ID: 959419597

View in Genome Browser
Species Human (GRCh38)
Location 3:106112663-106112685
Sequence GCCGGGGAGGCAGCGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419597_959419605 -6 Left 959419597 3:106112663-106112685 CCTCCAGCCGCTGCCTCCCCGGC No data
Right 959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG No data
959419597_959419607 -3 Left 959419597 3:106112663-106112685 CCTCCAGCCGCTGCCTCCCCGGC No data
Right 959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG 0: 46
1: 12
2: 3
3: 33
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419597 Original CRISPR GCCGGGGAGGCAGCGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr