ID: 959419601

View in Genome Browser
Species Human (GRCh38)
Location 3:106112675-106112697
Sequence GCCTCCCCGGCGGCGCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959419589_959419601 16 Left 959419589 3:106112636-106112658 CCTCGGGCCCCGCGGGGCCCGTC No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419594_959419601 -2 Left 959419594 3:106112654-106112676 CCGTCCGCTCCTCCAGCCGCTGC No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419590_959419601 9 Left 959419590 3:106112643-106112665 CCCCGCGGGGCCCGTCCGCTCCT No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419591_959419601 8 Left 959419591 3:106112644-106112666 CCCGCGGGGCCCGTCCGCTCCTC No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419588_959419601 17 Left 959419588 3:106112635-106112657 CCCTCGGGCCCCGCGGGGCCCGT No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419593_959419601 -1 Left 959419593 3:106112653-106112675 CCCGTCCGCTCCTCCAGCCGCTG No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419595_959419601 -6 Left 959419595 3:106112658-106112680 CCGCTCCTCCAGCCGCTGCCTCC No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419586_959419601 22 Left 959419586 3:106112630-106112652 CCTTGCCCTCGGGCCCCGCGGGG No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data
959419592_959419601 7 Left 959419592 3:106112645-106112667 CCGCGGGGCCCGTCCGCTCCTCC No data
Right 959419601 3:106112675-106112697 GCCTCCCCGGCGGCGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959419601 Original CRISPR GCCTCCCCGGCGGCGCTCGC CGG Intergenic