ID: 959419598

View in Genome Browser
Species Human (GRCh38)
Location 3:106112665-106112687
Sequence TCCAGCCGCTGCCTCCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419590_959419598 -1 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT 0: 62
1: 8
2: 1
3: 13
4: 130
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419581_959419598 30 Left 959419581 3:106112612-106112634 CCAAGGCAGGCGGCTGCTCCTTG 0: 68
1: 10
2: 0
3: 31
4: 190
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419591_959419598 -2 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC 0: 67
1: 6
2: 1
3: 18
4: 221
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419586_959419598 12 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG 0: 66
1: 10
2: 2
3: 30
4: 250
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419588_959419598 7 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT 0: 61
1: 11
2: 0
3: 3
4: 108
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419589_959419598 6 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC 0: 61
1: 11
2: 0
3: 27
4: 278
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data
959419592_959419598 -3 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC 0: 65
1: 6
2: 3
3: 38
4: 332
Right 959419598 3:106112665-106112687 TCCAGCCGCTGCCTCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419598 Original CRISPR TCCAGCCGCTGCCTCCCCGG CGG Intergenic
No off target data available for this crispr