ID: 959419596

View in Genome Browser
Species Human (GRCh38)
Location 3:106112662-106112684
Sequence TCCTCCAGCCGCTGCCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419591_959419596 -5 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419581_959419596 27 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419586_959419596 9 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419592_959419596 -6 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419589_959419596 3 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419588_959419596 4 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data
959419590_959419596 -4 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT No data
Right 959419596 3:106112662-106112684 TCCTCCAGCCGCTGCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419596 Original CRISPR TCCTCCAGCCGCTGCCTCCC CGG Intergenic