ID: 959419598

View in Genome Browser
Species Human (GRCh38)
Location 3:106112665-106112687
Sequence TCCAGCCGCTGCCTCCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419589_959419598 6 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419581_959419598 30 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419586_959419598 12 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419590_959419598 -1 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419588_959419598 7 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419592_959419598 -3 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419591_959419598 -2 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC No data
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419598 Original CRISPR TCCAGCCGCTGCCTCCCCGG CGG Intergenic