAGAGGCTGGAGGAGGGG + Intergenic
929614370 2:43296850-43296872 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
929623999 2:43387651-43387673 GGAGGCAGGGGGCGGAGGCGGGG - Intronic
929701943 2:44169467-44169489 GGAGGCGGCGGCCGGGGAAGGGG - Intronic
929724467 2:44410359-44410381 GGAGGCTGAGGCAGGAGAAGGGG - Intronic
929776298 2:44933054-44933076 TGAGGTAGGAGCTGGAGGAGGGG - Intergenic
930126727 2:47804212-47804234 GGAGGCTGAGGCAGGAGGAAGGG - Intronic
930453969 2:51581548-51581570 GGAGGCTGAGGCAGGAGAAGGGG + Intergenic
930814208 2:55575674-55575696 GGAGGCCGAGGCAGGAGGATTGG - Intronic
930817803 2:55617300-55617322 GGAGGCGGCGGCTAGAGCGGTGG - Exonic
930848031 2:55926465-55926487 GGTGGTAGCGACTGCAGGAGAGG + Intergenic
931442750 2:62302994-62303016 GCCAGCAGCGGCTGGAGGAGTGG - Intergenic
932030758 2:68182060-68182082 GGAGGGGGGGGTTGGAGGAGGGG - Intronic
932484370 2:72074039-72074061 GGAGGGACCGGCTGGAGTCGTGG - Intergenic
932717869 2:74115909-74115931 GGAGGCAGAGGTGGGAGGACTGG + Intergenic
932718480 2:74120567-74120589 GGAGGGACCGGAAGGAGGAGCGG + Intergenic
932964114 2:76450479-76450501 GGAGGCAGTGGGTCGGGGAGGGG - Intergenic
933015231 2:77115553-77115575 GGAGGGACCGGCTGGAGGCAAGG - Intronic
933124429 2:78586536-78586558 GGGGCCAGTGGCTGGAGCAGAGG + Intergenic
933212361 2:79585710-79585732 GGAGGGAGGGGCTGGAGCAGAGG - Intronic
933730936 2:85455853-85455875 GGAGGCAGGGTGGGGAGGAGGGG + Intergenic
934048330 2:88190161-88190183 GGAGGTAGAGGGTAGAGGAGAGG + Intergenic
934177025 2:89585236-89585258 GGAGGCTGCAGACGGAGGAGTGG - Intergenic
934287333 2:91659595-91659617 GGAGGCTGCAGACGGAGGAGTGG - Intergenic
934564319 2:95330049-95330071 GGTGGCTGCGGCCGGAGGTGAGG - Intronic
934647528 2:96067912-96067934 GGAGGCAGGAGCTGTGGGAGTGG + Intergenic
935040380 2:99420537-99420559 GGAGACAGAAGCTGAAGGAGTGG - Intronic
935070226 2:99687542-99687564 GGAGACAGGAGCTAGAGGAGAGG + Intronic
935112315 2:100104788-100104810 GGCGGCGGCGGCTGCAGCAGCGG - Intronic
935218794 2:100994653-100994675 GGAGGAAGGGACTTGAGGAGAGG + Intronic
935654183 2:105407785-105407807 GGTGGCAGCGGGGGGAGGATTGG - Intronic
935751276 2:106236061-106236083 GGAGGGACCGGCTGGAGCCGCGG - Intergenic
935832745 2:107017465-107017487 GGAGGTAGGGGCTGGTGGGGGGG - Intergenic
936093387 2:109514935-109514957 GAAGTCAGAGGCTTGAGGAGAGG - Intergenic
936370457 2:111898518-111898540 GCCGGCCGGGGCTGGAGGAGAGG - Exonic
936512558 2:113159874-113159896 GGAGGCAGAAGTTGCAGGAGCGG + Intronic
936545984 2:113393792-113393814 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
936663375 2:114567076-114567098 GGAGCCAGCTGTTGGAGGATGGG - Intronic
936939610 2:117870984-117871006 GGAGGCAGCGGCGGCAGTGGAGG - Intergenic
936943896 2:117913676-117913698 GGAGGCAGAGGTGGGAGGATGGG - Intergenic
937214915 2:120306388-120306410 GGTGGCAGCAGGTGGAGGACGGG - Intergenic
937216655 2:120317448-120317470 GGAAGCAGCAGGTGGAGGTGGGG + Intergenic
937325801 2:120989025-120989047 GGAGGCCGTGGCGGCAGGAGTGG + Exonic
937337917 2:121072998-121073020 GGAAGCAGCGGCTGCCTGAGTGG - Intergenic
937430678 2:121835695-121835717 GGAGGCAGAGGCGTGTGGAGAGG - Intergenic
937468355 2:122154464-122154486 GGACTGAGGGGCTGGAGGAGTGG - Intergenic
937798405 2:126052657-126052679 GGAGGGATCGGCTGGAGCCGCGG - Intergenic
937884198 2:126889116-126889138 GGAGGCAGCTGCTGCAGAGGAGG - Intergenic
937919694 2:127120523-127120545 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
937953723 2:127407931-127407953 GGAGGCAGCAACTCGGGGAGGGG - Intergenic
938108700 2:128550282-128550304 GAAGGCAGAGGGAGGAGGAGGGG - Intergenic
938122181 2:128641808-128641830 GCAGGCAGAGGCTGGACCAGGGG + Intergenic
938201549 2:129376775-129376797 GGAGGCAGCGTCAGAAGGGGCGG + Intergenic
938428633 2:131211654-131211676 GGAGGCTGAGGCAGGAGGATGGG - Intronic
938665462 2:133530839-133530861 GGTGACAGCCACTGGAGGAGAGG + Intronic
939218872 2:139276365-139276387 GGAGGCTGAGGCAGGAGAAGGGG + Intergenic
939308350 2:140438118-140438140 GGAGGCTGAGGCTGGAGGGTCGG - Intronic
939629052 2:144513101-144513123 GGAGGCACCTCCTGGAGAAGGGG + Intronic
940204887 2:151192050-151192072 GGGGGCTGGGGCTGGAGCAGGGG - Intergenic
941071209 2:160956500-160956522 GGAGCCAGGGGGTGGAGCAGGGG - Intergenic
941074057 2:160987540-160987562 GGAGGGACCGGCTGGAGCCGTGG - Intergenic
941120331 2:161522516-161522538 GGAGGCTGAGGCAGGAGGACTGG - Intronic
941519317 2:166519563-166519585 GGAGGCAGCTCATGCAGGAGGGG - Intergenic
941689738 2:168487822-168487844 GGAGGCTGAGGCAGGAGGACTGG - Intronic
941814063 2:169783014-169783036 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
941850763 2:170177643-170177665 GGAGGCAGGGGGTGGGGGGGTGG - Intergenic
941950378 2:171149665-171149687 GGAGGCAGAGGCAGGAGGACTGG + Intronic
942241121 2:173964712-173964734 GGGGGCAGCAGCAGGAGGGGAGG - Intronic
942314432 2:174684290-174684312 GCAGGCAGGGGCTTGAGAAGTGG - Intergenic
942401992 2:175612675-175612697 AGAGGGAGCAGCTGGAGAAGAGG + Intergenic
942450718 2:176106756-176106778 GGAGGGAGCGGCTGCAGTAAGGG + Intronic
942710419 2:178828590-178828612 GGCAGCAGCTGCTAGAGGAGCGG + Intronic
942997124 2:182276295-182276317 GGAGGAAGCAGCTGGAGCCGCGG + Intronic
943600900 2:189919854-189919876 AGAGGAAGAGGATGGAGGAGGGG - Intronic
943624171 2:190180625-190180647 CGAGGCAGGGGCGGGCGGAGCGG - Intronic
943624226 2:190180801-190180823 GGCGGCGACGGCAGGAGGAGGGG + Intronic
943722280 2:191217651-191217673 GGAGGATGCCTCTGGAGGAGGGG + Intergenic
945016563 2:205524745-205524767 GAAGGGTGAGGCTGGAGGAGAGG - Intronic
945234835 2:207624844-207624866 CGAAGCAGCCGATGGAGGAGGGG - Intronic
945399693 2:209366045-209366067 GGAGGCAGAGGCAGGAGGTCGGG - Intergenic
945530500 2:210948165-210948187 GGAGTCAGCGGTTGGAGCATGGG + Intergenic
946180185 2:217944168-217944190 GGAGGCCATGGCTGGCGGAGGGG - Intronic
946235755 2:218323494-218323516 GGAGGCGGGGGCTGGAGCTGGGG + Intronic
946307822 2:218866004-218866026 GGGGGTAGGGGCTGGGGGAGGGG + Intronic
946430901 2:219627124-219627146 GGAAGCTGAGGCGGGAGGAGGGG + Intergenic
946482050 2:220066578-220066600 GGAGGGTGGGGCTGGAGGATGGG - Intergenic
946507626 2:220318375-220318397 GGAGGCTGAGGCGGGAGGATTGG + Intergenic
947411339 2:229843638-229843660 GGAGGCTGAGGCTGGAGGAATGG + Intronic
947497897 2:230651989-230652011 GGTGCCAGGGGCTGGGGGAGGGG - Intergenic
947536610 2:230943643-230943665 GGAGGCGGGGCCTGGTGGAGGGG + Intronic
947546943 2:231016777-231016799 GGAGGCTTCCCCTGGAGGAGCGG + Intronic
947727835 2:232410756-232410778 GGACACAGTGGCTGGAGGGGTGG + Intergenic
947792634 2:232876810-232876832 GGAGGCGGCGCCGGGAGAAGGGG - Intronic
947798335 2:232908641-232908663 GGAGGCTGAGGTAGGAGGAGTGG - Intronic
947840529 2:233204662-233204684 GCAAGCACCGGCCGGAGGAGGGG + Exonic
947873551 2:233453294-233453316 GGCGGCAGTGGCTGGGGCAGTGG - Intronic
948085711 2:235245193-235245215 GGAAGCACTAGCTGGAGGAGGGG + Intergenic
948143396 2:235691082-235691104 GGGAGCAGAGTCTGGAGGAGGGG - Intronic
948196878 2:236103203-236103225 GGAGGCAGTGGGCGGAGGTGAGG - Intronic
948208225 2:236173878-236173900 GGAGGCAGCGGCTGGGGACTTGG - Intergenic
948264137 2:236625200-236625222 AGAGGCAGCGTCAGGAGCAGCGG + Intergenic
948268147 2:236653707-236653729 GGTGGCAGAGCGTGGAGGAGGGG + Intergenic
948281100 2:236748568-236748590 GGAGGAAGAGGGTGGAGGAGAGG - Intergenic
948458838 2:238119502-238119524 GGAGGAGGTGGGTGGAGGAGGGG + Intronic
948458862 2:238119583-238119605 GGAGGAGGTGGATGGAGGAGGGG + Intronic
948562532 2:238864180-238864202 GGGGGAAGGGGCTGGAGGTGAGG + Intronic
948767349 2:240230025-240230047 GGTGGCAGCTGCAGGTGGAGAGG + Intergenic
948782339 2:240329511-240329533 GGCCGCAGAGGGTGGAGGAGGGG + Intergenic
948889625 2:240900735-240900757 AGAGCCAGGGGCTGGGGGAGGGG - Intergenic
948995470 2:241576137-241576159 GGCTGCAGCGGGAGGAGGAGAGG - Intergenic
1168750244 20:276966-276988 GGAGGCAGAGGATGGGGAAGAGG + Intronic
1168771891 20:420872-420894 GGAAGCAGCAGCAGCAGGAGGGG + Exonic
1168838820 20:895545-895567 ACAGGCAGGGGCTGGGGGAGAGG + Intronic
1168876969 20:1178445-1178467 AGAGGCAGTTCCTGGAGGAGAGG + Intronic
1169113306 20:3046619-3046641 CGAGGCTGCGGCAGGAGGAGCGG + Exonic
1169118123 20:3080389-3080411 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1169213300 20:3779232-3779254 TGAGGCAGCGCCTGGAGGAGAGG - Exonic
1169214425 20:3785214-3785236 GGAGGAAGAGGGTGAAGGAGAGG - Exonic
1169326586 20:4681711-4681733 GTGGGCAGGAGCTGGAGGAGAGG - Intergenic
1169345203 20:4823503-4823525 GGAGGGAGAGGAAGGAGGAGGGG - Intronic
1169373653 20:5048300-5048322 GGAGGCGGAGGTTGCAGGAGCGG - Intergenic
1169722613 20:8695461-8695483 TGAGGCAGAGGCAGGAGGATCGG + Intronic
1170425173 20:16228433-16228455 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1170450585 20:16479354-16479376 GGAGGCGGCGGATGGGGCAGGGG + Intronic
1170732799 20:18988947-18988969 GGAGGCAGAGGCGGGAGGGAGGG + Intergenic
1170866418 20:20161859-20161881 AGAGGGCGTGGCTGGAGGAGGGG - Intronic
1171251293 20:23650738-23650760 GGAGGCAGAGGTTGCAGGAGTGG - Intergenic
1171364769 20:24616391-24616413 GGAGGATGCAGGTGGAGGAGGGG - Intronic
1171848223 20:30290614-30290636 GGAGGCGGGGGCGGGAGGGGAGG + Intergenic
1172100800 20:32483280-32483302 GGCGGCAGCAGCCGGAGAAGGGG + Intronic
1172117388 20:32581161-32581183 GGAAGCAGGGTATGGAGGAGAGG - Intronic
1172205263 20:33158855-33158877 GCAGGCAGGAGCTGCAGGAGGGG - Intergenic
1172234168 20:33358677-33358699 GGAGGCAGAGACTGAAGGAGAGG - Intergenic
1172252109 20:33487138-33487160 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1172350064 20:34231360-34231382 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1172438628 20:34949124-34949146 GGAAACAGTGGCTGGAGGAAGGG + Intronic
1172485470 20:35295333-35295355 GGCGCCAGGGGCTGGGGGAGGGG - Intergenic
1172503585 20:35444502-35444524 GGGGGCAGTGGCAGGAGGTGAGG + Intronic
1172519984 20:35560080-35560102 GGAGGCAGGGGCTGAGGGTGGGG + Intergenic
1172790988 20:37505366-37505388 AGAGGCAGGACCTGGAGGAGGGG - Intronic
1173028258 20:39329925-39329947 GGATGCTGGGGCTGGAGTAGTGG + Intergenic
1173162706 20:40664279-40664301 GGAGGGAGGGGATGGAGGAAGGG - Intergenic
1173250180 20:41360289-41360311 GGAGCCACCAGCTGGAGGAAAGG - Exonic
1173678436 20:44858397-44858419 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1173978507 20:47205368-47205390 GGAGGCTGAGGCGGGAGGATGGG + Intergenic
1174139034 20:48400108-48400130 GGAGACACCAGCAGGAGGAGAGG - Intergenic
1174188294 20:48722436-48722458 GTCGGCAGGGGCTGGAGGAGGGG + Intronic
1174368598 20:50071358-50071380 CGAGGCTGGGGCTGGAGGAGGGG - Intergenic
1174740522 20:53009232-53009254 GGAGGCTGAGGCTGGAGAATCGG + Intronic
1175083218 20:56438184-56438206 GGAGGCTGAGGCAGGAGGATCGG + Intronic
1175238328 20:57527436-57527458 GGAGGCAGCCGATGGAGCAGGGG + Intergenic
1175730340 20:61349964-61349986 GTGGGCAGGGGCAGGAGGAGAGG - Intronic
1175806760 20:61833929-61833951 GGAGGCACAGGGTGCAGGAGTGG + Intronic
1175889385 20:62309619-62309641 GGGGGCAGGGGGTGGAGGGGTGG + Intronic
1175913020 20:62413633-62413655 TGAGGCTGCAGCTGGTGGAGGGG + Intronic
1175940453 20:62535351-62535373 GGAGGCGGCACCTGCAGGAGAGG + Intergenic
1175964129 20:62652008-62652030 GGAGGCGGGGGCAGGGGGAGTGG - Intronic
1176053985 20:63134881-63134903 GGAGGCAGGGCCTAGAGGGGAGG + Intergenic
1176075379 20:63245857-63245879 GGGAGCCGAGGCTGGAGGAGTGG - Intronic
1176081929 20:63277846-63277868 GGAGGCAGCGGGGAGAGGTGAGG - Intronic
1176131390 20:63498254-63498276 GGTGGCAGCGGGTGGGGGTGGGG - Intronic
1176142065 20:63549174-63549196 GGCGGCGGGGGCGGGAGGAGAGG - Intronic
1176142109 20:63549282-63549304 GGAGACGGCGGCGGGGGGAGTGG - Intronic
1176178389 20:63739026-63739048 GGAGGCCGCGGCTGTCAGAGCGG - Exonic
1176178821 20:63740326-63740348 GGAGGCGGTGGCCGGGGGAGGGG - Intronic
1176379210 21:6103392-6103414 AGAGGCAGCGGCAGGGGCAGGGG + Intergenic
1177178641 21:17721137-17721159 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1177788468 21:25696397-25696419 GGAGGGAGAGGGAGGAGGAGGGG + Intronic
1177984699 21:27960139-27960161 GGAGGGACCGGCTGGAGCCGTGG + Intergenic
1178064139 21:28885216-28885238 GGAGGCAGCGGCTGCCGAACTGG - Exonic
1178411025 21:32363892-32363914 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1178551525 21:33543324-33543346 GAAGGGAGCGGCTGGGGGGGCGG - Intronic
1178561373 21:33642437-33642459 GGAGGCAGCGGAGGGAGATGAGG + Exonic
1178824665 21:36005029-36005051 GGAGGGAGAGGCAGGGGGAGGGG + Intergenic
1178839994 21:36130420-36130442 GGCGGCGGCGGCGGCAGGAGCGG - Intergenic
1178948454 21:36966800-36966822 GGAGGCTGCGGCGGGAGGGGCGG + Intronic
1179061691 21:37985040-37985062 GCAGGGAACGGGTGGAGGAGGGG - Intronic
1179085030 21:38208267-38208289 TGAGGCAGAGGCTGGTGCAGGGG - Intronic
1179297330 21:40075053-40075075 GGAGGAGGCGGCGGGAGCAGAGG - Exonic
1179449649 21:41459835-41459857 AGAGGCTGTGGCTGGGGGAGCGG + Intergenic
1179505528 21:41837519-41837541 GGTGCCAGGGGCTGGGGGAGGGG + Intronic
1179591653 21:42413119-42413141 CGAGGTAGCTGATGGAGGAGTGG - Exonic
1179628382 21:42661393-42661415 GGGGTCAGGGGCTGGGGGAGGGG - Intronic
1179646958 21:42782024-42782046 GGAGGCAGAGGAGGGAGGGGAGG - Intergenic
1179744263 21:43434845-43434867 AGAGGCAGCGGCAGGGGCAGGGG - Intergenic
1179873619 21:44256345-44256367 GGAGACTGAGGCTGGAGCAGGGG - Intronic
1179950168 21:44704741-44704763 GGAGGCAGCGCATGGCTGAGTGG - Intronic
1179953647 21:44725681-44725703 GGAGGCTGAGGCGGGAGGATTGG + Intergenic
1180615175 22:17121567-17121589 GGAGGAAGCGGGAGGAGGCGCGG + Intronic
1180702560 22:17789559-17789581 GCAGGCACCGGGTGGAGGAGGGG + Exonic
1180705771 22:17808881-17808903 GGCAGCGGCGGCTGGAGGAAAGG - Exonic
1180782464 22:18528827-18528849 GCAGGCAGCTGCAGGAGCAGTGG + Exonic
1180854961 22:19039949-19039971 GGAGGCTGAGGCGGGAGGAGGGG - Intronic
1180871686 22:19150259-19150281 GGCGGCAGCGGCTGGGGGCGCGG - Exonic
1181033162 22:20157857-20157879 CGAGGCAGCAGTTGGAGGTGGGG - Intergenic
1181034812 22:20164797-20164819 GCAGGCAGGGGTGGGAGGAGGGG + Intergenic
1181050317 22:20235241-20235263 GGAGGCTGCCCCTGCAGGAGAGG + Intergenic
1181085858 22:20439010-20439032 GAAGGGTGGGGCTGGAGGAGGGG + Intronic
1181239354 22:21468162-21468184 GCAGGCAGCTGCAGGAGCAGTGG + Intergenic
1181248501 22:21517579-21517601 GGGGGCAGCAGCTGGGGGCGTGG + Intergenic
1181257863 22:21575745-21575767 GGAGGCTGAGGCAGGAGGAATGG - Intronic
1181280588 22:21717125-21717147 GGAGGCCGGGGCTGGGGGGGCGG + Intronic
1181387852 22:22558237-22558259 GGAGACAGAGGGTGGGGGAGGGG + Intronic
1181492868 22:23271633-23271655 GGAGGCTGCTGCTGGCAGAGGGG + Intronic
1181510147 22:23385375-23385397 CGAGGCAGCAGTTGGAGGTGGGG + Intergenic
1181601122 22:23952406-23952428 GGAAACTGAGGCTGGAGGAGGGG + Intergenic
1181607387 22:23988920-23988942 GGAAACTGAGGCTGGAGGAGGGG - Intergenic
1181659905 22:24338446-24338468 GGACACAGCTGCTGCAGGAGGGG - Exonic
1181765282 22:25087152-25087174 GGAGGCAGCGGCGGGGTGGGGGG - Intronic
1181935219 22:26433576-26433598 GGAAGGAGCGGCTGGGGCAGGGG - Exonic
1182296812 22:29315009-29315031 GGAGGTAGCGGCTCGAGGAGCGG - Exonic
1182305841 22:29367536-29367558 GGAGGCCGAGGCAGGAGGATTGG - Intronic
1182313108 22:29423452-29423474 GGAGGCCGAGGCAGGAGGATTGG - Intergenic
1182418543 22:30236995-30237017 GAAGGCTGTGGCTGGAGGAGAGG + Intergenic
1182426980 22:30278832-30278854 GGAGGCTGAGGCAGGAGAAGCGG + Intergenic
1182435325 22:30326441-30326463 GGAGGTGGCGGGTGGAGGTGTGG + Intronic
1182471877 22:30553835-30553857 GGAGGGAGAGGGTGGAGGAGGGG + Intergenic
1182576498 22:31276635-31276657 GGAGGCGGCGGCACAAGGAGGGG + Intronic
1182585698 22:31343356-31343378 GGCGGGAGAGGCTGGGGGAGGGG - Intronic
1182619800 22:31612881-31612903 GGAGGCAGCGGCCTGAGGTCCGG - Intronic
1182743639 22:32587753-32587775 GGAAACATCGCCTGGAGGAGCGG + Intronic
1183123087 22:35746487-35746509 GGCTGCAGCGGCTGCAGCAGCGG + Exonic
1183231746 22:36586652-36586674 GGTGGCAGGGCCTGGAGCAGAGG + Intronic
1183251290 22:36732149-36732171 GGAGGGAGCGGCTGGTGCAAAGG - Intergenic
1183299546 22:37052077-37052099 GGAAGAAGCGGCAGGAGGAGGGG + Intronic
1183484642 22:38082473-38082495 GGAGACAGCGGCCAGAGGCGGGG - Intronic
1183518830 22:38284415-38284437 GGAGGCTGAGGCTGGAGGATGGG + Intergenic
1183559612 22:38561244-38561266 GGAGGCCAAGGCTGGAGGTGGGG - Intronic
1183602206 22:38846320-38846342 GGAGGCAGAGGAAGGAGGAGAGG + Intergenic
1183647126 22:39133384-39133406 GGAGGAAGGGGCAGGAGGAAGGG - Exonic
1183665801 22:39245065-39245087 GGAGTCAGCGCCAGGAGGGGGGG + Intergenic
1183696054 22:39423074-39423096 GGAGGCTAAGGCTGGAGGATCGG - Intronic
1183708141 22:39487582-39487604 GGCGGCAGCGGCTGCAGCAGGGG - Exonic
1183728483 22:39603046-39603068 GGAGGCTGAGGCTGGAGGCTGGG + Intronic
1183740076 22:39664406-39664428 GGAGGCACCTGCTAGAGGTGTGG + Intronic
1183742404 22:39676053-39676075 GGAGGGAGAGGCTGGAGGCAGGG + Intronic
1183831122 22:40418788-40418810 AGAAGCAGCAGCTGGTGGAGCGG - Exonic
1183845103 22:40536415-40536437 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1183929434 22:41227644-41227666 AGAGGGCGGGGCTGGAGGAGGGG - Intronic
1184147887 22:42622282-42622304 CCAGGCAGCGGCTGGAGCGGAGG - Intronic
1184227304 22:43136468-43136490 GGAGGCAGCAGCTGGAGGACGGG - Intronic
1184250497 22:43257573-43257595 TGGGGCAGCGGCGGGAAGAGCGG + Intronic
1184299035 22:43544072-43544094 GGAGGCTGGGGAGGGAGGAGTGG - Intronic
1184388425 22:44189210-44189232 GGAGTCTGCAGCTGGAGGAGTGG + Exonic
1184398491 22:44259888-44259910 GCAGGGAGCGCCTGGTGGAGAGG - Intronic
1184499123 22:44861389-44861411 GGGGGCCTCGGCTTGAGGAGGGG + Intronic
1185002024 22:48252024-48252046 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185002094 22:48252376-48252398 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185002172 22:48252769-48252791 GGACGCAGCTGCTGATGGAGCGG - Intergenic
1185187354 22:49409481-49409503 GGAGGCAGAGAGTGGAGCAGAGG - Intergenic
1185226771 22:49657859-49657881 GATGGCAGGGGCTGGAGGAAGGG - Intergenic
1185291605 22:50030348-50030370 GGATGCAGCGGCTGCTGGCGAGG + Intronic
1185320202 22:50197203-50197225 GCAGGCATCAGCTGGAGGGGCGG - Intronic
1185344686 22:50306124-50306146 GCAGGCAGCCGGTGGGGGAGGGG + Intronic
949357410 3:3196605-3196627 GGAGGCAGCGGGTGGAAGAGGGG - Intergenic
949790628 3:7788088-7788110 GGAGTTAGCAGCTGGAGGTGTGG + Intergenic
950121590 3:10485509-10485531 GGAGGGAGCGGGCGCAGGAGAGG - Intronic
950168004 3:10816153-10816175 GGAGGCAGGGGGTGGAGCTGAGG - Intergenic
950253871 3:11488330-11488352 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
950358426 3:12431699-12431721 GGAGGCTGAGGCAGGAGGATTGG + Intronic
950449850 3:13059362-13059384 CGAGGCAGCTGCTGGAGCAGAGG - Intronic
950477283 3:13222144-13222166 GGTGCCAGGGGCTGGGGGAGGGG - Intergenic
950478107 3:13226881-13226903 GGAGGCTGTGCCTGGAGGTGAGG - Intergenic
950528152 3:13536598-13536620 GGAAGGATGGGCTGGAGGAGTGG - Intergenic
950532090 3:13558134-13558156 GGAGGCAGCAGCCAGGGGAGCGG - Intronic
950662840 3:14477406-14477428 GGAGGCAGCAGCTGGGTGAGAGG + Intronic
950940328 3:16884928-16884950 CGAGGCGGCGGCGGGAGGAGAGG + Intronic
951013740 3:17705931-17705953 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
951016961 3:17742317-17742339 GGCGGCTGCGGCTGCAGCAGCGG + Intronic
951080299 3:18444716-18444738 GGCGGCGGCGGCGGCAGGAGAGG - Intronic
951500736 3:23384264-23384286 GGAGGCTGAGGCAGGAGGACTGG - Intronic
952381136 3:32806380-32806402 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
952589927 3:34939585-34939607 GGAGGCATCGTCTGGAGTACTGG + Intergenic
952927492 3:38331386-38331408 GGAGTCAGAGGGTGGAGAAGTGG + Intergenic
952955409 3:38554211-38554233 AGACCCAGGGGCTGGAGGAGAGG + Intronic
953032637 3:39188347-39188369 GGACGAAGAGGCTGGAGCAGAGG - Exonic
953413498 3:42702736-42702758 GGTGACAGCGGGAGGAGGAGGGG + Exonic
953672699 3:44976138-44976160 GGCGGCCGCGGCTGCAGGAGCGG + Exonic
953770588 3:45776176-45776198 GCAGGAAGGGGTTGGAGGAGGGG + Intronic
954031797 3:47825085-47825107 GGACCCAGCGGCTGCAGGCGCGG - Intronic
954051632 3:47984102-47984124 GGAGGCTGAGGCAGGAGGAAAGG - Intronic
954080518 3:48210839-48210861 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
954182992 3:48896271-48896293 GGCGGCTGAGGCTGGAGGATCGG - Intronic
954209063 3:49083657-49083679 GGAGGCCGAGGCAGGAGGATAGG + Intronic
954218915 3:49140378-49140400 GGAGGGACCGGCTGGAGCCGAGG + Intergenic
954247038 3:49340123-49340145 GAAGGCCGCGGCTCGAGGTGGGG - Intronic
954361452 3:50124866-50124888 GTGGGCAGGGGCTGGGGGAGGGG - Intergenic
954372245 3:50175040-50175062 GGTGGCAGGGGCTGGGGGAGCGG - Intronic
954692293 3:52402065-52402087 GGAGGCAGCATCTGGAGTTGGGG - Exonic
954721655 3:52569312-52569334 GGAGGCTGAGGCAGGAGAAGGGG - Intronic
954995361 3:54876290-54876312 GGAAGCTGCGGCTTGAGAAGAGG - Intronic
955053958 3:55439838-55439860 GGAGGCAGCTGGTGCATGAGTGG - Intergenic
955275310 3:57541467-57541489 GGAGGCAGAGGCAGGAGTATTGG - Intronic
955297218 3:57746933-57746955 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
955396196 3:58559443-58559465 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
955400282 3:58586583-58586605 GGAGGCTGAGGCGGGAGGATGGG + Intronic
955460122 3:59173000-59173022 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
955818783 3:62874815-62874837 GGGGGCAGCGGCGCGAGCAGCGG - Exonic
955996921 3:64687666-64687688 GGGGGCAGCGGAGGGAGGGGTGG - Exonic
956093569 3:65693181-65693203 GGAGGCTGAGGCGGGAGGATTGG - Intronic
956270207 3:67443362-67443384 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
956675569 3:71728978-71729000 GGAGGCTGCAGATGGAGGAGAGG + Intronic
956690531 3:71874216-71874238 GCGGCCAGGGGCTGGAGGAGAGG + Intergenic
956814575 3:72896334-72896356 GGAGGCTGAGGCAGGAGGATTGG + Intronic
956849713 3:73217748-73217770 GGAGGGAGCGGCGGGAGGGAGGG - Intergenic
956956614 3:74348637-74348659 GGAGACAGCAGCTGGAAGATAGG - Intronic
957073243 3:75581519-75581541 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
958426519 3:93984541-93984563 GGAGGCAGAGGAGGCAGGAGAGG + Intronic
958538112 3:95430774-95430796 GGAGGCCGAGGCAGGAGAAGGGG + Intergenic
958732311 3:97972423-97972445 CGGCGCAGCGGCTGGAGGCGGGG + Exonic
959042493 3:101438844-101438866 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
959268481 3:104172981-104173003 GGAGGCACCAGCTGGAGCAGTGG - Intergenic
959419595 3:106112658-106112680 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
959963948 3:112333097-112333119 GGAGGAAGAGGCGGGAGGTGCGG + Intronic
960431024 3:117568717-117568739 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
960950121 3:122993771-122993793 GGAGGCAGGAGCGGGAGGGGTGG - Intronic
961111001 3:124282903-124282925 AGAGGCTGCTGCTGGAAGAGGGG + Intronic
961211701 3:125130748-125130770 GGAGGGAGAAGCTGGAGGGGAGG + Intronic
961361596 3:126371389-126371411 GGAGGCATGGGCTGGGGGCGGGG + Intergenic
961369095 3:126418844-126418866 GGGGGCAGAGGCTGGATAAGTGG - Intronic
961397565 3:126606741-126606763 GGAGGCAGGGAATGGAGCAGTGG - Intronic
961453773 3:127014450-127014472 GGAGGCAGAGGCTGGGGTACAGG - Intronic
961457316 3:127030610-127030632 GGGCTCAGCGGCTGGAGCAGAGG - Intronic
961476618 3:127150858-127150880 GGAGGCACCGGGAGGAGTAGAGG - Intergenic
961532659 3:127548642-127548664 GGAGGCTGAGGCGGGAGGATCGG + Intergenic
961663164 3:128481060-128481082 CGAAGGAGAGGCTGGAGGAGGGG + Exonic
961780161 3:129316390-129316412 GAAGCCAGCGGCCGGAGAAGGGG - Intergenic
961873551 3:130004325-130004347 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
962002215 3:131309883-131309905 GGAGGCTGAGGCAGGAGGATCGG + Intronic
962279483 3:134039277-134039299 GGAGGGAGTGCCTGGAGGTGTGG + Intronic
962282378 3:134061571-134061593 GGAGGCAGGGGCTGGATGGCAGG + Intergenic
962417498 3:135196447-135196469 GCAGGCAGTGCCAGGAGGAGAGG + Intronic
962487355 3:135857560-135857582 GGAGGCTGAGGCGGGAGGATTGG + Intergenic
962541672 3:136389032-136389054 GGAGGCCGAGGCAGGAGGATTGG - Intronic
962543591 3:136409158-136409180 GGAGGCAGAGGCAGGAGAATTGG + Intronic
963289930 3:143477349-143477371 GGAGGGGGCGGCGGGGGGAGGGG - Intronic
963473320 3:145771884-145771906 GGAGGGACCGGCTGGAGCCGTGG - Intergenic
963945371 3:151140406-151140428 GTAGCCAGAGGCTGGTGGAGGGG - Intronic
964004205 3:151810006-151810028 GGAGGAGGCAGCTGGGGGAGGGG - Intergenic
964334999 3:155645701-155645723 GGAGGCTGAGGCAGGAGGACTGG - Intronic
964410451 3:156392121-156392143 GGTGGCAGGGGCAGGAGTAGGGG - Intronic
964613043 3:158634088-158634110 GGAGGGACCGGCTGGAGCCGAGG - Intergenic
964885926 3:161482389-161482411 GGAGGCTGTGAGTGGAGGAGAGG + Intergenic
965080027 3:164022708-164022730 GGAGGAAGCTGCTGGGGGAAAGG + Intergenic
966010017 3:175063719-175063741 GGAGGCAGAGGCAGGAGCATTGG - Intronic
966359447 3:179119468-179119490 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
966686870 3:182705143-182705165 GGAGGCAGCAGCAGAAGCAGGGG + Intergenic
966759899 3:183408436-183408458 GGATGCTGCGGCTGCAGCAGTGG + Intronic
966819258 3:183912031-183912053 GGAGGCTGTGGCAGGAGGATTGG - Intergenic
966866432 3:184261195-184261217 GCAGGCGGCAGCTGAAGGAGAGG + Exonic
967323352 3:188215438-188215460 GATGCCAGGGGCTGGAGGAGAGG - Intronic
967914639 3:194569519-194569541 GGAGGCAGAGACTGGTGGATTGG + Intergenic
968083930 3:195865995-195866017 GGAGGCACTGGCGGGAGGAGGGG - Intronic
968342524 3:197968638-197968660 GGAGGGACCGGCTGGAGGCGCGG - Intronic
968433816 4:575181-575203 GGGGGCGGCGGCTGCAGCAGCGG - Intergenic
968500641 4:948268-948290 GGAGGCAGAGGCGGGAGGCGGGG + Intronic
968529283 4:1082010-1082032 GGAGGCAGGGGCGGGAGGATTGG + Intronic
968652978 4:1767366-1767388 GGAGGGAGGGGCAGGAGGGGAGG - Intergenic
968652987 4:1767384-1767406 GGAGGGAGGGGCAGGAGGGGAGG - Intergenic
968652996 4:1767402-1767424 GGAGGGAGGGGCAGGAGGGGAGG - Intergenic
968674828 4:1871657-1871679 GGCGGGAGCGCCGGGAGGAGTGG + Intronic
968799620 4:2733505-2733527 AGAGGCAGCGGCTGGAGTCCCGG - Intergenic
968817236 4:2828421-2828443 GGAGGGAGCGGCAGGAGAAGAGG - Intronic
968914849 4:3492935-3492957 GGACGCAGCGGCTTGGGGGGTGG - Exonic
968968903 4:3783412-3783434 GGAGGAAGGGGCTTGCGGAGGGG + Intergenic
968972735 4:3804315-3804337 GGAGTCAGCTGGTGGAGGGGCGG - Intergenic
968975055 4:3817699-3817721 AGAGGCTGCGGCTGGGGCAGAGG + Intergenic
969016840 4:4108814-4108836 GGAGGCAGTGGAAGCAGGAGAGG + Intergenic
969210228 4:5681631-5681653 GGAGGCAGACGCTGGGAGAGTGG - Intronic
969352230 4:6604442-6604464 GGTGGGAGTGGCTGGAGGATGGG + Intronic
969436559 4:7192504-7192526 GGAGGGAGCGGCGGGAGGAGGGG - Intergenic
969451646 4:7277203-7277225 GGAGGCAGGGGCTTGTGGAGTGG + Intronic
969506461 4:7591231-7591253 GGAGGCAGCAGCAGGTGGAGGGG - Intronic
969629095 4:8325046-8325068 GAAGGCAGAGGCTGGAGGTGCGG - Intergenic
969630897 4:8335412-8335434 AGAGGCAGCTGTTGTAGGAGAGG + Intergenic
969631404 4:8340771-8340793 GGAGGCAGTGGCTTGGGGTGTGG + Intergenic
969725537 4:8916082-8916104 CGAGGCCTCGGCTGGAGGGGAGG - Intergenic
969737121 4:8999501-8999523 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
969796313 4:9531089-9531111 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
970007843 4:11428015-11428037 AGTGGCAGCGGATGGAGGTGAGG - Intronic
970058024 4:11997265-11997287 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
970203123 4:13629292-13629314 GGAGGCTGAGGCGGGAGGATCGG + Intergenic
970465015 4:16313784-16313806 GGATGCAGAGGCAGGAGGTGAGG + Intergenic
970517361 4:16846003-16846025 GGAGGCTGAGGCAGGAGGATGGG + Intronic
970546970 4:17139657-17139679 GGAGGGACCGGCTGGAGCCGTGG + Intergenic
970585665 4:17512027-17512049 GGCGGCGGCGGCTGCAGGCGAGG - Exonic
970709296 4:18843041-18843063 GGGGGCAGCTGCTGGAGGGCAGG + Intergenic
972287532 4:37663169-37663191 GGAGGGAGGGGCTGGAGAACAGG - Intronic
972332764 4:38079075-38079097 GGAGGCCAGGGCTGGAGGGGAGG + Intronic
972503477 4:39698530-39698552 GAAGGCGGCGGAAGGAGGAGGGG - Intronic
972568032 4:40286300-40286322 GGAGGCCGAGGCTGAAGGATTGG + Intergenic
972940648 4:44191035-44191057 GGAGGGACCGGCTGGAGCCGTGG + Intronic
973230913 4:47837775-47837797 GGTGGCATCGGGCGGAGGAGAGG + Intronic
973283198 4:48383062-48383084 AGAGGCTGAGGCTGGAGGATTGG + Intronic
973608103 4:52607752-52607774 GAAGCCAGGGGTTGGAGGAGGGG - Intronic
973774927 4:54233643-54233665 GGAGGCGCCGGGTGGACGAGAGG + Intronic
974031872 4:56783497-56783519 GGAGGCTGAGGCAGGAGAAGGGG + Intergenic
974055226 4:56977250-56977272 GGCAGCAGCGGCGGGAGGAGCGG - Exonic
974055841 4:56982230-56982252 GGAGGCAGTGGCTTTGGGAGGGG - Intronic
974385660 4:61200559-61200581 GGCGGCAGCAGCTGCCGGAGCGG - Intergenic
974466681 4:62266095-62266117 GGAGGCAGAAGCTAGAGGACAGG - Intergenic
975307740 4:72868274-72868296 GGAGGGACTGGCTGGAGCAGCGG - Intergenic
975530838 4:75397514-75397536 CAAGGGAGAGGCTGGAGGAGAGG - Intergenic
975715872 4:77205499-77205521 GGAGGGGGCGGCTGGGGGCGGGG - Intronic
975996395 4:80321129-80321151 GGAGGCTGAGGTTGGAGGATTGG - Intronic
976601903 4:86945602-86945624 GGAGGCTGAGGCAGGAGGATTGG - Intronic
976645574 4:87384133-87384155 GGAGGGACCGGCTGGAGCCGCGG + Intronic
976649287 4:87417866-87417888 GGAGGGACCGGCTGGAGCTGTGG + Intergenic
976789200 4:88858720-88858742 GCTGGCAGGGGATGGAGGAGGGG + Intronic
977720275 4:100231560-100231582 GGAGGGACCGGCTGGAGCCGTGG - Intergenic
978216346 4:106208891-106208913 GGAGCCGGCGTCTGGATGAGGGG - Intronic
979283039 4:118888888-118888910 TGGGGCAGCGGCTGCAGCAGCGG + Exonic
979432482 4:120648048-120648070 GGCAGCAGCGACTGGGGGAGGGG - Intergenic
979512960 4:121574825-121574847 GGAAGCAGGGGATGGAGGTGGGG + Intergenic
979558816 4:122079389-122079411 GGAGGCTGAGGCAGGTGGAGTGG - Intergenic
979832043 4:125315659-125315681 GGCGGCGGCGGCTGCAGGAGGGG + Intergenic
980298668 4:130958305-130958327 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
980578222 4:134713451-134713473 GGAGGCTGAGGGGGGAGGAGTGG - Intergenic
980600633 4:135019771-135019793 GGAGGGAGCGGCTGGAGCCATGG - Intergenic
980954468 4:139414314-139414336 GGAGGGACCGGCTGGAGCCGTGG + Intronic
980984423 4:139682090-139682112 GGAGGCTGAGGTTGGAGGATTGG + Intronic
981736752 4:147961666-147961688 AGAGGAAGCTGCTGGAGAAGGGG - Intronic
982268541 4:153563569-153563591 GGAGGCTGAGGCAGGAGGACGGG - Intronic
982616107 4:157637778-157637800 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
983561015 4:169101438-169101460 GGTTGCAGGGCCTGGAGGAGGGG + Intronic
983576483 4:169266620-169266642 GGGGGCAGGGGATGGGGGAGGGG + Intronic
984109164 4:175589105-175589127 GAAGGAAGCTGCTGGATGAGAGG - Intergenic
984219180 4:176952400-176952422 GTTGGCAGCGGCTAGAGGAAGGG + Intergenic
984404203 4:179306256-179306278 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
984649175 4:182251229-182251251 GGAGGCAGAAGCAGGAGGATTGG + Intronic
984720990 4:182972968-182972990 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
984726782 4:183029230-183029252 GGAGGCTGAGGCAGGAGGATCGG + Intergenic
984859880 4:184228494-184228516 GGAGGCAGAGACTGGAGCAATGG - Intergenic
984967954 4:185157214-185157236 GGAGGCCTCGGCGGGAGGATTGG + Intergenic
985332225 4:188850792-188850814 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
985555578 5:556320-556342 AGACGCAGCGGGTGGGGGAGCGG + Intergenic
985758503 5:1733156-1733178 GCAGGTAGCGGCAGGAGGTGAGG - Intergenic
985779957 5:1865374-1865396 GGTGGCAGCGCCTCTAGGAGAGG - Intergenic
985824493 5:2182182-2182204 GGCAGCAGCGTCTGCAGGAGGGG - Intergenic
985905227 5:2830167-2830189 GGAGGCCACTGCTGGAGGAGGGG - Intergenic
986287717 5:6372331-6372353 GGACCGAGGGGCTGGAGGAGAGG - Exonic
987371968 5:17201710-17201732 GGAGGCTGAGGCTGGCGGATTGG + Intronic
987572875 5:19687678-19687700 GGCGGCAGTGGCTGCAGCAGTGG - Intronic
988777530 5:34490788-34490810 GGTGGCAGGGGCGGGAGGGGAGG + Intergenic
989325985 5:40195637-40195659 GGAGGCTGAGGCAGGAGAAGTGG - Intergenic
989329066 5:40234522-40234544 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
989389621 5:40886489-40886511 AGAGGCAGAGGCAGGAGGATTGG - Intergenic
990297297 5:54415604-54415626 GGAGGCAGAGGTGGGAGGATTGG + Intergenic
990674118 5:58163939-58163961 GGAGGCCGAGGCAGGAGGATTGG - Intergenic
990806483 5:59668469-59668491 GGAGGCCAAGGCTGGAGGATTGG + Intronic
991048012 5:62243232-62243254 GGAGGCTGAGGCAAGAGGAGAGG + Intergenic
991270949 5:64780063-64780085 GGGGGCTGTGGGTGGAGGAGGGG - Intronic
991542668 5:67746970-67746992 GGAGGGACCGGCTGGAGCCGTGG - Intergenic
992186048 5:74245673-74245695 GGAAGCAGCAGACGGAGGAGTGG - Intergenic
992373712 5:76171051-76171073 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
992648403 5:78833550-78833572 GGAGGCAGTGGAGGGAGGAAGGG + Intronic
992819760 5:80484702-80484724 GGAGGCTGAGGCAGGAGGATGGG - Intergenic
993060793 5:83036457-83036479 GCAGGAAGGGGCGGGAGGAGAGG + Intergenic
993143121 5:84059160-84059182 GGAGGCTGAGGCAGGAGGATTGG + Intronic
993386435 5:87268071-87268093 GGTGGTGGCGGCTGAAGGAGCGG + Exonic
993855990 5:93075677-93075699 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
994812959 5:104546501-104546523 GGAGGGACCGGCTGGAGCCGAGG + Intergenic
994914621 5:105958516-105958538 GGAGGCTGAGGCAGGTGGAGTGG - Intergenic
995402341 5:111757276-111757298 GGAGGAAGAGGAGGGAGGAGGGG + Intronic
995518501 5:112977148-112977170 GGAGGCTGCGGCGGAAAGAGGGG - Intronic
995650530 5:114362918-114362940 GGCGGCAGCGGCTGCAGACGGGG - Exonic
995854235 5:116575791-116575813 GGGCGCAGCGGCAGGGGGAGGGG - Intergenic
996423766 5:123290791-123290813 GGAGGCTGCCCCAGGAGGAGGGG - Intergenic
996517070 5:124382581-124382603 GGAGGGACCGGCTGGAGCTGCGG + Intergenic
997004257 5:129800019-129800041 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
997013378 5:129904545-129904567 GGCGGCAGCGGCGGCAGCAGCGG - Exonic
997494965 5:134315746-134315768 GGAGGCTGAGGCGGGAGGATTGG + Intronic
997585216 5:135039780-135039802 GGCGGCGGCGGCGGGAGGAGCGG - Intronic
997634522 5:135395150-135395172 TGAGCCAGAGGCAGGAGGAGAGG - Intronic
997736951 5:136219958-136219980 GGAGGGAACGGCTGGAGCTGCGG + Intronic
997834339 5:137180136-137180158 GGAGGCAGGTGCTAGAGGGGTGG - Intronic
997984586 5:138492300-138492322 GGCGGCAGCGGCGGGAGGGACGG + Intergenic
998400246 5:141844933-141844955 AGAAGCAGTGGCAGGAGGAGGGG + Intergenic
998470485 5:142380066-142380088 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
998486363 5:142505939-142505961 GTAGGCAGGGTCTGGAGGCGGGG + Intergenic
998517338 5:142768493-142768515 GGTGACAGGAGCTGGAGGAGTGG - Intergenic
998819802 5:146048209-146048231 GGAGGCTGAGGCAGGAGGATGGG + Intronic
999218802 5:149958248-149958270 AAAGGCAGCGGGTGGAGGGGTGG - Intergenic
999272731 5:150306962-150306984 GGAGGCAGAAGGTGGATGAGAGG - Intronic
999291906 5:150431253-150431275 GGGAGCAGCGGCAGGAGGTGAGG + Intergenic
999498441 5:152123469-152123491 GGAGGCAGCTGCTCTAGGACAGG - Intergenic
999986694 5:157012238-157012260 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1000161017 5:158597831-158597853 GTTGCCAGGGGCTGGAGGAGAGG + Intergenic
1000220486 5:159209406-159209428 GGAGGCAGCGGCAGCGGCAGCGG + Intronic
1000234789 5:159347278-159347300 GGAGGCCGAGGTGGGAGGAGTGG + Intergenic
1000343428 5:160294898-160294920 GGGGGCAGGAGCTGGAGGTGTGG - Intronic
1000985239 5:167858821-167858843 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1001209143 5:169794068-169794090 GGAGGCAGGTGCTGGAGTTGGGG - Intronic
1001493127 5:172169411-172169433 GGAGGTAGGGGCTGGAGGAATGG + Intronic
1001647829 5:173295383-173295405 CAAGGCAGCTGATGGAGGAGAGG - Intergenic
1001650933 5:173315868-173315890 GGTGGCGGGGGCTGGAGGTGGGG + Exonic
1001781251 5:174370955-174370977 GGAGGAAGGAGATGGAGGAGAGG - Intergenic
1001801254 5:174546085-174546107 GGAGGCAGGGGCAGGAGGTGGGG - Intergenic
1001991170 5:176116516-176116538 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1001993434 5:176135093-176135115 GGAGGGAGAGGCTGGGGGCGAGG + Intergenic
1002029369 5:176416547-176416569 GGGCGCCGCGGCGGGAGGAGCGG + Exonic
1002121942 5:177011753-177011775 GGAGGGACCGGCTGGAGCCGTGG + Intronic
1002190149 5:177473643-177473665 CGAGCCAGCGGCCGGGGGAGGGG + Intronic
1002225704 5:177721620-177721642 GGAGGCTGAGGCAGGAGGACTGG - Intronic
1002268145 5:178049585-178049607 GGAGGCTGAGGCAGGAGGACTGG + Intronic
1002320881 5:178375246-178375268 GTTGGCAGGGGCTGGGGGAGAGG + Intronic
1002321369 5:178377964-178377986 GGAGGCTGAGGCAGGAGGATCGG + Intronic
1002341420 5:178518827-178518849 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1002402152 5:178996781-178996803 GGGGGCAGCAGCTGGGGGACTGG + Intergenic
1002455903 5:179345231-179345253 GGCGGCGGCGGCGGCAGGAGCGG + Exonic
1002661183 5:180792078-180792100 GGATGCGGCGGCCGGAGCAGCGG - Exonic
1002685136 5:181003975-181003997 GGAAGCACCGGCAGGTGGAGGGG + Intronic
1002887762 6:1311773-1311795 GGAGGAGCCGGCTGGCGGAGCGG + Intergenic
1002954831 6:1851976-1851998 GCAGGGAGAGGCAGGAGGAGAGG + Intronic
1003550888 6:7101218-7101240 GGAGGCACTGGCTGTAGGGGTGG - Intergenic
1004160197 6:13206038-13206060 GGAGGGAGCCGGTGGTGGAGGGG - Exonic
1004354621 6:14920317-14920339 GCAGACAGAGGCTTGAGGAGGGG + Intergenic
1004382236 6:15142492-15142514 GGAGGCTGAGGCAGGAGGATCGG - Intergenic
1004387940 6:15188438-15188460 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1004562052 6:16760805-16760827 GGAGGCGGCGGCTGGGGTTGGGG - Intronic
1004813470 6:19286595-19286617 GGTGACAGGGGCTGGGGGAGGGG + Intergenic
1005353935 6:24963993-24964015 GAAGGCGGAGGCAGGAGGAGGGG - Intronic
1005486225 6:26302741-26302763 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1005883041 6:30074804-30074826 GGAGGGAGCGGCGGGCGGAAGGG - Intronic
1005885183 6:30092131-30092153 GCAGGGAGGGGCTGGATGAGGGG - Intergenic
1005930923 6:30483221-30483243 GGAGGCAGAGACTGGAGCAATGG - Intergenic
1006136110 6:31897328-31897350 GGGGGCAGCGGGTGCTGGAGGGG - Intronic
1006154635 6:32007603-32007625 TGAGGGAGCGGCTGGAGGCTGGG + Intergenic
1006160947 6:32040338-32040360 TGAGGGAGCGGCTGGAGGCTGGG + Intronic
1006168744 6:32081178-32081200 GGAGGTGGAGGCTGGATGAGGGG + Intronic
1006180711 6:32151940-32151962 GAAGGCAGCGGCGGGGGGGGGGG + Exonic
1006337411 6:33427910-33427932 GGCGGCAGCGGCGGGAGCGGCGG + Intronic
1006349944 6:33513621-33513643 GAAGGCAGCAGGTGGAGGGGGGG - Intergenic
1006399034 6:33805291-33805313 TGAGGCAGCGTCTGGATGTGTGG - Intergenic
1006410550 6:33871003-33871025 GGCTGAAGGGGCTGGAGGAGAGG - Intergenic
1006492122 6:34396971-34396993 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1006727226 6:36208395-36208417 GGAAGCAGAGGCAGGAGGATAGG + Intronic
1006751510 6:36380853-36380875 GGAGTCAGGGGCTGGAGAAGGGG - Intronic
1006814167 6:36839557-36839579 GGGGGCCGCGGATCGAGGAGGGG + Exonic
1006910478 6:37560243-37560265 GGAGGCAGAAGCTGGGGCAGGGG + Intergenic
1006913322 6:37578360-37578382 GGAGGCAGGGGCAGCGGGAGTGG + Intergenic
1007089430 6:39172936-39172958 GAAGGCAGGGGCTGGAGGTAAGG + Intergenic
1007305739 6:40902867-40902889 GCAGACAGAGGGTGGAGGAGAGG - Intergenic
1007309590 6:40934851-40934873 GGTGTCAGAGGTTGGAGGAGAGG + Intergenic
1007345900 6:41229204-41229226 GGATGTACCGGGTGGAGGAGAGG - Intronic
1007431412 6:41779573-41779595 GGAGCCAGAGGCTGCAGGACAGG + Intronic
1007467899 6:42067801-42067823 GGAGGCTGAGGCAGGAGGACTGG - Intronic
1007535209 6:42581115-42581137 GGAGGCTGAGGCAGGAGGAAAGG - Intronic
1007630762 6:43272065-43272087 GGAGGCAGTGCCAGCAGGAGGGG - Intronic
1007674436 6:43581577-43581599 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1007916031 6:45562540-45562562 GGAGGCAGCGGCTCCAGGATGGG - Intronic
1008143479 6:47859922-47859944 GGGGGCAGTGGCTGGAGAAGTGG + Intergenic
1008673332 6:53795031-53795053 GGAGGCACCGGCTGGCGGGCGGG + Exonic
1009520098 6:64670874-64670896 GGAGGCTGCTGGTGAAGGAGAGG - Intronic
1009990350 6:70835608-70835630 GGAGGCTGAGGCTGGAGGATTGG - Intronic
1010198471 6:73263073-73263095 GGCGGCAGCGGCTGCAGGCCTGG + Exonic
1010502844 6:76622667-76622689 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1010810538 6:80294160-80294182 GGAGGGACCGGCTGGAGCTGCGG + Intronic
1011266612 6:85526963-85526985 GGAGGCCGAGGCTGGAGAATCGG + Intronic
1011405431 6:87010832-87010854 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1011448216 6:87465920-87465942 TAAGGCAGGGCCTGGAGGAGTGG + Intronic
1012112444 6:95254107-95254129 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1012791844 6:103708712-103708734 GGCTGCAGGGGCTGGAGGAGTGG - Intergenic
1012981007 6:105830892-105830914 GGAAGGGGCAGCTGGAGGAGGGG + Intergenic
1012981015 6:105830913-105830935 GGAAGGGGCAGCTGGAGGAGGGG + Intergenic
1012981023 6:105830934-105830956 GGAAGGGGCAGCTGGAGGAGGGG + Intergenic
1012981078 6:105831081-105831103 GGAAGGGGAGGCTGGAGGAGGGG + Intergenic
1012981114 6:105831171-105831193 GGAGGGGGCAGCTGGAGGAGGGG + Intergenic
1012981122 6:105831192-105831214 GGAAGGGGCAGCTGGAGGAGGGG + Intergenic
1012981144 6:105831256-105831278 GGAAGGGGCAGCTGGAGGAGGGG + Intergenic
1013135201 6:107275737-107275759 GGAGGCAAAGGCTGAAGGAATGG + Intronic
1013273561 6:108562235-108562257 GGACGCAGTGTCTGGAGGAGGGG + Intronic
1013373465 6:109490905-109490927 TGGGGCAGCAGCTGGAGGATGGG + Intergenic
1013387237 6:109643730-109643752 GGAGGATGGGGCTGGAGGGGTGG - Intronic
1013514656 6:110875031-110875053 GGCGGCAGCGGCGGGAGAAGAGG + Exonic
1014212094 6:118718364-118718386 AGAGGCAGGGGCTGGGGGAAAGG - Intergenic
1014315201 6:119855814-119855836 GGAGGGAAAGGTTGGAGGAGAGG + Intergenic
1014591814 6:123282129-123282151 AGAGGCAGAGACTGGAGGATGGG + Intronic
1014800522 6:125772148-125772170 GGAGGCTGAGGCTGGAGAATGGG - Intergenic
1015425488 6:133060862-133060884 GTAGTCAGGGGCTGGAGGATGGG + Intergenic
1015476531 6:133664281-133664303 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1015809479 6:137147109-137147131 GGAGGCCAAGGCTGGAGGATTGG + Intronic
1015820376 6:137254164-137254186 GGAGGGACCGGCTGGAGCTGTGG + Intergenic
1015952640 6:138569090-138569112 GGCAGCAGCTGCTGGAGGGGAGG + Intronic
1016692237 6:146951116-146951138 GCAGGCAGCTGCAGGAGAAGGGG - Intergenic
1016779811 6:147944904-147944926 GGAGGCAGAGGCTGGAACAATGG - Intergenic
1017058260 6:150456896-150456918 GGAGGCAGGGGATTTAGGAGAGG + Intergenic
1017448784 6:154534112-154534134 GGAGGCTGAGGCGGGAGGATCGG - Intergenic
1017740080 6:157398476-157398498 GGAAGCAGAGGCTGGAGGCCAGG + Intronic
1017850142 6:158298419-158298441 GGAGGGACCGGCTGGAGCTGCGG - Intronic
1017855377 6:158346353-158346375 GGAGGGACCGGCTGGAGCTGTGG - Intronic
1018471368 6:164101194-164101216 GGGGGCTGCAGATGGAGGAGGGG - Intergenic
1018471445 6:164101401-164101423 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471469 6:164101464-164101486 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471476 6:164101485-164101507 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471483 6:164101506-164101528 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471490 6:164101527-164101549 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471509 6:164101590-164101612 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018471516 6:164101611-164101633 GGAGCCTGCAGGTGGAGGAGAGG - Intergenic
1018471530 6:164101674-164101696 GGAGCCTGCAGGTGGAGGAGAGG - Intergenic
1018471554 6:164101779-164101801 GGAGCCTGCAGGTGGAGGAGGGG - Intergenic
1018938323 6:168289427-168289449 GGAGCCAGCTGCGGGGGGAGTGG + Intergenic
1019108515 6:169690350-169690372 GGAGGGAGGAGCTGGAGAAGAGG - Intronic
1019232184 6:170576667-170576689 GGAGGCAGCAGCCTGAGGAAAGG - Exonic
1019395590 7:816359-816381 GGGGGCTGCACCTGGAGGAGGGG - Intergenic
1019512904 7:1426888-1426910 GGAGTCAGGGGCTGGTGGAGGGG + Intergenic
1019558775 7:1645585-1645607 GCAGGCAGGGGCTGCAGGGGTGG + Intergenic
1019614843 7:1954523-1954545 GGAGGCCGTGGCTGCAGGTGGGG + Intronic
1019703234 7:2484678-2484700 GCAGGCAGCGGCTGTTGGATAGG - Intergenic
1019709507 7:2511815-2511837 GGAGGCTGCGGCAGGGGCAGGGG - Intergenic
1019832697 7:3349121-3349143 GGAGGCAGCAGAAGTAGGAGAGG - Intronic
1019846251 7:3505353-3505375 GGAGGCAGAGGCAGGAGGATTGG - Intronic
1019898490 7:4001209-4001231 GCAGGCAGTGGGTGGAGCAGGGG - Intronic
1019959825 7:4449803-4449825 GGGGGCAGCAGCAGGAGCAGGGG - Intergenic
1020007092 7:4788847-4788869 GGCTGCAGCAGCTGGTGGAGTGG - Exonic
1020041306 7:5004484-5004506 GGAGGCTGAGGCAGGAGGATGGG - Intronic
1020070398 7:5223475-5223497 GGAGGCAGGAGCTGGAGGAGCGG - Intronic
1020106251 7:5423553-5423575 GGCGGCTGCGGGTGGCGGAGGGG - Intronic
1020206695 7:6123283-6123305 GGAGGCTGAGGCAGGAGGATGGG + Intronic
1020227401 7:6291004-6291026 GAAGGAAGCGGCTGGGTGAGGGG + Intergenic
1020406277 7:7839313-7839335 GGAGGCTGAGGCAGGAGGACTGG - Intronic
1020616636 7:10466452-10466474 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1020863860 7:13531337-13531359 GGTGGTAGAGGCTGGAGGACAGG - Intergenic
1021298917 7:18945931-18945953 GGAGGCTGAGGCTGGAGAATCGG + Intronic
1021633108 7:22665560-22665582 TGGGGCAGCGCCTGGGGGAGAGG - Intergenic
1021744524 7:23725294-23725316 GGAGGCCGAGGCAGGAGGATTGG + Intronic
1021758581 7:23880788-23880810 GGAGGCAGTAGCTAGAGGAGTGG + Intergenic
1021872140 7:25017946-25017968 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1022106293 7:27199945-27199967 GGCGGCGGCGGCTGCAGCAGCGG - Exonic
1022230797 7:28410252-28410274 GCAGGAGGCGGCCGGAGGAGTGG - Intronic
1022253907 7:28636431-28636453 GGAGGCAGGGGATGCAGTAGGGG - Intronic
1022477922 7:30723809-30723831 GAGGGCAGGGGCTGGAGGGGTGG + Intronic
1022717774 7:32914377-32914399 GGGGGCAGTGGCTGGAGCACTGG - Intergenic
1022737748 7:33091977-33091999 GGGGGCAGTGGCTGGAGCACTGG - Intergenic
1023057208 7:36299976-36299998 GGAGGCAGGGGATGAAGGAGGGG - Exonic
1023113152 7:36834500-36834522 GGAGCCCCCGGCTGGTGGAGAGG - Intergenic
1023163930 7:37324362-37324384 GCAGGCAGAGGCCGGAGAAGTGG - Intronic
1023405851 7:39833405-39833427 GGAGCCAGCGCCTGGTGGGGAGG + Intergenic
1023718451 7:43068191-43068213 GGAGGCTGAGGCAGGAGGATGGG - Intergenic
1023764465 7:43497846-43497868 GGAGGAACTGGCTTGAGGAGAGG + Intronic
1023816150 7:43951632-43951654 GGAGGCTGAGGCAGGAGGATAGG - Intronic
1023862694 7:44225628-44225650 AGGAGCAGCGGCTCGAGGAGGGG - Intronic
1023936365 7:44742754-44742776 GGAGGCTGAGGCTGGAGGATCGG - Intergenic
1024028354 7:45433336-45433358 GGAGGGAGAGGAAGGAGGAGGGG - Intergenic
1024055966 7:45660008-45660030 GGAGGCAGAGGCCAGATGAGTGG - Intronic
1024063666 7:45716326-45716348 CAAGGCAGGGCCTGGAGGAGAGG - Exonic
1024084936 7:45885030-45885052 GGGGGCAGCCGCAGGAGGTGGGG + Intergenic
1024270401 7:47637142-47637164 AAATGCAGCGGCTGGAGGAGGGG - Intergenic
1024624190 7:51190310-51190332 AGAGGCTGAGGCTGGAGGATTGG - Intronic
1024759925 7:52583218-52583240 GGGGGCAGGGGTGGGAGGAGCGG + Intergenic
1024905275 7:54372155-54372177 GAAGGCAGCACTTGGAGGAGGGG - Intergenic
1025803509 7:64809285-64809307 GGACGGGGCGGCTGGAGGGGCGG + Intronic
1025835279 7:65087285-65087307 GGAGGCAGGGGGTTGGGGAGGGG + Intergenic
1025905055 7:65776758-65776780 GGAGGCAGGGGGTTGGGGAGGGG + Intergenic
1026229173 7:68468381-68468403 GGAGGCTGAGGTGGGAGGAGAGG + Intergenic
1026438080 7:70417258-70417280 GGAGGCAGAGGCAGCGGGAGAGG + Intronic
1026806155 7:73430507-73430529 GGAGGCAGGGGGAGGGGGAGGGG - Intergenic
1026873661 7:73867964-73867986 TGAGGCAGGGACTGGAGGAAAGG + Intergenic
1026939680 7:74280176-74280198 GCAGGCTGAGGCTGGAGGATTGG - Intergenic
1027612890 7:80384459-80384481 GGAGGCTGGGGCAGGAGGATTGG - Intronic
1028121213 7:87058895-87058917 GGAGACAGGGGGAGGAGGAGCGG + Intronic
1028398965 7:90404024-90404046 GGAGGCGGAGGGGGGAGGAGGGG + Intronic
1028584946 7:92443637-92443659 GGAGGGACCGGCTGGAGCTGTGG - Intergenic
1029075319 7:97929614-97929636 GGAGGCAGAGGAGGCAGGAGAGG + Intergenic
1029204995 7:98864453-98864475 GGAGGCTAAGGCAGGAGGAGTGG - Intronic
1029263899 7:99324018-99324040 GGGGGCAGGGGCTAGGGGAGAGG + Intergenic
1029479256 7:100802957-100802979 GAAGGCAGCAGCTGGGGGAGGGG + Exonic
1029623115 7:101702309-101702331 GGAGGCACAGCCTGGGGGAGAGG + Intergenic
1030303516 7:107997947-107997969 GAAGGCAGTGGGGGGAGGAGTGG + Intronic
1030340929 7:108379451-108379473 GGCGACAGGAGCTGGAGGAGAGG + Intronic
1030470192 7:109953755-109953777 GGAGGCAGGGGCGGGGCGAGGGG - Intergenic
1030566480 7:111164114-111164136 GGAGGGAGGGGAGGGAGGAGAGG + Intronic
1030842327 7:114371182-114371204 GGAGGCTGAGGCAGGAGGACTGG - Intronic
1031514783 7:122688444-122688466 GGAGGGAGTGGGTGGATGAGTGG + Intronic
1031966713 7:128032322-128032344 GGAGGAAGCGGCCCGGGGAGGGG - Intronic
1032107068 7:129041256-129041278 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1032165178 7:129539746-129539768 GGAGGCAGAGGCGGTAAGAGGGG - Intergenic
1032441588 7:131946380-131946402 GGAGGCAGGGGTCGGTGGAGGGG + Intergenic
1032465561 7:132142303-132142325 GGAGGCAGAGGTGGGAGCAGAGG - Intronic
1033232983 7:139616170-139616192 GGAAGCAGCAGCAGGAGCAGTGG - Intronic
1033300022 7:140177062-140177084 GGCCGCGGCGGCTGGCGGAGGGG + Intergenic
1033565525 7:142574904-142574926 AGAGGCAGAGGCAGGGGGAGGGG - Intergenic
1033584323 7:142762882-142762904 GGTGCCAGCAGCTGGAGGGGCGG - Intronic
1033705639 7:143882864-143882886 GGAGGCTGGAGCTGGAGGAGAGG + Intronic
1033846939 7:145444764-145444786 GGAGGCAGGGGCTGGCGATGCGG + Intergenic
1034446662 7:151117220-151117242 GTGGGCAGGAGCTGGAGGAGTGG - Intronic
1034466393 7:151232510-151232532 GGTGGCAGCGGCTGCAGCGGCGG + Exonic
1034469990 7:151249832-151249854 GGAGGGACCGGAAGGAGGAGGGG + Intronic
1034578859 7:152025676-152025698 GGAGGCAGCGGCTCGGGGACTGG + Intronic
1035508113 8:150614-150636 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1035567219 8:649687-649709 GGAGGCAGGAGCTGGAAGACGGG + Intronic
1035680439 8:1483668-1483690 GGAGGCAGGTGCAGGAGGTGGGG + Intergenic
1035700978 8:1639147-1639169 GGAGGTCGAGGCTGGAGGTGCGG + Intronic
1035702884 8:1650768-1650790 GGTGGCAGTTGCTGGAGCAGAGG + Intronic
1035830535 8:2690039-2690061 GGAGGCAGAGGCAGGGGGATTGG + Intergenic
1036220338 8:6915910-6915932 GGAGGCAGCAGCAGGAAGAGGGG - Intergenic
1036242196 8:7090710-7090732 GGAGGCAGCGGAGGCAGGACAGG - Intergenic
1036399689 8:8396744-8396766 GTAGCCAGAGGCTGGAGGAGAGG + Intergenic
1036471688 8:9058129-9058151 AAAGGCAGGAGCTGGAGGAGAGG + Intronic
1036536878 8:9658325-9658347 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1036748658 8:11429126-11429148 GGTGCCAGGGGCTGGAGGAGGGG - Intronic
1036830532 8:12016366-12016388 GGAGGCAGGGGAGGCAGGAGAGG + Intergenic
1036900680 8:12666813-12666835 GGAGGCAGGGGACGCAGGAGAGG + Intergenic
1036948211 8:13115376-13115398 GCAGGCAGCAGATGGGGGAGTGG + Intronic
1037678220 8:21070801-21070823 GGAGGCTGCTGCTGGGGGAAAGG + Intergenic
1037737799 8:21581183-21581205 GGAGGCAGGAGCTTAAGGAGGGG - Intergenic
1037806750 8:22062192-22062214 GGAGGCTGAGGCAGGAGGATGGG - Intronic
1037815906 8:22111753-22111775 GGAGGCAGCTGAGGGAGGACGGG + Intergenic
1037936100 8:22915997-22916019 GGAGGCTGCGGCTAGAGGCCTGG + Intronic
1038197251 8:25379744-25379766 GGAGGGACCGGCTGGAGCTGCGG - Intronic
1038240945 8:25807641-25807663 GGAGCCAGGGGCTGCTGGAGAGG - Intergenic
1038420952 8:27433763-27433785 AGAGGCAGCTTCTGGAGGAGAGG + Intronic
1038455368 8:27669176-27669198 GGAGGGAGTGGCAGGAGAAGGGG + Intronic
1038495264 8:27997175-27997197 GGTGCCAGGGGCTGGAGGACAGG - Intergenic
1039474658 8:37833353-37833375 GCAGAGGGCGGCTGGAGGAGAGG - Intronic
1039478581 8:37855084-37855106 GGAGGCAGAGGCAGGAGAATTGG - Intergenic
1039793967 8:40896847-40896869 GGAGGTGGAGGCTGGTGGAGGGG - Intronic
1039807434 8:41012629-41012651 AGAGGCAGAGGCTGGAGGGAAGG - Intergenic
1039818634 8:41116862-41116884 GGAGGCTGAGGCAGGAGGATAGG - Intergenic
1039938643 8:42069853-42069875 GGAGGCTGAGGCGGGAGGATTGG - Intergenic
1039944117 8:42115589-42115611 AGGGGCAGCGGATGGAGAAGGGG - Intergenic
1040400614 8:47045847-47045869 GGTGGGTGCGGCTGGAGGAGTGG - Intergenic
1040408604 8:47133392-47133414 GGTGGCCGCGGCTGCAGGGGAGG + Intergenic
1040580316 8:48693613-48693635 GGTGGCACAGGCTGGAGGAGGGG - Intergenic
1040583731 8:48719966-48719988 GGAGGGACCGGCTGGAGCTGCGG + Intronic
1040894006 8:52346888-52346910 GGAGGAAACGGCTGGAGTAGGGG + Intronic
1041167185 8:55102040-55102062 GGAGTCAGCTGGTGGAGGAGAGG + Intergenic
1041330483 8:56719117-56719139 GGAGGGAAGGGCAGGAGGAGAGG - Intergenic
1042048811 8:64685176-64685198 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1042827726 8:72995433-72995455 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1042902836 8:73746369-73746391 GGTGGTAGCGGCCGGAAGAGAGG - Intronic
1043389454 8:79778005-79778027 GGGGGGGGCGGTTGGAGGAGGGG + Intergenic
1043408913 8:79971501-79971523 GGAGGCAGTGGGTGGGGTAGGGG - Intronic
1043527903 8:81116017-81116039 GGAGAGAGCAGCTGGGGGAGAGG + Intergenic
1043781643 8:84343731-84343753 GGAGGCTGAGGCAGGAGGAATGG - Intronic
1044190537 8:89311256-89311278 GGAGGCACCCGAAGGAGGAGAGG - Intergenic
1044251598 8:90009154-90009176 GGAGACAGGGGCAGGAGAAGAGG - Intronic
1044318688 8:90778025-90778047 GGAGGGACCGGCTGGAGCTGTGG - Intronic
1044437654 8:92184634-92184656 GTTGCCAGGGGCTGGAGGAGAGG - Intergenic
1044455515 8:92388498-92388520 GAAGGTAGTGGTTGGAGGAGTGG + Intergenic
1044656503 8:94553777-94553799 GGAGACGGTGGATGGAGGAGGGG + Intergenic
1044660462 8:94590206-94590228 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1045277765 8:100722432-100722454 GGAGGCAGGGGCGGGCGGGGCGG - Exonic
1045331821 8:101161979-101162001 GGAGGCAGAGGCAGGAGAATGGG - Intergenic
1045448071 8:102288233-102288255 GGAGGGTGTGGCTGGAGAAGAGG - Exonic
1045593587 8:103627636-103627658 GGAGGGACCGGCTGGAGCCGAGG - Intronic
1045638688 8:104223406-104223428 GGAGGCGGTGGCGGGCGGAGCGG - Intronic
1046037773 8:108864664-108864686 GCAGGCTGCAGCTGGAGGATTGG + Intergenic
1046108404 8:109692733-109692755 GGAGGCAGCGAAAGGAGAAGGGG - Intergenic
1046748024 8:117896937-117896959 GGAGGCAGAGGCTGGGGGGCTGG - Intronic
1046870826 8:119204383-119204405 GGAAGAAGGGGATGGAGGAGGGG + Intronic
1047220585 8:122915342-122915364 GGAGGGAGCAGCTGCAGGATGGG - Intronic
1047327613 8:123854720-123854742 GGAGGAAGCAGCTTGAGCAGAGG + Intronic
1047755911 8:127918213-127918235 GAAGGCAGTGGATGGGGGAGTGG + Intergenic
1047848275 8:128827151-128827173 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1047874388 8:129119573-129119595 GGAGGCAGTGGCAAGAGAAGAGG - Intergenic
1047974086 8:130112253-130112275 GGGGGGAGATGCTGGAGGAGTGG + Exonic
1048072846 8:131040146-131040168 GGAGGCAGCGGCAGCGGGAGTGG - Exonic
1048176459 8:132156925-132156947 GGAGGCAGAGATTGGAGGAATGG + Intronic
1048345721 8:133572707-133572729 GGAGGCTGCGGCTGGAGCTTGGG + Intergenic
1048426587 8:134329155-134329177 CGTGGTAGCTGCTGGAGGAGGGG - Intergenic
1048573189 8:135671652-135671674 GGAGGCAGGGGCTGGAGAGAAGG + Intergenic
1048580894 8:135729134-135729156 GGAGACAGCTGAAGGAGGAGTGG - Intergenic
1049166373 8:141128555-141128577 GGAGGCGGGGCCTGGAGGGGCGG - Intronic
1049241849 8:141541825-141541847 GGAGGAAGAGGCTGCAGGAGTGG - Intergenic
1049257305 8:141620808-141620830 GGAGGCAGCTCCTACAGGAGAGG - Intergenic
1049266111 8:141668695-141668717 TGAGGAAGGGGCTGGAGCAGTGG + Intergenic
1049362005 8:142216322-142216344 AGAGGCAGGGGCTGGGGGTGTGG + Intronic
1049660446 8:143817445-143817467 GGAAGCAGTGGCCGGAGCAGCGG - Exonic
1049676471 8:143891481-143891503 GAGGACAGTGGCTGGAGGAGGGG - Intergenic
1049691154 8:143959890-143959912 GGAGGCTGAGGCAGGAGAAGTGG + Intronic
1049706556 8:144045860-144045882 GGGGGCAGCGGCAGGCTGAGTGG + Intronic
1049712451 8:144071387-144071409 GGAGGCTGAGGCGGGAGAAGTGG - Intergenic
1049729131 8:144167061-144167083 GGAGGCACCTGCTGGGGCAGAGG - Intronic
1049747390 8:144268805-144268827 GGAGGCAGCGGCAGGGACAGAGG + Intronic
1049756286 8:144312575-144312597 GCAGGCAGGGGCTGGGGGTGTGG - Intronic
1049791659 8:144475162-144475184 GGAAGCATCGGTTGGAGGAAAGG + Exonic
1049858890 8:144883664-144883686 GAATGCAGTGGCAGGAGGAGGGG + Intronic
1050066368 9:1763828-1763850 GGAGGCTGAGGCTGGAGGATAGG + Intergenic
1050425774 9:5511230-5511252 AGAGGCAGCTGTTGGTGGAGGGG + Intronic
1050556264 9:6792100-6792122 GGAGGCAGAGGCTGGCGGATTGG + Intronic
1050598449 9:7227256-7227278 GGCGGCAGCTTCTGGAGGAAGGG - Intergenic
1051350295 9:16192456-16192478 GGAGGCAGAGGCGGGTGGGGTGG - Intergenic
1051449735 9:17181969-17181991 GGGAGCAGGGGCTGGAGGAGTGG + Intronic
1051637874 9:19197275-19197297 GGAGGCAGAGGCAGGAGGACTGG + Intergenic
1052059777 9:23946027-23946049 GGACTCCTCGGCTGGAGGAGGGG + Intergenic
1052812518 9:33074222-33074244 GGAGGCTGAGGCAGGAGGATTGG + Intronic
1052813255 9:33080155-33080177 GGAGGCTGAGGCGGGAGGATTGG + Intergenic
1053256041 9:36616039-36616061 GGAAGCAGCGGCTGGAGGAGCGG - Intronic
1053457065 9:38241542-38241564 GGAGGCAGCGGCTGGAGGAGCGG + Intergenic
1053511909 9:38694833-38694855 GGAGGCAGAGGCTGGAGAGGAGG - Intergenic
1053575211 9:39353124-39353146 GGTGGAAGCTGCTGGAGGTGAGG - Intergenic
1053786351 9:41655254-41655276 GGAGGCGGGGGCGGGAGGGGAGG + Intergenic
1053839715 9:42181058-42181080 GGTGGAAGCTGCTGGAGGTGAGG - Intergenic
1053900734 9:42793089-42793111 GGGGGCGGTGGCCGGAGGAGGGG + Intergenic
1054096773 9:60911807-60911829 GGTGGAAGCTGCTGGAGGTGAGG - Intergenic
1054118177 9:61187433-61187455 GGTGGAAGCTGCTGGAGGTGAGG - Intergenic
1054175072 9:61869210-61869232 GGAGGCGGGGGCGGGAGGGGAGG + Intergenic
1054589578 9:66995131-66995153 GGTGGAAGCTGCTGGAGGTGAGG + Intergenic
1054662465 9:67711583-67711605 GGAGGCGGGGGCGGGAGGGGAGG - Intergenic
1054722201 9:68615337-68615359 GGAGGCAGAAACTGGAGGGGAGG + Intergenic
1054835560 9:69672235-69672257 GGAGGCAGCAGCGGCTGGAGCGG - Exonic
1055035964 9:71818818-71818840 GGAGACAGAGGCTGAAGTAGAGG - Intergenic
1055480004 9:76700216-76700238 AGAGGCTGAGGCTGAAGGAGGGG + Intronic
1056711331 9:88994236-88994258 GGAGACCGAGGCTGGGGGAGGGG - Exonic
1057034706 9:91803384-91803406 GCTGCCAGAGGCTGGAGGAGGGG + Intronic
1057412005 9:94825116-94825138 GGAGGGAGAGAATGGAGGAGAGG + Intronic
1057704630 9:97388168-97388190 AGAGGCAGCAGCTGCAGGTGGGG - Intergenic
1059058117 9:111005635-111005657 TGAGGCAGAGGCTGGATCAGGGG - Intronic
1059191689 9:112333351-112333373 GGCGCCGGCGGCCGGAGGAGCGG - Intronic
1059210857 9:112513702-112513724 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1059393983 9:114018966-114018988 GGAGGCAGGGGCTGGACTTGAGG + Intronic
1059633961 9:116154402-116154424 GGCGGCAGCAGCGGGAGGCGAGG + Exonic
1059818720 9:117948110-117948132 GGAGGCAGAGGTTGCAGTAGCGG + Intergenic
1060064776 9:120495055-120495077 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1060484667 9:124039586-124039608 GGAGGCAGGGGGTGGATGTGAGG + Intergenic
1060634563 9:125189747-125189769 GGCGGCGGCGGCTGTAGCAGCGG + Exonic
1060688037 9:125630227-125630249 GGAGGCTGAGGCAGGAGGATCGG - Intronic
1061011852 9:127960588-127960610 GGAAGCAGCTGCTGGAGGCCTGG + Intronic
1061035087 9:128108966-128108988 GTGGGCGGGGGCTGGAGGAGAGG + Exonic
1061050307 9:128191351-128191373 GGAGGAGGCGGCTGGCGGGGTGG - Intronic
1061275786 9:129568874-129568896 GGAGGGAGAGGCCGGAGCAGGGG + Intergenic
1061286500 9:129626322-129626344 GTAGGCAGCCGCTGGGAGAGGGG + Intronic
1061290650 9:129648871-129648893 GGTAGCAGGGGCTGGAGCAGGGG + Intergenic
1061294566 9:129669997-129670019 GGTGCCAGGGGCTGGGGGAGGGG - Intronic
1061297366 9:129684033-129684055 GGAGGCAGCGATGGGAGCAGAGG + Intronic
1061413758 9:130434493-130434515 GGAGGCTGAGGCGGGAGGATCGG - Intergenic
1061432656 9:130540993-130541015 GGAGGCAGCAGATGAAGGTGGGG + Intergenic
1061449324 9:130660055-130660077 GACGGCAGCGGGCGGAGGAGGGG + Intergenic
1061493879 9:130960884-130960906 GAAGGCAGGGGCTGCTGGAGGGG - Intergenic
1061495788 9:130973533-130973555 TGTGGCACCGGCTGGAGGGGTGG - Intergenic
1061539008 9:131267279-131267301 GGAGTCTGAGGCTGGAGGTGAGG + Intronic
1061695907 9:132373251-132373273 GGAGGCCGAGGCGGGAGGATCGG - Intergenic
1061747746 9:132752751-132752773 GGAGCCAGCTGCAGGAGGAGGGG - Intronic
1061761507 9:132855051-132855073 GGGTGCAGCGGGTGGAGGAAGGG - Intronic
1061808727 9:133150269-133150291 GGAGACTGCGGCTGGTGCAGTGG - Intergenic
1061858421 9:133455627-133455649 TCAGGCAGCTGCTGCAGGAGGGG + Intronic
1061941781 9:133887769-133887791 GGAGGCAGAGGCAGGGGCAGGGG - Intronic
1061946964 9:133913924-133913946 GGAGGCAGAGTCTGGGGGAGTGG - Intronic
1061949983 9:133930767-133930789 GGAGGGAGGGGCAGCAGGAGAGG + Intronic
1061980127 9:134097750-134097772 GGAGGCTGAGGCAGGAGGATGGG + Intergenic
1061984094 9:134119067-134119089 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1061995256 9:134179962-134179984 GGAGCCATCGGCTGAGGGAGAGG - Intergenic
1062122175 9:134839676-134839698 GGGAGCAGAGGCCGGAGGAGAGG + Intronic
1062264823 9:135682125-135682147 GGTGGCAGCCACTGGGGGAGAGG - Intergenic
1062321640 9:135993151-135993173 GGAGGCTGCTGCTGGGGGAGGGG + Intergenic
1062383472 9:136298777-136298799 GGTGCCAGGGGCTGGGGGAGAGG + Intronic
1062412733 9:136433133-136433155 GGTGGGCGCGGCTGGAGGGGTGG - Exonic
1062477493 9:136736047-136736069 GGAGGGAGGGGCAGCAGGAGGGG - Intergenic
1062480211 9:136747622-136747644 GGAGGCTGAGGCTGGAGGGTTGG - Intronic
1062480219 9:136747650-136747672 GGAGGCTGAGGCTGGAGGTTTGG - Intronic
1062623667 9:137433659-137433681 TGAGGCAGCTGCTGGAAGAGGGG + Intronic
1062675188 9:137738877-137738899 GGAGTCTGGGGCTGGAGGAAGGG + Intronic
1062687621 9:137823200-137823222 GGAGGCTGAGGCTGGAGAATGGG - Intronic
1062722652 9:138052485-138052507 GGAGGGAGATGCTGGAGGTGAGG + Intronic
1203654119 Un_KI270752v1:7323-7345 GGAGGCAGAGGCAGAAGCAGAGG - Intergenic
1185644882 X:1609482-1609504 CGCGGCAGCGGCAGCAGGAGAGG - Intergenic
1186002566 X:5029428-5029450 GGAGGCTGAGGCAGGAGGACTGG - Intergenic
1186217692 X:7317570-7317592 GGAGGCTGAGGCAGGAGGATTGG - Intronic
1186228530 X:7427717-7427739 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1186430264 X:9498980-9499002 GGAGGCAGAGCCTGCTGGAGGGG - Intronic
1186768048 X:12791404-12791426 GGAGGCTGCTGCTGCGGGAGCGG - Exonic
1186853218 X:13600967-13600989 GTTGCCAGGGGCTGGAGGAGGGG - Intronic
1186917956 X:14244134-14244156 GGACGCAGCTGTTGGGGGAGGGG - Intergenic
1187056088 X:15742615-15742637 GGAGGCCGAGGCGGGAGGAGAGG - Intronic
1187976699 X:24710074-24710096 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1188762012 X:34044012-34044034 GGAGGCAGAGGGAGGAGGTGAGG + Intergenic
1188803455 X:34559525-34559547 GGAGGAAGTGGGTGGAGAAGTGG - Intergenic
1189292287 X:39894917-39894939 GGAGGCAGAAGAAGGAGGAGGGG - Intergenic
1189367480 X:40400143-40400165 GGAGGCTGAGGCAGGAGGATTGG - Intergenic
1189407112 X:40735348-40735370 GGAGGCGGCGGCGGGGGCAGCGG - Exonic
1189828378 X:44944246-44944268 GGAGGCCGAGGCTGGAGAATTGG + Intronic
1189834346 X:45005261-45005283 GGAGGCAGTGGCTGTCTGAGGGG + Intronic
1189860895 X:45270777-45270799 GCAGTCAGCAGCTGGAGGTGAGG - Intergenic
1189958232 X:46298524-46298546 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1190329316 X:49226059-49226081 GGAGGCGGCGGCTGGGGGAAGGG + Exonic
1190875205 X:54455406-54455428 GGAGGTAGGCGCTGGAGGAAAGG + Intronic
1191054965 X:56232250-56232272 GGAGGCGGCCGCCGGAGGCGAGG + Intergenic
1191618315 X:63190340-63190362 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1191670582 X:63745039-63745061 GGAGAGAGTGGGTGGAGGAGAGG + Intronic
1191830017 X:65406707-65406729 GGCGGCGGCGGCGGTAGGAGCGG + Intronic
1191942892 X:66499436-66499458 AGGGACAGAGGCTGGAGGAGGGG - Intergenic
1192220912 X:69196763-69196785 GGGGGCACCTGCTGGAGGAATGG + Intergenic
1192621077 X:72680836-72680858 GGAGGCAGCGGCTGGAGGAGCGG + Intronic
1192623051 X:72699267-72699289 GGAGGCCGAGGCAGGTGGAGGGG + Intronic
1192709260 X:73563107-73563129 GGGGGCGGCTGCTGGAGGCGGGG - Intergenic
1192785945 X:74335384-74335406 GGAGGCAGAGGTTGCATGAGTGG + Intergenic
1193088359 X:77467894-77467916 GGAGGTAGGGCCTGGAAGAGAGG - Intergenic
1193221766 X:78934972-78934994 GGAGGAAGGGGCTGCGGGAGGGG + Intergenic
1193601060 X:83508776-83508798 AGAGGCGGCAGCTGGAGGTGGGG - Exonic
1194026913 X:88764134-88764156 GGAGGCTGAGGCTGGAGAATTGG + Intergenic
1195004975 X:100676810-100676832 GGAGTCTGCAGCTAGAGGAGAGG - Intronic
1195036324 X:100973398-100973420 GGAGGCAGCGGCTGGAGGAGCGG - Intronic
1196404618 X:115348274-115348296 GGAGGCAGCGGCTGGAGGAGCGG - Intergenic
1196447110 X:115851221-115851243 TGAGGGAGCCACTGGAGGAGAGG - Intergenic
1196448449 X:115857183-115857205 TGAGGGAGCCACTGGAGGAGAGG - Intergenic
1196454479 X:115884070-115884092 TGAGGGAGCCACTGGAGGAGAGG - Intergenic
1196657334 X:118232207-118232229 GGAGGAAGAGGAAGGAGGAGGGG + Intergenic
1196856149 X:119986867-119986889 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1196944190 X:120807864-120807886 GGAGGGACCGGCTGGAGCCGTGG + Intergenic
1197041322 X:121939294-121939316 GGAGGGAACGGCTGGAGCCGAGG + Intergenic
1197557088 X:127968982-127969004 GGAGGGACCGGCTGGAGCCGAGG - Intergenic
1197881260 X:131169345-131169367 GGAGGAAGGGGCTGGAGAACAGG + Intergenic
1198026858 X:132715329-132715351 GGAGGCTGAGGCAGGAGGAGCGG + Intronic
1198321422 X:135521657-135521679 GGAGGGAGGGGAGGGAGGAGCGG + Intronic
1198435518 X:136613177-136613199 GGAGGCAGAGGTTGCAGTAGCGG - Intergenic
1198450983 X:136767163-136767185 TGAGGGAGCAGCTGGAGGACAGG - Intronic
1198497708 X:137209754-137209776 GGATGCAGGGGTTGGTGGAGTGG - Intergenic
1198517827 X:137427061-137427083 GGAGGAAGGGGATGGGGGAGGGG + Intergenic
1198564445 X:137889857-137889879 GGAGGCTGAGGCAGGAGGATTGG + Intergenic
1199364025 X:146957239-146957261 GGAGGGACCGGCTGGAGCCGCGG + Intergenic
1199765929 X:150941715-150941737 GGAGAGAGCTGCTGGGGGAGGGG + Intergenic
1199808860 X:151329162-151329184 GGTGTCAGGGGCTGGTGGAGGGG + Intergenic
1199995596 X:153023491-153023513 GGAGGCTGAGGCAGGAGGATAGG + Intergenic
1200075608 X:153549166-153549188 GGAGGCAGTGGGAGGAGGTGGGG + Intronic
1200101538 X:153691091-153691113 CTAGGGGGCGGCTGGAGGAGAGG + Intronic
1200119532 X:153783810-153783832 AGAAGCGGCTGCTGGAGGAGCGG + Exonic
1200158903 X:153994363-153994385 GGTGGCAAGTGCTGGAGGAGGGG + Intergenic
1200292498 X:154886377-154886399 GGCGGCAGCGGCTGCAGGCCTGG + Exonic
1200339342 X:155382117-155382139 GGCGGCAGCGGCTGCAGGCCTGG + Exonic
1200347128 X:155458576-155458598 GGCGGCAGCGGCTGCAGGCCTGG - Exonic
1200684064 Y:6244805-6244827 GGAGGCAGGGGATGGGGGACAGG - Intergenic
1201048571 Y:9909581-9909603 GGAGGCAGGGGATGGGGGACAGG + Intergenic
1201063886 Y:10070599-10070621 GGAGGCAGGGGATGGGGGACAGG + Intergenic
1201146448 Y:11067591-11067613 GGAGGGAGAGGAAGGAGGAGAGG + Intergenic
1202115474 Y:21466703-21466725 GGAGGCAGGGGATGGGGGACAGG - Intergenic